ID: 902940805

View in Genome Browser
Species Human (GRCh38)
Location 1:19799393-19799415
Sequence CCTTCCTGACGGGGGCGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902940805 Original CRISPR CCTTCCTGACGGGGGCGTGG AGG Intronic
900102449 1:967635-967657 CCTGCCTGGCGGGGGCATGTTGG - Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900390744 1:2432809-2432831 CCCTCCGGACGGGGGAGTTGGGG - Intronic
900931880 1:5743014-5743036 CCTGGCTGATGGGGCCGTGGTGG - Intergenic
901733717 1:11298854-11298876 CCCTCCTGACGGAGGCGAGGAGG + Intergenic
901921537 1:12540758-12540780 CCTTCCTGACGGTGCAGAGGAGG + Intergenic
902236775 1:15062788-15062810 CCTGCCTTACGTGGGTGTGGAGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903163013 1:21502846-21502868 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
903910827 1:26723605-26723627 CCTTCCTGGCAGGGGCGGTGTGG + Intronic
905477714 1:38240597-38240619 CCTTCTTGGTGGGGGAGTGGAGG - Intergenic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
907475135 1:54700392-54700414 CCTTCATGATGGGGTCGTGGTGG - Exonic
910815746 1:91289173-91289195 CCTCCCAGACGGGGTGGTGGCGG + Intronic
910855946 1:91695691-91695713 CACTCCTGACGGGGGCCTTGTGG - Exonic
915719445 1:157973611-157973633 CCTTCCTGGTGGGGTAGTGGGGG - Intergenic
917496948 1:175549123-175549145 CCTTCCTATCAGGGGCCTGGGGG - Intronic
917959685 1:180132336-180132358 CCTTCCTGGCGCGGTCCTGGGGG + Intergenic
922773879 1:228206250-228206272 CCTCCCGGACAGGGCCGTGGAGG - Intronic
1063452949 10:6163672-6163694 CGGGCCCGACGGGGGCGTGGCGG + Intronic
1064424062 10:15214414-15214436 CCTTCGTGCCGGGGGCCTCGGGG + Exonic
1065352005 10:24804148-24804170 CTTTCCTGGGCGGGGCGTGGTGG - Intergenic
1067026424 10:42847306-42847328 CCTCCCAGACGGGGTCGCGGTGG - Intergenic
1067728851 10:48794359-48794381 CCTTCCTGTCGGCGGCCTGCTGG - Intronic
1068686250 10:59872770-59872792 CTTTCCAGATGGGGGGGTGGGGG + Intronic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1073061105 10:100734452-100734474 CCTTCCTGCCTGGGGCCTGGTGG + Intergenic
1076175033 10:128361798-128361820 CGTTCCTGAATGGGGCATGGAGG - Intergenic
1076734013 10:132450787-132450809 CCTTCGTGAAGGGAGAGTGGGGG + Intergenic
1078420672 11:11209521-11209543 CAATCCTGGCGGGGGCGGGGGGG + Intergenic
1081582190 11:44360018-44360040 CCTACCTGACAGGGCTGTGGTGG - Intergenic
1085087547 11:73680645-73680667 TCTTCTTGGCGGGGGTGTGGGGG + Intronic
1087252866 11:95923706-95923728 CCTCCCTCCCTGGGGCGTGGAGG - Intronic
1089514904 11:119026267-119026289 CCTGCCTGACGGGGGAGGAGGGG - Intronic
1096037166 12:48482602-48482624 CGTTCTTGACTGGGGCTTGGAGG + Intronic
1097035512 12:56121144-56121166 CCTTCCTGACAGGGGCTTTGAGG + Exonic
1102225314 12:111224321-111224343 GCTTCCTGAGAGGGGAGTGGAGG + Intronic
1102292591 12:111713335-111713357 CATTGCTGACCGGGGCGTAGTGG + Intronic
1102656307 12:114485005-114485027 CCTCCCAGACGGGGTCGTGGCGG + Intergenic
1103724231 12:122989841-122989863 CCTTCCTGGCTGGAGGGTGGGGG + Exonic
1108059102 13:46515414-46515436 CCTCCCAGACGGGGTGGTGGCGG + Intergenic
1113522004 13:110947805-110947827 GCCTCCTGAAGGGGGTGTGGGGG + Intergenic
1113858997 13:113468868-113468890 CCGTCATGCCGGGGACGTGGGGG + Intronic
1115761402 14:36581524-36581546 CCCTTCTGGCGCGGGCGTGGAGG + Intronic
1117343881 14:54814302-54814324 CAGTCCTGACGGGGGCGCTGTGG - Intergenic
1119422554 14:74516206-74516228 CCAGCCTGACAGGGACGTGGTGG + Intronic
1122235246 14:100327587-100327609 CCTTCCTGAGGGGGCCGTGCTGG - Intronic
1123934282 15:25186630-25186652 CCTTCCTTATGAGGGAGTGGTGG + Intergenic
1126573167 15:50172827-50172849 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1128843731 15:70871707-70871729 CCTCCCAGACGGGGTGGTGGTGG + Intronic
1128970117 15:72100644-72100666 CCTCCCAGACGGGGTCGTGGCGG - Intronic
1129110293 15:73333217-73333239 CCTTGCTGACAGGGCAGTGGGGG + Intronic
1130335069 15:82951644-82951666 ACTGCCTGACGTGGGCATGGAGG - Intronic
1132590343 16:723751-723773 CCTGTCTGGCGGGGGCTTGGTGG + Intronic
1134522535 16:14925203-14925225 CCTCCCTGACTGGGGCCTGCTGG + Intronic
1134710205 16:16323854-16323876 CCTCCCTGACTGGGGCCTGCTGG + Intergenic
1134949398 16:18344791-18344813 CCTCCCTGACTGGGGCCTGCTGG - Intergenic
1135424653 16:22326290-22326312 CCTGCCTGCCAGGGGCATGGGGG + Intronic
1136093197 16:27935310-27935332 CCATCCTGATGGGGGAATGGGGG + Intronic
1137592192 16:49700467-49700489 GCTTCCTGACTGGGGCGGAGGGG + Intronic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1140602923 16:76500077-76500099 CCTCCCTGACGGGGTGGCGGCGG + Intronic
1142200162 16:88757310-88757332 CGTTGCTGGCGGGGGGGTGGGGG + Intronic
1142360400 16:89623583-89623605 CTTCCCTGACGGGAGCGGGGCGG + Intronic
1142875905 17:2852311-2852333 CCTCCCTGCCGGGGTTGTGGGGG - Intronic
1144124338 17:12188678-12188700 CCTTCCTGAGGTGGGGGTGGGGG - Intergenic
1144629659 17:16864532-16864554 CCTTCCTCACAGGGCTGTGGTGG + Intergenic
1144651769 17:17011585-17011607 CCTTCCTCACAGGGCTGTGGTGG - Intergenic
1144652864 17:17018247-17018269 CCTTCCTGGCGGGGTGGAGGGGG - Intergenic
1147831201 17:43299333-43299355 GGGCCCTGACGGGGGCGTGGGGG + Intergenic
1148225806 17:45897039-45897061 CCTCCTTGACGGTGGCGTAGAGG + Intronic
1148287977 17:46413104-46413126 ACTTCCAGTTGGGGGCGTGGCGG + Intergenic
1148310147 17:46630684-46630706 ACTTCCAGTTGGGGGCGTGGCGG + Intronic
1148786600 17:50148987-50149009 CCACCCTCAGGGGGGCGTGGGGG - Intronic
1148848684 17:50543563-50543585 CCTTCCTGAGGTGGGGGTAGGGG + Exonic
1149162558 17:53711545-53711567 CCTTGCTGAAGGGGGTGGGGAGG + Intergenic
1152351119 17:79784559-79784581 CCTTGGTGGCGGTGGCGTGGCGG - Exonic
1155920304 18:31596877-31596899 CTTTGGTGACGGGTGCGTGGTGG + Intronic
1155990904 18:32278311-32278333 CATGCCTGGCAGGGGCGTGGGGG + Intronic
1156503406 18:37574266-37574288 CCTCCCTGGCGGGGAGGTGGGGG - Intergenic
1157857750 18:51117393-51117415 CCTCCCAGACGGGGTGGTGGTGG + Intergenic
1160233491 18:77067208-77067230 CCTCCCAGAAGGGGGCGGGGGGG - Intronic
1160586061 18:79914382-79914404 TCTGCCTGATGGGGGCGTCGTGG - Intronic
1161779258 19:6280076-6280098 CCTGCCTGGCGGGGGCCTGCCGG + Intergenic
1161962190 19:7529041-7529063 CCTTCCTTTGGGGGGCCTGGGGG - Intronic
1162542065 19:11303031-11303053 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1162555625 19:11383970-11383992 ACTTCCTGACCGGGTCCTGGGGG - Intronic
1163676469 19:18657869-18657891 GCTTGCTGACGTGAGCGTGGGGG + Intronic
1166157018 19:40921332-40921354 CTTTCCTGACCGGGGAGAGGAGG - Intergenic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1168467331 19:56613754-56613776 CCCTCCTTACAGAGGCGTGGAGG - Intronic
927777488 2:25913602-25913624 CTTTCCTGCCGGGGCCCTGGAGG + Intergenic
928024830 2:27730741-27730763 CCTTCCTGACAGTGGGGAGGAGG + Intergenic
934757271 2:96832841-96832863 CCTTCCTGAGGCGGGCCTGGAGG - Exonic
937265830 2:120614120-120614142 CCTTCCAGCCCGGGGCCTGGCGG - Intergenic
939966900 2:148619192-148619214 CCTTGCTGAGGGGGCCATGGAGG - Intergenic
943411697 2:187556584-187556606 CCTCCCAGACGGGGTCGCGGCGG - Intronic
944241366 2:197488579-197488601 CAATCCTGAGGTGGGCGTGGTGG + Intronic
944751465 2:202715052-202715074 CCTCCCAGACGGGGTGGTGGCGG + Intronic
946724434 2:222648074-222648096 CCTTCCTCGCGGGGGCTTGATGG - Intronic
948194361 2:236084210-236084232 CCTTCCTGAAGGGCGGGGGGGGG + Intronic
948572955 2:238928849-238928871 CCTTACAGATGGGGACGTGGAGG - Intergenic
948907303 2:240986023-240986045 CCTCCCTGATGGGGACATGGTGG + Intronic
1171164092 20:22955526-22955548 CCTTTCTAACTGGGGCTTGGAGG + Intergenic
1174548699 20:51345483-51345505 CCTGCCTGCTGGAGGCGTGGTGG + Intergenic
1175127743 20:56764944-56764966 ACTTCATGACTGGGGCGGGGTGG + Intergenic
1175748794 20:61480558-61480580 CCGTCCTGACCGGGGCCTGGTGG + Intronic
1176019343 20:62954575-62954597 CCATCCTGCTGGGGGCGCGGGGG - Intronic
1176235637 20:64052308-64052330 CCTTTCTGACTGGGGCTTGGGGG - Intronic
1179794309 21:43773871-43773893 CCTTCCCCTCGGGGGCATGGAGG - Exonic
1179902239 21:44400260-44400282 CCTTCCTGACCAAGGTGTGGTGG + Exonic
1181546945 22:23607523-23607545 TCTTGCTGGCGGGGGCGGGGGGG + Intergenic
1181943409 22:26496533-26496555 CCCTCCTGAGGGTGGCTTGGGGG + Intronic
1182430242 22:30294915-30294937 CCTGCCTGCCCGGGGCCTGGTGG + Intronic
1183311433 22:37112052-37112074 CCTCCCTGACATGTGCGTGGGGG + Intergenic
1183618074 22:38956933-38956955 CCCTTCTGACAGGGGGGTGGGGG + Intronic
1183642476 22:39100924-39100946 GCTTCGGGACTGGGGCGTGGAGG + Intronic
1184656448 22:45944317-45944339 CCTTCCTGGGGGTGGCATGGAGG - Intronic
1184788821 22:46686539-46686561 CCTTCCCGGCGCTGGCGTGGAGG + Exonic
952416734 3:33096825-33096847 CCTTCCCGTCGGGGGCGGGCCGG - Intronic
962288271 3:134106735-134106757 CCTTCATGCCAGGGGCATGGAGG - Intronic
963858494 3:150281048-150281070 CCTTGCTGAAGGGGGCATGCAGG - Intergenic
966611115 3:181868748-181868770 CCAACCTGAAGGGGGCATGGAGG - Intergenic
968222094 3:196947202-196947224 CCTTGCTGAGTGGGGCTTGGAGG - Exonic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
968760795 4:2442063-2442085 CCATCCTCACTGGGGTGTGGTGG - Intronic
968907351 4:3460721-3460743 CTTACCTGATGGGGGCGGGGTGG + Intergenic
968955459 4:3716701-3716723 TGTTCCTGACCGGGGCCTGGTGG + Intergenic
969966994 4:11007122-11007144 CCTTCCTGCCTGGGAGGTGGTGG + Intergenic
972387905 4:38585628-38585650 CGTTCCAGACGGGGGGATGGAGG - Intergenic
982215973 4:153082893-153082915 CCATCCTGACCGAGGTGTGGGGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983495143 4:168435096-168435118 CCTTACTGACTGGGGGTTGGGGG - Intronic
983495678 4:168440031-168440053 CCATTCTGATGGGTGCGTGGGGG - Intronic
984422764 4:179546327-179546349 CATTCCTGGTGGGGGTGTGGTGG - Intergenic
984973306 4:185209566-185209588 CCAGCCTGACGCGGGCGGGGCGG - Intronic
985240893 4:187929834-187929856 CCTGCCTCACGGGGGCCTTGAGG - Intergenic
985525490 5:399265-399287 CCATCCTGCCGGGGTCCTGGTGG - Intronic
985629739 5:1008391-1008413 CCTTCCAGCCGGGGCCGGGGGGG + Intergenic
985776470 5:1846640-1846662 CCTTCATGTTGGGGGCCTGGAGG + Intergenic
998748204 5:145286146-145286168 CCTTCCTCACTGGGTTGTGGTGG - Intergenic
999696245 5:154190668-154190690 CCCTCGTGGCGGCGGCGTGGTGG + Intronic
1001641663 5:173248388-173248410 CCGTTCTGGTGGGGGCGTGGGGG + Intergenic
1003332291 6:5139792-5139814 TCTTCCAGGCTGGGGCGTGGTGG + Intronic
1004640763 6:17513514-17513536 CTCACGTGACGGGGGCGTGGAGG - Intronic
1005624874 6:27653586-27653608 CCTCCCAGACGGGGTGGTGGTGG - Intergenic
1006281690 6:33059470-33059492 CCTCCCAGACGGGGTGGTGGCGG + Intergenic
1006370966 6:33643338-33643360 CCTTCCCGAGGTGGGGGTGGTGG - Intronic
1007211213 6:40194650-40194672 CCTTCCTGAAGGGGACCTAGGGG + Intergenic
1008876268 6:56332581-56332603 CCTTTTTGGCGGGGGCGGGGGGG - Intronic
1009042020 6:58190717-58190739 CCTCCCAGACGGGGTGGTGGTGG - Intergenic
1014212850 6:118724594-118724616 CCTTCCTAACGGGTGTGAGGTGG + Intergenic
1015252826 6:131144281-131144303 CCTCCCAGACGGGGTCGTGGCGG + Intronic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1020142418 7:5619876-5619898 CCTCCCTGGCAGGGGAGTGGTGG + Intergenic
1026899467 7:74028751-74028773 CCTTCCTGACGGGGGGATCCCGG - Intronic
1030064995 7:105652681-105652703 CCTTCCTGGCAGGGGGATGGAGG - Intronic
1033351055 7:140562372-140562394 ACTTCCTGGCTGGGGCGTGGTGG + Intronic
1034174747 7:149091261-149091283 CCGTCCCGCCGGGGGCGCGGAGG + Intergenic
1034179584 7:149126790-149126812 CCGTCCCGCCGGGGGCGCGGAGG + Intronic
1034427937 7:151024290-151024312 CCTTCATGCCGGGGACCTGGGGG - Exonic
1036586969 8:10133357-10133379 CCTTCCTGACGGAGGAGTCCAGG - Intronic
1038326508 8:26576921-26576943 GCTCCCTGAGGGGTGCGTGGGGG - Intronic
1039201031 8:35094386-35094408 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
1049405282 8:142449615-142449637 CCTTCCTGGCGAGGGGGGGGGGG - Exonic
1049460700 8:142726463-142726485 CCTTCCTGACGAGGCTGGGGAGG - Intergenic
1050534964 9:6623090-6623112 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1053312370 9:37027726-37027748 CCCTCCGGGCGGGGGCGGGGCGG + Intronic
1054496155 9:65824997-65825019 GCTGCCTGCCGGGGGCGGGGGGG - Intergenic
1056765092 9:89440231-89440253 GCTTCCTGGCAGGGGCGGGGAGG - Intronic
1057705177 9:97390677-97390699 CCTTCCTGTCAGGGGCATGCTGG - Intergenic
1060041498 9:120304983-120305005 CCTCCCAGACGGGGTTGTGGCGG - Intergenic
1062101906 9:134732914-134732936 CCTGCCTGCCGGCGGCGGGGCGG - Intronic
1062164004 9:135096565-135096587 CCACACTGACGGGGGCTTGGGGG - Intronic
1062630744 9:137462051-137462073 ACCTCCTGACGGGGCCCTGGGGG - Intronic
1187423890 X:19160210-19160232 CCTGTCTGACTGGGGGGTGGTGG + Intergenic
1189270513 X:39748249-39748271 GCTTCCTGACTGGGGGGAGGTGG - Intergenic
1189534399 X:41922746-41922768 CCTGCCAGGCGGGGGCCTGGGGG - Intronic