ID: 902936705

View in Genome Browser
Species Human (GRCh38)
Location 1:19769771-19769793
Sequence GTGGCTTAATGCAGGCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902936705 Original CRISPR GTGGCTTAATGCAGGCATCC TGG Intronic
901689761 1:10965115-10965137 GTGGCTGAATGAGGGCAGCCTGG - Intronic
902734523 1:18391371-18391393 GTGGCTGAATGCTAGCATCACGG + Intergenic
902799518 1:18820599-18820621 GTGGGTGAATGCAGGCACACAGG - Intergenic
902936705 1:19769771-19769793 GTGGCTTAATGCAGGCATCCTGG + Intronic
904766866 1:32856319-32856341 CTGGCTTAATGCTGGCTTTCAGG - Exonic
905215221 1:36401824-36401846 GTGGCTTGGTGCAGGCCTGCAGG - Intergenic
905740374 1:40365167-40365189 GTGGCTTAATACAGGCACGTGGG - Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
909162880 1:72176628-72176650 GTGGCTTAATGAAAACAGCCTGG + Intronic
917442094 1:175077370-175077392 GTTTCTGAATACAGGCATCCTGG + Exonic
918329371 1:183442710-183442732 TTGGTTTGATTCAGGCATCCTGG - Intergenic
920825464 1:209420914-209420936 ATGGCTCCATGCAGGCCTCCCGG - Intergenic
1066292182 10:34024571-34024593 GTGGGTTAATTCAAGCATCCAGG - Intergenic
1067295114 10:44971242-44971264 GTGGCTTACTGCAGACTTCAGGG + Intronic
1068919214 10:62465322-62465344 GTGGCTTGGTGCAGGCCTGCAGG + Intronic
1068947592 10:62745055-62745077 GTGACTTAAACCAGGCATCCTGG + Intergenic
1070506172 10:77114852-77114874 GTGGCTTAATGCAGCCTACAGGG + Intronic
1072046327 10:91659644-91659666 GTGGTTAAATGCAGGGATTCTGG - Intergenic
1073290742 10:102412068-102412090 GGGGCTCAAAGGAGGCATCCTGG + Intronic
1073351031 10:102819923-102819945 GGGGATTAAGGCAGGCTTCCTGG + Intergenic
1075210942 10:120490544-120490566 GAGGCTGAGGGCAGGCATCCAGG - Intronic
1076009479 10:126975885-126975907 GTGGCTTACTCCTGTCATCCTGG - Intronic
1076384647 10:130047538-130047560 GTTACTTAGTGCAGGAATCCAGG - Intergenic
1078317267 11:10304270-10304292 ATGGATTAATGAAGGCAGCCAGG + Intergenic
1085017753 11:73186264-73186286 CTGGATTAAAGGAGGCATCCTGG - Intergenic
1086233541 11:84598872-84598894 GTGGCTTAATGCAGCCTCCAGGG - Intronic
1092044134 12:5415262-5415284 GTGGATTAATGCTGTTATCCTGG - Intergenic
1092806117 12:12224883-12224905 TTGGATTCAGGCAGGCATCCAGG - Intronic
1093232511 12:16564512-16564534 GTGGTTTACTACAGGCATCAGGG + Intronic
1096243070 12:49969706-49969728 GGAGGTTAATGCAGTCATCCTGG + Intronic
1098921415 12:76305598-76305620 ATGGCTGAATTCAGGCATTCAGG - Intergenic
1101006987 12:100410678-100410700 GTGGCTTATTGCAGTTTTCCTGG + Intronic
1103661628 12:122524738-122524760 GTAGCATAATACAGGTATCCAGG + Intronic
1105431751 13:20343377-20343399 GTTCCTTCATGCAGCCATCCTGG + Intergenic
1109748451 13:66657470-66657492 GTGACGTAATCCAGGCAACCAGG - Intronic
1111554894 13:89867869-89867891 GAGGCTTAATGCAGGTCTCTTGG + Intergenic
1111597263 13:90427834-90427856 GTGGCGCAATGCAGGCCTGCAGG + Intergenic
1113741011 13:112712404-112712426 GTGGCACAATGAAGACATCCAGG - Intronic
1114826295 14:26084525-26084547 GTGGCTTGCTCAAGGCATCCTGG - Intergenic
1116805781 14:49492881-49492903 GTACCTTAATTCAGGAATCCAGG - Intergenic
1117836779 14:59816018-59816040 GTGCCTTCATGCAGCCTTCCTGG + Intronic
1118522049 14:66596455-66596477 GTGGCTTGATGCAGGCCTGCAGG - Intronic
1119408996 14:74417201-74417223 GTGGCTAAAAGCATGCATTCTGG - Intronic
1121726916 14:96158998-96159020 GTGGTTTGATGCTGGCATCAGGG - Intergenic
1121903617 14:97718908-97718930 GTGGCTTAATGCATGCCTGGTGG + Intergenic
1122919664 14:104874780-104874802 GTGGCTTGAGCCAGGCACCCAGG + Intronic
1123040363 14:105487813-105487835 GGGGCTGAAAGCAGGCAGCCAGG + Intronic
1124338835 15:28876826-28876848 CTGCCCTAATGCAGGCATCAGGG + Intergenic
1128151596 15:65366690-65366712 TGGGCTTAATGCAGGCAAGCCGG - Intronic
1131389303 15:92034149-92034171 GGGGCTGTATGCAGGGATCCAGG + Intronic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1135175792 16:20227629-20227651 CTGGCTGAATGCAGGGAACCTGG + Intergenic
1137227057 16:46523670-46523692 GTGGCTTAAGCCTGTCATCCTGG - Intergenic
1138170331 16:54843593-54843615 CTGGCTTTATGCAGGTAGCCTGG + Intergenic
1139336091 16:66232297-66232319 GTTGCTTAAGGCAGGCTTCAGGG + Intergenic
1139594360 16:67949503-67949525 GTGGCTTCATGGAGGCATGAGGG + Intronic
1139852782 16:69961000-69961022 GGGTCTTAATGCAGGGACCCTGG + Intronic
1139881753 16:70183908-70183930 GGGTCTTAATGCAGGGACCCTGG + Intronic
1140221150 16:73045208-73045230 GTGGCTTAGTTCTAGCATCCAGG - Intronic
1140370755 16:74411598-74411620 GGGTCTTAATGCAGGGACCCTGG - Intronic
1140830744 16:78748450-78748472 GAAGCTTAATCCAGGCATGCTGG + Intronic
1144637333 17:16918559-16918581 GTGGCTTGAAGCAGGCATGAAGG + Intergenic
1146242718 17:31244865-31244887 ATGGCTGAATGGAGGCCTCCAGG - Intronic
1146472094 17:33132711-33132733 CTGGCTTTATGCAGGCATCTTGG + Intronic
1148741034 17:49892790-49892812 CAGGCTTAATGTAGGCAACCTGG - Intergenic
1149532063 17:57403351-57403373 GTGTCTTACTGGAGGCATACTGG - Intronic
1149819748 17:59764550-59764572 CTGGCTTCAAGCAGTCATCCTGG + Intronic
1149992741 17:61391887-61391909 GTGCCTCAAGGCAGGCAGCCTGG + Intronic
1150201565 17:63362543-63362565 GTGGCTTGGTGCAGGCCTGCAGG - Intronic
1157506631 18:48231057-48231079 GTGGCTTGGTGCAGGCTTGCAGG + Intronic
1165369669 19:35396899-35396921 TTGGCTAAACGCAGGCATCAGGG - Intergenic
1167239810 19:48337068-48337090 GTGGCTGAATGGAGGAATCTGGG - Intronic
1167649894 19:50723518-50723540 CCAGCTTAATGCAGGCAGCCTGG + Exonic
1168238177 19:55076322-55076344 CTCCCTCAATGCAGGCATCCAGG - Intronic
924963843 2:57853-57875 GTGGCTTAGTGCTGGCCTGCAGG + Intergenic
925080906 2:1065240-1065262 GGGTCTGAATACAGGCATCCCGG - Intronic
926048163 2:9725300-9725322 CTGGCTTAGTGCAGGCAAACGGG + Intergenic
927181635 2:20450650-20450672 GTTGCTCAAAGCAGGCAGCCTGG - Intergenic
927305912 2:21572678-21572700 GTGGCTTTATTCAGGGATCTAGG - Intergenic
928734789 2:34275599-34275621 CTGGCCTAAAGTAGGCATCCAGG + Intergenic
929379543 2:41334292-41334314 GTAGGCTGATGCAGGCATCCTGG + Intergenic
931283712 2:60815503-60815525 GGAGCTTAATGCAAGAATCCAGG - Intergenic
937041882 2:118828535-118828557 GTTGCTAAATGCAAGCATCCTGG + Intergenic
939624231 2:144457174-144457196 GTGGATTAATGCATAAATCCAGG - Intronic
941151376 2:161919218-161919240 GTGGCTTGGTGCAGGCCTGCTGG + Intronic
948857466 2:240736679-240736701 GTGGCCTCTGGCAGGCATCCTGG - Intronic
1169309318 20:4521662-4521684 GTGGCTCAATGCAGGCCTGCAGG + Intergenic
1170221510 20:13946963-13946985 ATGGCTCAATGCAGGCCTGCAGG + Intronic
1171402225 20:24881439-24881461 GTGGCTCATTGCTGTCATCCAGG - Intergenic
1177777652 21:25586805-25586827 GTTGCTTAAGGAAGGCTTCCAGG - Intronic
953213714 3:40898373-40898395 GTGCCATGATGCAGGTATCCTGG + Intergenic
954148166 3:48644607-48644629 GTGGCATTCTGCAGGCTTCCTGG - Intronic
955683569 3:61527624-61527646 GTGGCTTAATTCTGGAATCTAGG + Intergenic
958562068 3:95759745-95759767 GTGGCTCAGTGCAGGCCTGCAGG - Intergenic
959974607 3:112444624-112444646 GGGGCTTAAAACAGGAATCCTGG + Intergenic
960511403 3:118553470-118553492 GTGGCTTCATCCAGGAATCCAGG - Intergenic
962461573 3:135619116-135619138 GGAGCCTAATGCAGGCAGCCTGG + Intergenic
965115021 3:164477662-164477684 GTGGCTTGGTGCAGGCTTCCAGG + Intergenic
967021522 3:185527306-185527328 CTGGTTTAATGTAGGCACCCAGG - Intronic
968651167 4:1760844-1760866 GTGGCTCCAGGCTGGCATCCTGG + Intergenic
969570793 4:8006914-8006936 GTGCCTGAATGCTGGGATCCTGG + Intronic
972492311 4:39599490-39599512 GAGGCTAAATGCAGCAATCCAGG + Intronic
974415745 4:61604243-61604265 CTGACATAATGAAGGCATCCAGG - Intronic
976417826 4:84799503-84799525 GTGACTCAAAGCAGGCTTCCTGG - Intronic
982140968 4:152317581-152317603 GTTGCTTGATGCAGGGCTCCAGG + Intergenic
982443049 4:155459006-155459028 GTGGTTTGATTTAGGCATCCAGG + Intergenic
983942612 4:173551595-173551617 ATGGCTTAATGCAAGCTTCAAGG - Intergenic
990467715 5:56085545-56085567 GTAGCTTAATCCAGGGAGCCTGG - Intergenic
991166695 5:63571017-63571039 GGGGCTTAATTCAGGCTTGCTGG - Intergenic
993110316 5:83649276-83649298 GAGACTTAATGCAGGCAAGCTGG + Intronic
998454194 5:142258247-142258269 GAAGATTAATGCAGGCATGCAGG - Intergenic
998546375 5:143031368-143031390 GGAGGTTAATGCAGTCATCCTGG + Intronic
1001803631 5:174564767-174564789 ATGGCTTTCTGCAGGCAGCCAGG + Intergenic
1003169488 6:3709852-3709874 GTGACTGAATGCAGGCAGGCAGG + Intergenic
1012392522 6:98758551-98758573 GTGGTTTAATGTAGTCATCAGGG - Intergenic
1014155073 6:118100719-118100741 GTTGCTTAATGTAGGCGTGCTGG + Intronic
1015897611 6:138032605-138032627 GTGGATGAATGCAGGCACTCCGG + Intergenic
1019884576 7:3892821-3892843 GTGGCTTGCTGCAGGGATACGGG - Intronic
1020832589 7:13110260-13110282 GTGGCTCAGTGCAGGCCTGCAGG - Intergenic
1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG + Intergenic
1024919443 7:54542457-54542479 GTAGCTGAAAGCAGGCAGCCAGG + Exonic
1028349771 7:89831628-89831650 GTGACTTAAAGCATGCATTCTGG + Intergenic
1030523432 7:110626310-110626332 GTAGTTTAATGCATGCAACCTGG - Intergenic
1030623571 7:111818610-111818632 GGAGCTTACTGCAGCCATCCAGG - Intronic
1033595887 7:142857348-142857370 CAGGCTTCATGGAGGCATCCAGG - Intronic
1034055232 7:148027447-148027469 TTGTCTTAAGGCAGACATCCAGG + Intronic
1037572558 8:20171040-20171062 ATGGCTGAATGCAGGAACCCAGG - Intronic
1037606647 8:20443546-20443568 TTGGCTAAATGCTTGCATCCAGG - Intergenic
1042429310 8:68686442-68686464 GTGGGTTCATGCAGACATTCAGG + Intronic
1043128236 8:76427676-76427698 GTTGCTTATTTCAGGCATCTGGG + Intergenic
1043521096 8:81046313-81046335 ATGACTAAAAGCAGGCATCCTGG + Intronic
1043738375 8:83775536-83775558 GTGCCTAAATGCAGGCAGCATGG - Intergenic
1048844837 8:138596396-138596418 GTGGATTAATGAAGGCTTCCTGG - Intronic
1052543521 9:29843193-29843215 ATGGCTTACTGGAAGCATCCAGG + Intergenic
1054736927 9:68762949-68762971 GAGGCTTAATGCAAGGATCCTGG + Intronic
1058292433 9:103258649-103258671 GTGGCTCAAGGCAGGCACCCGGG + Intergenic
1060723760 9:125994526-125994548 GTGGCCAAATGCAGGCATCCAGG - Intergenic
1061642034 9:131966312-131966334 ATGGCTTACTGCAGCCCTCCTGG - Intronic
1186646631 X:11513872-11513894 GTGGCTTAGGCCAGGCATCATGG + Intronic
1186709085 X:12173904-12173926 GGGGCTGAGAGCAGGCATCCAGG + Intronic
1187685554 X:21812307-21812329 GTGGCTTTATGCTGACATTCTGG - Intergenic
1192267175 X:69546889-69546911 GTGGCTTAGTACAGGCCTGCAGG + Intergenic
1192498717 X:71634407-71634429 TTGGCTTACTGTAGTCATCCAGG + Intergenic
1193211489 X:78811394-78811416 GTGGCTCCATGCAGGCCTGCAGG - Intergenic
1198199212 X:134398524-134398546 ATGGCTTGTTGCAGGAATCCTGG + Intronic
1198795703 X:140391629-140391651 GAGGCTTAATCCTGGGATCCTGG + Intergenic
1199451180 X:147980723-147980745 GTGGCTTATGGCTGCCATCCTGG - Intergenic
1199664837 X:150088423-150088445 GGGGCTTAAGGCAGGGACCCAGG + Intergenic
1200947584 Y:8862113-8862135 CTGGCTTAATGAAGGAAGCCTGG + Intergenic
1202164967 Y:21978114-21978136 GTGGCCTACTCCAGTCATCCAGG - Intergenic
1202226389 Y:22608260-22608282 GTGGCCTACTCCAGTCATCCAGG + Intergenic
1202316726 Y:23587404-23587426 GTGGCCTACTCCAGTCATCCAGG - Intergenic
1202554039 Y:26082654-26082676 GTGGCCTACTCCAGTCATCCAGG + Intergenic