ID: 902936806

View in Genome Browser
Species Human (GRCh38)
Location 1:19770248-19770270
Sequence GCTTAGACCAGGGGCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902936792_902936806 19 Left 902936792 1:19770206-19770228 CCAGTGAGAAGGCCCTGCTGTTA 0: 1
1: 0
2: 4
3: 15
4: 143
Right 902936806 1:19770248-19770270 GCTTAGACCAGGGGCCTGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 237
902936797_902936806 7 Left 902936797 1:19770218-19770240 CCCTGCTGTTATCCAGGAGGGGC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 902936806 1:19770248-19770270 GCTTAGACCAGGGGCCTGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 237
902936800_902936806 -5 Left 902936800 1:19770230-19770252 CCAGGAGGGGCGACAGTGGCTTA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 902936806 1:19770248-19770270 GCTTAGACCAGGGGCCTGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 237
902936798_902936806 6 Left 902936798 1:19770219-19770241 CCTGCTGTTATCCAGGAGGGGCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 902936806 1:19770248-19770270 GCTTAGACCAGGGGCCTGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902936806 Original CRISPR GCTTAGACCAGGGGCCTGGG TGG Intronic