ID: 902935006

View in Genome Browser
Species Human (GRCh38)
Location 1:19758739-19758761
Sequence GCAAGTTGGCAGTAGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902935006_902935018 30 Left 902935006 1:19758739-19758761 CCCAGGCTCTACTGCCAACTTGC 0: 1
1: 0
2: 0
3: 14
4: 164
Right 902935018 1:19758792-19758814 CCCAATGAAAGGTGCCCCACAGG 0: 1
1: 0
2: 0
3: 10
4: 81
902935006_902935015 19 Left 902935006 1:19758739-19758761 CCCAGGCTCTACTGCCAACTTGC 0: 1
1: 0
2: 0
3: 14
4: 164
Right 902935015 1:19758781-19758803 TGAGAGCCTGTCCCAATGAAAGG 0: 1
1: 0
2: 3
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902935006 Original CRISPR GCAAGTTGGCAGTAGAGCCT GGG (reversed) Intronic
900890867 1:5448757-5448779 GCAAGTTGGAAGTTGGGCTTTGG + Intergenic
900934183 1:5755005-5755027 GCAAGAAGGCAGCAGAGCCAAGG - Intergenic
902186823 1:14731677-14731699 GCTAGTGGGTAGCAGAGCCTGGG + Intronic
902727803 1:18348832-18348854 GCAAGTTGGCAGCAAAGTCAGGG - Intronic
902728818 1:18355073-18355095 GGATGTTGGGAGCAGAGCCTGGG + Intronic
902749519 1:18497774-18497796 GCTAGTTGGTAGCAGAGCCCAGG - Intergenic
902935006 1:19758739-19758761 GCAAGTTGGCAGTAGAGCCTGGG - Intronic
902987359 1:20163093-20163115 GCATGTTGGCAGTTTAGCCTGGG + Intronic
904289290 1:29473771-29473793 GCAGGTCGGCAGTGGATCCTGGG - Intergenic
904976428 1:34460473-34460495 GCAAGTTGGCAGAAGGGCCCTGG - Intergenic
907748343 1:57237500-57237522 GCTAGTTGGCAGTAGAAAATGGG - Intronic
907865062 1:58391363-58391385 GCCAGCTGGCAGAAGAGCTTGGG + Intronic
910945563 1:92588358-92588380 GCAAGTCTGAAGTAGAGTCTGGG - Intronic
913392504 1:118330080-118330102 GGGAGTTGGCAGGATAGCCTGGG + Intergenic
913664818 1:121037539-121037561 GTAAGTTGGCCGCAGAGCTTAGG - Intergenic
914016211 1:143820814-143820836 GTAAGTTGGCCGCAGAGCTTAGG - Intergenic
914161571 1:145140194-145140216 GTAAGTTGGCCGCAGAGCTTAGG + Intergenic
914451593 1:147797697-147797719 GCTAGTAAGCAGTGGAGCCTGGG - Intergenic
914654828 1:149729355-149729377 GTAAGTTGGCCGCAGAGCTTAGG - Intergenic
918098620 1:181354703-181354725 GGAAAAGGGCAGTAGAGCCTTGG + Intergenic
919573869 1:199282240-199282262 GAAGGTTGGCAGTAGACCATTGG - Intergenic
919938600 1:202271285-202271307 GCCAGATGGCAGGGGAGCCTAGG + Intronic
921565404 1:216711304-216711326 CCGAGTTGGCAGTGGAGCCGAGG - Intronic
922110256 1:222548813-222548835 TCAAGATGGCAGTAGGGGCTGGG + Intergenic
922911950 1:229225660-229225682 GCAGGAGGGCACTAGAGCCTTGG - Intergenic
1063585736 10:7350473-7350495 GCAAGATGGCACTAAAGCGTGGG - Intronic
1067747818 10:48949593-48949615 CCAGGTTGGGAGTAGTGCCTTGG - Intronic
1069718073 10:70533472-70533494 GCAAGTTGGCAGCCCAGCCACGG - Intronic
1069815565 10:71191654-71191676 GGAAGTTGGCAGCAGAGCAGGGG - Intergenic
1069945930 10:71985592-71985614 GCAAGTTGGAAGTAGAGGTGGGG - Intronic
1071394123 10:85204994-85205016 GGGGGTTGGCAGTAGATCCTGGG - Intergenic
1072135872 10:92545354-92545376 GGAAGTTGTCAGTAGATTCTTGG - Intronic
1073755045 10:106572544-106572566 GCCAGTGGGCCGTGGAGCCTGGG - Intergenic
1074269194 10:111936323-111936345 GCCAGTTGGCAAGGGAGCCTGGG - Intergenic
1075483389 10:122800387-122800409 GCCTGGGGGCAGTAGAGCCTGGG + Intergenic
1076593456 10:131608585-131608607 GCAAACAGGCAGTAGAGCCCTGG - Intergenic
1078063017 11:8060458-8060480 GCAAGTTGGTAGCAGAGCCAGGG - Intronic
1079019295 11:16896020-16896042 GCAAGTGGGCACCAGAACCTTGG - Intronic
1084459955 11:69291254-69291276 GCAAGTTAGCAGTGGAACCTAGG - Intergenic
1084975222 11:72793423-72793445 GCAAGCTGGAAGCAGAGCCTGGG + Exonic
1085562824 11:77487601-77487623 ACAAGTTGACTGAAGAGCCTTGG + Intergenic
1087829187 11:102800328-102800350 GGAAGTTGGAAATAGAGCCTTGG + Intergenic
1089809303 11:121118535-121118557 GCAAGTAGGCACAGGAGCCTTGG - Exonic
1091358950 11:134959228-134959250 TCAAGTCAGCACTAGAGCCTAGG + Intergenic
1097532047 12:60813754-60813776 GCAAGAAGGCTGTAAAGCCTAGG - Intergenic
1099643896 12:85325710-85325732 GCAAAGTGACAGGAGAGCCTTGG + Intergenic
1100561543 12:95752509-95752531 GCTTTGTGGCAGTAGAGCCTAGG - Intronic
1101794329 12:107958905-107958927 GGAAGTTGGCATTAGAGACCAGG + Intergenic
1101990167 12:109477646-109477668 GCAAGATGGCGGTAGTGCGTCGG + Exonic
1102444946 12:112994804-112994826 GCAAGGTGGCAGCAGGGCCCTGG - Intronic
1103003493 12:117404088-117404110 GCAAGTTGGCAGTTTGGGCTGGG - Intronic
1103786566 12:123437040-123437062 GCAAATTGTCACTAGGGCCTGGG + Intergenic
1104270145 12:127276082-127276104 GCAAGGAGGCAGTAAAGCATGGG + Intergenic
1105597616 13:21854107-21854129 GCTGGTTAGCAGTGGAGCCTGGG + Intergenic
1107879496 13:44820720-44820742 GCTGGTTGGCAAGAGAGCCTTGG + Intergenic
1108373446 13:49792644-49792666 GCGAGGTGGCAGTAGCGCCGGGG + Exonic
1108606134 13:52040378-52040400 TCAAGGTGCCAGTAGAGGCTGGG - Intronic
1110596738 13:77327416-77327438 TCCTGTTGGCAGCAGAGCCTTGG - Intergenic
1113411450 13:110093864-110093886 GCAAGTTAGGAGCAGAGCCAGGG - Intergenic
1116788223 14:49311232-49311254 TCAAGTGGGCAGTCCAGCCTTGG + Intergenic
1119092684 14:71799380-71799402 GCAAGTTGGCAGAGCAGCCATGG - Intergenic
1119854557 14:77889631-77889653 GCAAGTTGGCAAGGGAGCCTGGG + Intronic
1120521005 14:85528706-85528728 CCAAGGTGGCAGCAGAGCATAGG - Exonic
1124822959 15:33066174-33066196 GCAAGATGGCAGTATAGCCCAGG - Intronic
1129687064 15:77692631-77692653 GGAAATTGGCAGAAAAGCCTAGG - Intronic
1131068699 15:89450470-89450492 GCCAGTTGGCCGTAGTGCCCTGG + Intergenic
1132914697 16:2337591-2337613 ACAAGTTGGAAGAACAGCCTGGG - Intronic
1134068828 16:11248128-11248150 GCAGGTAGGTAGCAGAGCCTTGG - Intergenic
1135193656 16:20376510-20376532 GCCTGTTGGCAGTTGAACCTTGG - Intronic
1135409124 16:22219924-22219946 GCAGGTTGGAAGGAGAGCCAAGG + Intronic
1135534673 16:23284069-23284091 ACCAGTTGGCAGTAGAGCTTGGG + Intronic
1136505025 16:30697891-30697913 GCAAGTTAGCAGTGGAACCTGGG - Intergenic
1139265154 16:65631508-65631530 GCAAGATGGCAGGAAACCCTGGG - Intergenic
1139521029 16:67482887-67482909 GCAGGATGGCAGTGGAGCATGGG + Intronic
1140612327 16:76615708-76615730 GAAAGTGTGCAGTAAAGCCTGGG - Intronic
1142268413 16:89076896-89076918 CCAAGTTGGCAGTTGAGGATTGG + Intergenic
1142776880 17:2147435-2147457 GCAAGTTAGGATCAGAGCCTAGG + Intronic
1143798305 17:9356549-9356571 GCCAGCTGGCAGGGGAGCCTGGG - Intronic
1143897182 17:10145457-10145479 GGAAGGAGGCAGTAGAGGCTTGG + Intronic
1149603314 17:57907348-57907370 GGAAGTGGGCAGGAGAGGCTGGG + Intronic
1149789145 17:59462132-59462154 TCGAGTAGGCAGTAGAGACTTGG + Intergenic
1152588473 17:81199595-81199617 GCAGCTTGGCTGTGGAGCCTGGG - Intronic
1155969958 18:32073494-32073516 GCAAAATGGCAATAGTGCCTAGG + Intergenic
1157972080 18:52282482-52282504 GTAGGTTGGCAGTAGGGCCCAGG + Intergenic
1161316326 19:3619257-3619279 GGAAGGTGGCATCAGAGCCTGGG + Intronic
1165074156 19:33271494-33271516 GCATGGTGGCTGGAGAGCCTAGG + Intergenic
1165309063 19:35019597-35019619 TCAAGTCAGCAGCAGAGCCTTGG + Intronic
1165904897 19:39187724-39187746 GCAAGTTGGAAGCGGTGCCTCGG + Intergenic
1166258143 19:41620268-41620290 GCAGGGTGGGAGGAGAGCCTGGG + Intronic
926382029 2:12300609-12300631 GCAAGTTGGCACTGGTGCCAAGG - Intergenic
926565594 2:14467966-14467988 GGAAGTTAGCAGTAGACTCTTGG - Intergenic
931128060 2:59299393-59299415 GCAAGTTCGCGGCAGAGCCAGGG + Intergenic
935700827 2:105810352-105810374 GCAAGCTGGCAGTAGAGGGAGGG + Intronic
940368104 2:152871198-152871220 GCCAGTTGTCAATGGAGCCTGGG + Intergenic
941751898 2:169142871-169142893 GCCAGGTGACAGCAGAGCCTAGG + Intronic
946174295 2:217913134-217913156 GGATGCTGGCAGTGGAGCCTGGG + Intronic
947268854 2:228310569-228310591 GAAAGTTGGGATTTGAGCCTAGG + Intergenic
948002517 2:234580049-234580071 GCCAGATGGCAGGAGAGACTGGG - Intergenic
948215000 2:236221989-236222011 GCAAGGTTGCAGGGGAGCCTTGG + Intronic
1168927900 20:1598130-1598152 GGAAGTAGGCAGGAGAGACTGGG + Intronic
1169129039 20:3154097-3154119 GAAAGTTGGCAGTAGAGATATGG + Intronic
1170315013 20:15032073-15032095 GCCAGGTGGCAGGAGTGCCTGGG + Intronic
1170581348 20:17701802-17701824 GCAAATTGGCTCTGGAGCCTTGG - Intronic
1171797826 20:29580078-29580100 GCAAGTGGGAGGAAGAGCCTGGG + Intergenic
1171850421 20:30304082-30304104 GCAAGTGGGAGGAAGAGCCTGGG - Intergenic
1172824754 20:37771931-37771953 GAAAGTGGGCAGTATAGGCTGGG - Intronic
1174606288 20:51764211-51764233 GCTAGTAAGCAGCAGAGCCTGGG + Intronic
1183040357 22:35173179-35173201 GCAGGCTGGCAGTAAAGCCAGGG - Intergenic
1184291877 22:43501725-43501747 GCCAGTAGGCAGCAGAGCCTGGG + Intronic
1184516757 22:44966917-44966939 GCAAGTTGGATGGAGAGGCTGGG - Intronic
1184518172 22:44975782-44975804 GCGAGTTGGAAGTGGAGCCCTGG - Intronic
949246390 3:1929874-1929896 GCAAGTTGGCATTGGAACCATGG - Intergenic
949766590 3:7533788-7533810 GAAAGTTGGCAGTTGAACATAGG - Intronic
951254774 3:20435640-20435662 ACAAGCTGGCTGTAGAGCCTTGG + Intergenic
952988404 3:38808909-38808931 GCAAGTTGGCAGAACATCCAGGG - Intergenic
957305754 3:78456646-78456668 ACAAATTGGCAGTAGTGCCAAGG + Intergenic
957367688 3:79247877-79247899 GCATCCTGGCAGTGGAGCCTGGG + Intronic
959214035 3:103426073-103426095 GCAAGATGGCATGAGATCCTTGG - Intergenic
961067247 3:123885630-123885652 GCAAGTTGGCAGCTGATCCAGGG + Intergenic
966852971 3:184175797-184175819 GCAAAATGGAGGTAGAGCCTGGG - Intronic
976227918 4:82811135-82811157 GCAATTTGGCAGTAGGGAATTGG + Intergenic
976325063 4:83762096-83762118 GAAAGTGGGCAGTAGAGGGTGGG - Intergenic
978089640 4:104699332-104699354 GCTAGTTGGCAGCAGAGCTGAGG + Intergenic
981075554 4:140587656-140587678 GCAAGCAGGCAGTAAAGCCAAGG - Intergenic
981114911 4:140978221-140978243 TCAAGTTGGCAGCAGAGTCTTGG - Intronic
982071245 4:151696489-151696511 GCAAGCGGGCAGCAGAGCTTAGG + Intronic
982864592 4:160493947-160493969 ACAAGTTGGGAGTAGAGCACAGG + Intergenic
984269436 4:177533286-177533308 GCAAGTTCGAAGTAAATCCTAGG - Intergenic
988674089 5:33413402-33413424 CCAAGTTGGCATTAGGGCCATGG - Intergenic
988891532 5:35622557-35622579 GCAAGTTAGCAGGAGATTCTGGG + Intronic
991034368 5:62113366-62113388 GCAAGTTGATAGTAGGGCATAGG + Intergenic
993063998 5:83076484-83076506 GGAAGATGGCAGTTGAGACTAGG - Intronic
998739627 5:145185686-145185708 GTAAGTTGGAAGTGGAGCCGGGG + Intergenic
1000277521 5:159751691-159751713 GCAAGTTGGAAGTTTAGGCTGGG - Intergenic
1003169894 6:3712917-3712939 GCAAGGTGGCAGTTGAGATTTGG - Intergenic
1004919483 6:20362814-20362836 ACAATTTGGCAGTAGAAACTGGG + Intergenic
1004942913 6:20580050-20580072 GCTAGTTGGTCGTAGACCCTGGG + Intronic
1006116797 6:31779939-31779961 GCAGGTGGGCAGCAGAGCCCTGG - Intronic
1007952316 6:45883425-45883447 ACAAGGTGGAAGTAGAGCATGGG + Intergenic
1009525052 6:64733216-64733238 GCAAGTAGGCTTTAGGGCCTGGG + Intronic
1011627556 6:89296029-89296051 TCTAGTTAGAAGTAGAGCCTGGG - Intronic
1012193505 6:96310374-96310396 GCCAGTTGGCATGAGATCCTAGG - Intergenic
1015589569 6:134810010-134810032 GCAGGTTTGAAATAGAGCCTAGG - Intergenic
1018858886 6:167696371-167696393 GCAAGGTGGGCGTGGAGCCTGGG + Intergenic
1019173374 6:170147255-170147277 GCAAGCTGGCAGCAGAGTCAGGG - Intergenic
1022022920 7:26418261-26418283 GCAAGATGGCGGCAGACCCTGGG + Intergenic
1032736011 7:134693268-134693290 GCCAGTTGGTAGCAGAGCCTGGG - Intergenic
1033917652 7:146347287-146347309 GCAAGAAGGGAGTAGAGCCCAGG + Intronic
1034364647 7:150535982-150536004 GCAAGGTGGCCCTGGAGCCTGGG - Intergenic
1034425162 7:151010235-151010257 GCACCTTGGCAGAAGAGCCCAGG + Exonic
1036622084 8:10430897-10430919 GCAAGTTGCTTGTAGAGTCTGGG + Intergenic
1038931035 8:32193895-32193917 GCAAGTTAGCAGGAAGGCCTGGG + Intronic
1039575535 8:38620817-38620839 GTAAGTTGGCAGAAGAGACAGGG + Intergenic
1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG + Intergenic
1042283347 8:67079219-67079241 TCAAGTTCGCAATAGAACCTGGG - Intronic
1045512579 8:102823918-102823940 GCACATTGGCAGTAGAGCAAAGG - Intergenic
1046213675 8:111114262-111114284 GCAGGTTGACATAAGAGCCTGGG - Intergenic
1049454217 8:142678773-142678795 GCTGGCTGGCAGGAGAGCCTGGG + Intronic
1049454227 8:142678835-142678857 GCCGGCTGGCAGGAGAGCCTAGG + Intronic
1049454237 8:142678897-142678919 GCCAGCTGGCATGAGAGCCTGGG + Intronic
1051798641 9:20905718-20905740 GCCAGCTGGAAATAGAGCCTAGG + Intronic
1051858052 9:21592178-21592200 CCATGTTGGCAGGAGACCCTTGG + Intergenic
1053064301 9:35056786-35056808 GGCAGGTGGCAGTAGTGCCTTGG + Exonic
1053788201 9:41667373-41667395 GCAAGTGGGAGGAAGAGCCTGGG - Intergenic
1054156937 9:61647395-61647417 GCAAGTGGGAGGAAGAGCCTGGG + Intergenic
1054176481 9:61878712-61878734 GCAAGTGGGAGGAAGAGCCTGGG - Intergenic
1054476709 9:65578403-65578425 GCAAGTGGGAGGAAGAGCCTGGG + Intergenic
1054661057 9:67702096-67702118 GCAAGTGGGAGGAAGAGCCTGGG + Intergenic
1058167363 9:101635197-101635219 TCAAGTTGTCAGAAGAACCTAGG - Intronic
1061412112 9:130427442-130427464 GCCAGCTGGCAGGAGGGCCTGGG + Intronic
1062144721 9:134982692-134982714 GGAAGATGGCAGCAGAGACTGGG - Intergenic
1187092007 X:16106804-16106826 GGAAGGTGGCAGTAGAGCACAGG - Intergenic
1187666012 X:21610002-21610024 GCAGGTTGTTAGCAGAGCCTTGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1190066073 X:47242559-47242581 GCAAGGAGGCAGAAGGGCCTGGG + Intronic
1194914904 X:99694093-99694115 GTAATTTGTGAGTAGAGCCTTGG - Intergenic
1198076145 X:133194940-133194962 GCCAGAGGGCAGAAGAGCCTTGG + Intergenic
1199138011 X:144276108-144276130 ATAAGTTGGCAGAAGATCCTGGG - Intergenic
1201185927 Y:11402751-11402773 GCAAGGTGGCAGCATGGCCTGGG + Intergenic