ID: 902950962

View in Genome Browser
Species Human (GRCh38)
Location 1:19882572-19882594
Sequence CCGCTCGTCCCGCTTGCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902950962_902950968 -4 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950968 1:19882591-19882613 GCGGGCGGCGCGCCGGGCCCTGG 0: 1
1: 0
2: 15
3: 118
4: 779
902950962_902950969 2 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950969 1:19882597-19882619 GGCGCGCCGGGCCCTGGCCAAGG 0: 1
1: 0
2: 1
3: 23
4: 291
902950962_902950977 20 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950977 1:19882615-19882637 CAAGGAGCGGCGGAATCGGCCGG 0: 1
1: 0
2: 2
3: 3
4: 90
902950962_902950979 30 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950979 1:19882625-19882647 CGGAATCGGCCGGAGTCTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 36
902950962_902950970 7 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950970 1:19882602-19882624 GCCGGGCCCTGGCCAAGGAGCGG 0: 1
1: 1
2: 2
3: 25
4: 362
902950962_902950975 16 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950975 1:19882611-19882633 TGGCCAAGGAGCGGCGGAATCGG 0: 1
1: 0
2: 0
3: 7
4: 77
902950962_902950967 -10 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950967 1:19882585-19882607 GGACGAGCGGGCGGCGCGCCGGG 0: 1
1: 0
2: 0
3: 26
4: 243
902950962_902950978 27 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950978 1:19882622-19882644 CGGCGGAATCGGCCGGAGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 39
902950962_902950972 10 Left 902950962 1:19882572-19882594 CCGAGCGCAAGCGGGACGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 902950972 1:19882605-19882627 GGGCCCTGGCCAAGGAGCGGCGG 0: 1
1: 0
2: 5
3: 43
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902950962 Original CRISPR CCGCTCGTCCCGCTTGCGCT CGG (reversed) Exonic
900190153 1:1349745-1349767 CCGCGCGCCCCGCATCCGCTCGG - Intergenic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
902950962 1:19882572-19882594 CCGCTCGTCCCGCTTGCGCTCGG - Exonic
903153473 1:21429107-21429129 CAGCTGGGCCCGCTTGCCCTCGG - Intergenic
903528042 1:24007929-24007951 CAGCTCCTCCCGCTTCCTCTTGG + Intergenic
906048459 1:42851332-42851354 CCGCTCGTGCCGGATGCGGTTGG - Exonic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
917845098 1:179014167-179014189 CTGCTCTTCCTGCTTGAGCTTGG - Intergenic
1064662196 10:17617376-17617398 CCGCTCCTCCCCCTCGCGGTCGG - Exonic
1065023241 10:21517493-21517515 CCGGCCGACCCGCCTGCGCTTGG + Exonic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1093547992 12:20369798-20369820 GCGCTCGTCCAGATTGGGCTGGG + Exonic
1119223931 14:72929660-72929682 CAGCTCCTCCCGCTTCCTCTTGG + Intronic
1121127729 14:91418367-91418389 CCGCTCCTCACGCTTGTGCGCGG + Intergenic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1132115248 15:99131242-99131264 CAGCTCCTCCCTCATGCGCTCGG - Exonic
1132365178 15:101251738-101251760 CGGCTCCTCCCGCTCGCGCGCGG + Exonic
1143537349 17:7549211-7549233 CTGCTGGTCCCGCTCGCGCTGGG + Exonic
1143830267 17:9645576-9645598 CCGCTCGTCCGCCTCGCGCCCGG + Exonic
1145745970 17:27319932-27319954 ACGCTCATCCAGCTTGTGCTGGG + Intergenic
1161683378 19:5691551-5691573 CAGCTCCTCCCGCTTCCTCTTGG - Exonic
1162432332 19:10636522-10636544 CAGGTCGTCCGGCTTGCGCAGGG - Exonic
1162923696 19:13918990-13919012 CCGCTGGTCCCCCTTGCTCTTGG - Exonic
1164179712 19:22807700-22807722 CCGCCCGTCCCGCACCCGCTCGG + Intergenic
1168471440 19:56643547-56643569 GCGCTCGTCTCGCTGGGGCTTGG + Intronic
932495320 2:72143262-72143284 CCGCCCCTCCCGGCTGCGCTAGG - Intronic
934685930 2:96321746-96321768 GCGCTGTTCCCGCTGGCGCTCGG - Intergenic
938063356 2:128268570-128268592 CAGCTGGGCCCGCTTGCCCTCGG + Exonic
945891526 2:215436005-215436027 CCCCTCTTCCCGCTCGCGCCTGG + Exonic
1173166223 20:40688917-40688939 CCGCTCTTCCCCCCCGCGCTTGG - Exonic
1178971028 21:37177030-37177052 CAGCTGGTCCTGCTTGGGCTCGG + Intronic
1182664151 22:31944962-31944984 CCGCGCTTCCCGCTCCCGCTGGG + Intronic
965731006 3:171772658-171772680 CAGCTCATCCAGCTTTCGCTTGG - Intronic
968904268 4:3444357-3444379 CCGCTGGGCCCGCGTGCGCCAGG + Exonic
979205624 4:118033823-118033845 CCCCTCGTCCGGGTGGCGCTTGG - Intronic
980053588 4:128060810-128060832 CCGCTTGGCCCGCTGGCGCCCGG - Intergenic
985727634 5:1524236-1524258 CCGCTCGGCCCGCCTGCTCGCGG + Intergenic
1002799802 6:511625-511647 CGGCTTGTCCCGCTCGGGCTGGG - Intronic
1022482630 7:30753836-30753858 CAGCTCCTCCCGGTTGCGGTCGG - Exonic
1025007501 7:55365886-55365908 CCGCTCCTCCCGCCAGCGCGCGG + Exonic
1037807384 8:22066363-22066385 CCGCTGGTCCCACTCCCGCTCGG - Intronic
1047066806 8:121293047-121293069 CAGCTCTTCCCGCTTGTACTTGG - Intergenic
1049040406 8:140108510-140108532 CCGCTCGCCCCCCTTGCCCAGGG + Intronic
1061975821 9:134067678-134067700 CCCCTCCTCCCGCTCCCGCTTGG - Intronic
1062102421 9:134735421-134735443 CCTCTCGTTCCTCTTTCGCTGGG + Intronic
1196390170 X:115198679-115198701 CAGCTCCTCCCGCTTCCTCTTGG - Intronic
1200222547 X:154398239-154398261 CCGCTCTTGGCGCTTGCGCCCGG - Exonic