ID: 902954165

View in Genome Browser
Species Human (GRCh38)
Location 1:19913439-19913461
Sequence AGCCAGAGCCCTTGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902954165 Original CRISPR AGCCAGAGCCCTTGTGTGGA TGG (reversed) Intergenic
900976438 1:6019761-6019783 AGTCAGAAACCTTGTGTGGAAGG + Intronic
901587781 1:10312590-10312612 AGCAAGAAAACTTGTGTGGATGG - Intronic
902954165 1:19913439-19913461 AGCCAGAGCCCTTGTGTGGATGG - Intergenic
903755523 1:25657892-25657914 AGGCTGAGCCTGTGTGTGGATGG + Intronic
903888861 1:26556729-26556751 GGCCAGAGCCCTGGTGTGGGTGG - Intronic
903949395 1:26986818-26986840 AACCAGAGACCTTGTGGGGAGGG + Intergenic
904260696 1:29285965-29285987 AGCCAGAGCCCAGGTGGGGAAGG - Intronic
905363499 1:37436067-37436089 AGCCACAGCCCTAGAGCGGATGG - Intergenic
905468029 1:38170528-38170550 AGCCACAGGCCTTGGATGGATGG - Intergenic
905523074 1:38615062-38615084 AGCCTGAGCCCTTGGGGGAAGGG + Intergenic
906949983 1:50326719-50326741 TGCCAGTGCCCCTGGGTGGAGGG - Intergenic
907304263 1:53505080-53505102 AGGCAGAGCGCATGTCTGGAGGG + Intergenic
908203174 1:61818768-61818790 AGGCACAGCCCATGTCTGGAGGG + Intronic
910115092 1:83723452-83723474 AGCCAGAGCTCTAGTCTGGCTGG - Intergenic
911231891 1:95370631-95370653 AGTCAGTCCCCTTCTGTGGAAGG + Intergenic
913572203 1:120131838-120131860 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
914293123 1:146293482-146293504 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
914554167 1:148744265-148744287 AGCCAGAGCCCTGGTGGGATGGG + Intergenic
917233632 1:172865554-172865576 AGGCAGAGCCCAGGTGAGGATGG - Intergenic
917691591 1:177475444-177475466 AACAAGAGCCAATGTGTGGAGGG + Intergenic
919640440 1:200040177-200040199 AACCAGTACTCTTGTGTGGAGGG + Intronic
919804535 1:201373314-201373336 GGCCAGAGCTCTTCTGAGGAAGG - Exonic
922221744 1:223613575-223613597 AGCCACTGCCCATGGGTGGATGG + Intronic
924254540 1:242169468-242169490 ACCCAGGGCCCTTGTGGGGTAGG - Intronic
924800676 1:247327897-247327919 AACCAGCGCCCTTGGGTTGAAGG - Intronic
1063540384 10:6927820-6927842 AGCCTTAGCCCTTGGGTGGTGGG - Intergenic
1065962948 10:30749002-30749024 AGCCTGAGACCTTGTGAGAAGGG - Intergenic
1066488664 10:35873119-35873141 AGCCACAGCCCATGCCTGGAAGG + Intergenic
1068860399 10:61841772-61841794 AGACAGGTCCCTTGGGTGGAGGG + Intergenic
1069164402 10:65134016-65134038 AGGCAGAGACCTTGCCTGGAAGG - Intergenic
1070474863 10:76820326-76820348 AGCCAGACCACGTGTGAGGAGGG - Intergenic
1071498631 10:86188313-86188335 AGCCTGAGCCCTTGTTGGCATGG - Intronic
1071897798 10:90084994-90085016 AGCCAGAGCAGGTGTGAGGAGGG + Intergenic
1071971060 10:90907310-90907332 AGCCAGGACCCCTGTGGGGAAGG + Intronic
1072135507 10:92542102-92542124 CACCAGAGCCCTTGTTTTGAAGG + Intronic
1073308841 10:102525034-102525056 AGTCAGAACCCTTCTGTGGGAGG + Intronic
1073476305 10:103756258-103756280 AGCCAGAGCTCTTCTCTGGCAGG - Intronic
1073548775 10:104377588-104377610 AGCCACAGGCCAGGTGTGGATGG + Intronic
1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG + Intronic
1076607447 10:131698317-131698339 AGCCCCAGCCCCTGTGTGGCAGG + Intergenic
1076930161 10:133527171-133527193 AGCCAGTGACCTGGTGAGGATGG - Intronic
1077089200 11:770790-770812 ATCCAGGGCCCTTGTCAGGAGGG + Exonic
1077481964 11:2819193-2819215 GGCCACAGCCCTTGGGAGGAGGG - Intronic
1078074931 11:8149911-8149933 AGCCAGAACCATTCTGTGGTTGG - Intronic
1081527008 11:43934291-43934313 AGTCACAGGCTTTGTGTGGAGGG + Intronic
1081540584 11:44031814-44031836 AGACACAGCCTTAGTGTGGATGG + Intergenic
1083987826 11:66228247-66228269 AGGCAGGACCCTTGTGGGGAAGG + Intronic
1084265490 11:68003449-68003471 AGCCAGAGCCTCGGTGTGGGTGG - Intronic
1086231419 11:84574971-84574993 AGACAGAGTCATTGTGAGGAGGG - Intronic
1087127750 11:94643360-94643382 AGCCAGAGCGGGTGTGAGGAGGG - Intergenic
1087211759 11:95452132-95452154 AGGCAGAGCCACTGTATGGAAGG + Intergenic
1089190316 11:116648827-116648849 GGCCAGGTCCCTAGTGTGGATGG + Intergenic
1089209715 11:116791822-116791844 AGCCAGAGCCCAGGTGAGCACGG + Exonic
1089600109 11:119608854-119608876 AGGCAGAACCATTGTTTGGAAGG + Intergenic
1089743328 11:120600066-120600088 GGCCGAAGCCCTTGGGTGGAAGG + Intronic
1092056559 12:5512498-5512520 AGCCAGCGCCCTGGTGTGTGGGG - Intronic
1093559588 12:20522219-20522241 GACCAGGGCCCTTGTGTTGATGG - Intronic
1096217114 12:49803865-49803887 AGCCAGAGCCCTGGGGAGGCAGG - Intronic
1096637611 12:52970847-52970869 AGCCAGAGAACTTGTGTTGAAGG - Intergenic
1096860775 12:54526522-54526544 ACCTAGAGCCATTGTGTGGCTGG + Exonic
1097378247 12:58863016-58863038 AGCCAGAGTCCTTGCATGTAAGG + Intergenic
1100136357 12:91557518-91557540 AGCCAGAGCTCTCTTGTGTAAGG - Intergenic
1101952973 12:109190522-109190544 AGGCAGAGCAGCTGTGTGGAAGG + Intronic
1103202308 12:119097762-119097784 TGCCAGAGCCCTGGGGTGTAAGG - Intronic
1103913518 12:124364454-124364476 GGCCACAGACTTTGTGTGGAGGG + Intronic
1103968452 12:124654812-124654834 AGCCGGAGGCCTGGTGTGGCGGG - Intergenic
1104744781 12:131203988-131204010 AGGCAGAGCCCTTGTCTGCGGGG + Intergenic
1106359929 13:29021612-29021634 AGGCAGTTCCCTTCTGTGGATGG + Intronic
1106531557 13:30597838-30597860 AGCCTGACCCCTGGTGTGTAGGG + Intronic
1107295931 13:38907534-38907556 AGCCAAAGCCACTGTGTGTATGG + Intergenic
1109722178 13:66289030-66289052 AGCCAAAGCCTTTGTGTGTCTGG - Intergenic
1110087773 13:71404122-71404144 AGCCAGATGACTTGAGTGGAAGG - Intergenic
1111169021 13:84501339-84501361 AGTCAAAGCCGTAGTGTGGAAGG + Intergenic
1111978233 13:94989948-94989970 AAGCAGAGCCCTTTTGTGGTGGG - Intergenic
1113723004 13:112574926-112574948 AGCCAGGGCCCAGGTGGGGAGGG + Intronic
1115162375 14:30410527-30410549 ACCCAGAGCCCTGGTGGGGTAGG + Intergenic
1115915633 14:38309996-38310018 AGCCAGTGTCATTGTGTGGGCGG + Intergenic
1117632463 14:57708182-57708204 AGCCAGATCACTGGTGTGGGTGG - Intronic
1117758620 14:59002675-59002697 AGCCAGATACCTTGTCTGGAAGG + Intergenic
1118767895 14:68922327-68922349 AGCCAGATCCCATCTGTGGCAGG - Intronic
1119401285 14:74364333-74364355 TGCCAGATCCCTTGTGAGCAGGG - Intergenic
1119438124 14:74611389-74611411 AGCCAGGGCTCATTTGTGGAGGG - Intronic
1121446707 14:93983453-93983475 AGCCAGACCCTTGGTGAGGAAGG + Intergenic
1121456423 14:94041649-94041671 AGGCAGGGGCCTGGTGTGGAGGG - Intronic
1121815168 14:96923676-96923698 AGCCTGAGCCCCTGGGGGGAGGG - Intronic
1121815297 14:96924132-96924154 AGCCCAAGCCCCTGGGTGGAGGG - Intronic
1121815309 14:96924170-96924192 AGCCTGAGCCCCTGGGTGGAGGG - Intronic
1122273023 14:100576818-100576840 GGCCAGAGTGCATGTGTGGACGG + Intronic
1122690965 14:103532030-103532052 AGCCCCAGCCCCTGTGTGGTGGG + Intronic
1123981655 15:25610234-25610256 AGCCACAGCCTCTGTGTGGAGGG - Intergenic
1127161920 15:56197564-56197586 AGACATAGGCCTTGTGTGCAAGG - Intronic
1127755336 15:62086378-62086400 AGCCAGAGCACTAGTGTTCAAGG + Intergenic
1128033216 15:64499979-64500001 AGCCAGTTCCCTTGGGAGGACGG + Exonic
1128715752 15:69906513-69906535 AGCCACAGCCAATGTGTTGAAGG + Intergenic
1129666666 15:77583057-77583079 AGCCAGAGGGCTTGTGGGGGAGG + Intergenic
1130887647 15:88107555-88107577 AGACAGAGTCCTGGTGTGGATGG - Intronic
1131779984 15:95845830-95845852 AGCCTGTCCCCTTTTGTGGAAGG + Intergenic
1131882582 15:96875786-96875808 AGCCAGACCCGGTGTGAGGAGGG + Intergenic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1135146201 16:19965057-19965079 AGCCAGAGCCCTGTAGTGAAGGG + Intergenic
1135742593 16:24989162-24989184 AGTCAGAGCCCAGGTGTGGAGGG - Intronic
1135754960 16:25089508-25089530 AGTCAGAGCCCAGGTGTGGAGGG - Intergenic
1136589211 16:31207261-31207283 CTCCAGAGCCCTTGTTTGGATGG + Intergenic
1137550985 16:49437512-49437534 AGCCGGAGCCCCAGGGTGGATGG - Intergenic
1137604995 16:49781336-49781358 TGCTGGAGCCCTTGAGTGGATGG - Intronic
1138349504 16:56338927-56338949 TGCTCCAGCCCTTGTGTGGAAGG - Intronic
1140966589 16:79972367-79972389 ATCCAGGGTCCTTTTGTGGACGG - Intergenic
1143683350 17:8494109-8494131 AGCCTGGGCCCCTGGGTGGATGG - Intronic
1145010994 17:19367839-19367861 AGTCAGACCACTAGTGTGGAAGG - Intronic
1146001497 17:29133248-29133270 AGCCAGAGCCCTTCTGATGGGGG - Intronic
1147523334 17:41195838-41195860 TGCCAGAGGCCTAGAGTGGAAGG + Intronic
1147670387 17:42173609-42173631 AACCAGGGCCCCTGAGTGGATGG - Intronic
1147693004 17:42329514-42329536 AGCCAGAGGCCCTTTGTGAAGGG + Intronic
1148679521 17:49465752-49465774 AGCCAGAGCCCTTCTATGCATGG + Intronic
1149530512 17:57391264-57391286 AGACAGAACCCTTGTGTGGATGG + Intronic
1149998589 17:61417712-61417734 AGGCAGGGCCCTTGTGTGATGGG - Intergenic
1150321005 17:64214220-64214242 AGCCTGAGCCCTTGTGAAGCCGG - Exonic
1150334687 17:64321887-64321909 AGCCAGATCCCCTGTGTCCAGGG - Exonic
1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG + Intronic
1151227685 17:72658803-72658825 CGACAGGGCTCTTGTGTGGATGG + Intronic
1152094226 17:78263734-78263756 AGCCAGGGCCCTTGTGGGAAAGG + Intergenic
1152109134 17:78347693-78347715 AGCCAGAGTCCTGGAGTGGAGGG - Intergenic
1152268627 17:79310671-79310693 TGCCCGGGCCCTTCTGTGGAGGG + Intronic
1155157578 18:23170392-23170414 AGCCAGAGGGCAGGTGTGGATGG - Intronic
1155642161 18:28031215-28031237 AGCCTGAGCATTTGGGTGGAGGG - Intronic
1157036330 18:43979496-43979518 AGCCAGAGTGGTTGTGTGGAAGG - Intergenic
1157291713 18:46414332-46414354 ACACAGAGCCCTGGTTTGGAAGG - Intronic
1158324597 18:56300535-56300557 AGACAGAGCCCTTGGGGGGATGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159059032 18:63495182-63495204 AGACAGACCTCTTGTGTGCAGGG - Intronic
1159661270 18:71098232-71098254 ACCCAGAGCCCTTGTGGTGTAGG + Intergenic
1160506863 18:79432262-79432284 AGTCACAGGCCCTGTGTGGAGGG + Intronic
1160571043 18:79817981-79818003 ACCCTGAGCCCTTGGGTGGCAGG - Intergenic
1161872122 19:6878253-6878275 ACCCAGATCCCTTCTGGGGATGG - Intergenic
1162478253 19:10913771-10913793 ACCCAATGCCCATGTGTGGATGG + Intronic
1164267210 19:23631075-23631097 AGCCACAGCTCTTGTGTGTCTGG - Intronic
1164656452 19:29925390-29925412 AGCCAGAGGGCTTGTGTGTGAGG + Intronic
1164724627 19:30457823-30457845 ACCCAGAGCCCCTGTGGGGCAGG - Intronic
1164801375 19:31079602-31079624 AGGCAGAGCCAGTGTGTCGAAGG - Intergenic
1165394709 19:35557991-35558013 AGATGGAGGCCTTGTGTGGAGGG + Intronic
1165495589 19:36150638-36150660 AGGCAGAGGCCAAGTGTGGATGG - Intergenic
1166415585 19:42593023-42593045 AGCCACAGCCCTTGGATGGCTGG + Intronic
925235479 2:2273536-2273558 AGCCAAAGCCAGTGTCTGGAGGG + Intronic
925252382 2:2451097-2451119 AGCCAGAGCTCTCCTGTGTAAGG + Intergenic
925716903 2:6792303-6792325 AGCCAGGGCAGTGGTGTGGATGG + Intergenic
926681939 2:15670858-15670880 AGCCAGAGGTCTGGTCTGGAAGG + Intergenic
927231921 2:20832484-20832506 TGCCAGTGCCATTTTGTGGAGGG - Intergenic
927542490 2:23926197-23926219 GGCCAGAGCCCCTGGGTGGAAGG - Intronic
928572319 2:32622047-32622069 AGCCAGAGTCCACATGTGGATGG + Intergenic
930276819 2:49320536-49320558 AGCCACAGCCCTGGAGTTGAGGG - Intergenic
931117482 2:59180390-59180412 AGCAAGGGCCCCTGTGTGAAAGG - Intergenic
932921267 2:75917356-75917378 AGCCAGTGCCCGTGCATGGAGGG - Intergenic
938307042 2:130263579-130263601 ACCCAGGGCCCTTCAGTGGATGG + Intergenic
938735989 2:134187108-134187130 AGCCAGGGGCCGAGTGTGGAGGG + Intronic
938755250 2:134373314-134373336 AGTCAGAGGACCTGTGTGGAAGG + Intronic
939307341 2:140427876-140427898 AGCCGGACCCCGTGTGAGGAAGG - Intronic
940612425 2:156007278-156007300 ACCCAGAGCCCTCGTGGGGTGGG + Intergenic
944439381 2:199727043-199727065 GGACAGAGCCCCTGTGGGGAGGG - Intergenic
946187385 2:217988677-217988699 AGCCAGACCTCTTGGGAGGAGGG + Intronic
946399386 2:219460687-219460709 AGCCTGGGCCCTGGTGTGGAGGG - Intronic
948755068 2:240154865-240154887 AGCGGGAGCCATAGTGTGGAAGG + Intergenic
948799585 2:240425914-240425936 AGACAGAGCCCTTACCTGGAAGG - Intergenic
1170795121 20:19540411-19540433 AGGCAGAGCCCTTGTGTGGAGGG - Intronic
1175300169 20:57937464-57937486 AGCCAGTGAAGTTGTGTGGAGGG + Intergenic
1175977553 20:62718718-62718740 AGTCAGATCCATTCTGTGGATGG + Intronic
1176073016 20:63236500-63236522 AGGCAGAGCCCTGGGCTGGAAGG - Intronic
1176105286 20:63382854-63382876 AGTCAGATGCCCTGTGTGGACGG - Intergenic
1176140463 20:63542645-63542667 CGCCAGAGGCCTGGTGTGGGGGG - Intronic
1178469619 21:32880576-32880598 AGCCAGAGAACTTGTCTGGAAGG + Intergenic
1179110186 21:38439437-38439459 AGCCAGGCCCTTGGTGTGGATGG + Intronic
1180976234 22:19850296-19850318 AGACAGAGCCCCTGTGCTGAGGG + Exonic
1181063073 22:20291228-20291250 AACCAGAGACCTTGTCAGGAGGG - Intergenic
1181103063 22:20554435-20554457 AGCCTGGGCCCCTGTGTGCAGGG - Intronic
1181887365 22:26031895-26031917 ACCCAGAGCCCTCCTGTGAATGG - Intergenic
1182393860 22:30021284-30021306 AGCCATAGCCCACGTCTGGAAGG - Intronic
1182924689 22:34111266-34111288 AGCCAGAGCCCAAGACTGGATGG - Intergenic
1183635747 22:39061475-39061497 AGCCAGACCCGGTGTGAGGAGGG + Intronic
1183746677 22:39695709-39695731 AGCCCCGGCCCATGTGTGGATGG + Intergenic
1184100141 22:42337775-42337797 AGGCAGAGCCCAGATGTGGATGG - Intronic
950189575 3:10967219-10967241 AGAGAAAGCCCTTGGGTGGAGGG + Intergenic
952416030 3:33092375-33092397 ATCCAGAGCCTTTCTGGGGAAGG - Exonic
954108494 3:48421637-48421659 AGGCAGGGCCCTGGTGGGGAGGG - Intronic
954294694 3:49667783-49667805 AGGCACAGCCCTTGTTGGGAGGG + Exonic
959729362 3:109583314-109583336 AGTCAGGGACCTTGAGTGGAGGG + Intergenic
961336117 3:126180614-126180636 GGCCAGAGCCCGTGAGGGGAGGG + Intronic
961364775 3:126392372-126392394 AGCCAAAGATCTTGTGTGGAAGG + Intergenic
961390560 3:126550217-126550239 TGGCAGAGCCTCTGTGTGGAAGG - Intronic
962454062 3:135549007-135549029 AGTGAGAGCCCGAGTGTGGAAGG - Intergenic
964984939 3:162726499-162726521 AGCCAGACCCGGTGTGAGGAGGG + Intergenic
965274404 3:166662800-166662822 AGCCAGTGCCTGTGCGTGGAGGG - Intergenic
966936998 3:184717200-184717222 AGCCAGGGCCCTGGTCTGAATGG + Intergenic
967419491 3:189258408-189258430 AGCCAGAGCTCTTGTGTTTGAGG + Intronic
968706926 4:2083327-2083349 AGGCACAGCCCACGTGTGGAGGG - Intronic
969433804 4:7172410-7172432 AGCCAGAGTCATTTGGTGGATGG - Intergenic
969726646 4:8922117-8922139 AGCCAGAGGCCTTTTGGAGAAGG - Intergenic
969748987 4:9095990-9096012 AGCCAGACCCAGTGTGAGGAGGG - Intergenic
970954062 4:21790076-21790098 AGGCAAAGCCATTATGTGGATGG + Intronic
971677742 4:29655717-29655739 AGGCAGAGTCCCTGGGTGGATGG + Intergenic
973214515 4:47654590-47654612 AGCCAGTGCCCATGCATGGAGGG + Intronic
975053769 4:69901135-69901157 AGCCAGAGATCTGGTGTAGAGGG - Intergenic
975666673 4:76740556-76740578 AGCCAGAGACCGAGTGTGGGCGG + Exonic
981758887 4:148171847-148171869 AGCCTCAGCCCTTGTCTGGGTGG - Intronic
982497175 4:156107422-156107444 AGCCAGACCCGGTGTGAGGAGGG + Intergenic
982909268 4:161118358-161118380 AGCCAGGGCCCTTGTGGTGTAGG + Intergenic
985144531 4:186881191-186881213 AGTCAGAGCCCTTGGGAGGATGG - Intergenic
985523627 5:390959-390981 ACCCAGACCCCTTCTGTGGCTGG - Intronic
985987332 5:3527144-3527166 AGCCTGGGTCCCTGTGTGGAGGG - Intergenic
986193468 5:5517312-5517334 AGCCAGAGCAGGTGTGAGGAGGG - Intergenic
988239715 5:28593922-28593944 ACCCAGAGCCATTGGGTTGATGG + Intergenic
991043707 5:62201234-62201256 AGCCAGTGCCCTAGCATGGAAGG - Intergenic
993470657 5:88303694-88303716 AGTCAGGGCCTTAGTGTGGAAGG - Intergenic
995280483 5:110330370-110330392 AGCCAGATCCTTAGTGTGTATGG + Intronic
995671586 5:114609948-114609970 AGCAAGAACCCTGGAGTGGAAGG + Intergenic
996192663 5:120564480-120564502 AGCCAGCGCCCTTGCATGTAGGG - Intronic
998170500 5:139869742-139869764 AGCCTGAGCCATTGTGAAGATGG - Intronic
1001533012 5:172477968-172477990 AGCCAGAGCCTGTGTATGTAAGG - Intergenic
1002611035 5:180418681-180418703 AGCCAGAGCAGGTGTGAGGAGGG + Intergenic
1003423991 6:5984345-5984367 CCCCAGAGTCTTTGTGTGGAAGG - Intergenic
1004066440 6:12249738-12249760 AGCCAGAGTCCTTATTTGCAAGG + Intergenic
1006268001 6:32941390-32941412 ACCCAGAGCCCTTCTGGGGCAGG + Intronic
1007219456 6:40266990-40267012 AGCCAGAGCCCTTCTGACAATGG + Intergenic
1010267429 6:73882803-73882825 ATGCAGAGCCCTCGTGTGCATGG + Intergenic
1010894611 6:81349085-81349107 AGCCAGACCAGTTGTGAGGAGGG + Intergenic
1010978914 6:82348135-82348157 GGGCAGAGCCTCTGTGTGGATGG + Intergenic
1013602478 6:111718103-111718125 AGCCAGCCCCACTGTGTGGAAGG + Intronic
1013790730 6:113833750-113833772 ACCCGGAGTCCTTGTGTTGAAGG - Intergenic
1015176181 6:130311799-130311821 AAACAGAGACCCTGTGTGGAAGG - Intronic
1016791481 6:148070930-148070952 AGCCAGAGCCCTGGAGACGAAGG - Intergenic
1016822848 6:148362477-148362499 AGACTGAGGCCTTGTGTGGGAGG - Intronic
1019290752 7:248892-248914 AGTCAGCACCCTGGTGTGGAAGG - Intronic
1019320883 7:414716-414738 GGCCAGAGCCCTGGTGTGAAAGG + Intergenic
1019595936 7:1858434-1858456 ACGCAGAGCCCCTGGGTGGAAGG - Intronic
1020128127 7:5544578-5544600 AGCCAGAGCCCAGGCCTGGAGGG + Intronic
1020324012 7:6960650-6960672 AGCCAGATCCAGTGTGAGGAGGG + Intergenic
1020688668 7:11327557-11327579 AGCCAGATACCTGGTCTGGAAGG - Intergenic
1021065236 7:16164911-16164933 AGCCAGAGCCCTCCTGTAGGAGG + Intronic
1021444594 7:20718600-20718622 AGGCAGAGCCCTGGGGGGGAGGG + Intronic
1022499187 7:30871980-30872002 AGGCAGAGCCCTGGTGCGGCTGG + Intronic
1024307624 7:47941367-47941389 AGCCACATCCCCTGTGAGGATGG - Intronic
1028414619 7:90566658-90566680 AGCCACAGCCCATGAGAGGAGGG - Intronic
1029218711 7:98970777-98970799 AGCCCCAGCCCCTGTGTGGCAGG - Intronic
1029227404 7:99038148-99038170 GGACAGAGCCCATGTGGGGAAGG - Intronic
1031553467 7:123143253-123143275 AGCCAGAGGACTTGTGTGGGGGG - Intronic
1032957163 7:136984554-136984576 ACCCAGAGCCCTTGTGGTGTAGG + Intronic
1033588670 7:142792771-142792793 GGTCAGCGCCCTTGTGTTGATGG + Intergenic
1034516564 7:151585494-151585516 AGCACGAGCCCATGTGTGGCAGG + Intronic
1034872527 7:154696625-154696647 GGACAGAGCCCATGAGTGGAAGG - Intronic
1035755364 8:2027051-2027073 GGATAGAGCCCTTGTGTGGTAGG - Intergenic
1036372062 8:8170335-8170357 AGCCAGACCCAGTGTGAGGAGGG - Intergenic
1036614385 8:10377475-10377497 AGCCATATCCTTTGGGTGGATGG + Intronic
1036878838 8:12495306-12495328 AGCCAGACCCAGTGTGAGGAGGG + Intergenic
1037567982 8:20133726-20133748 AGCCAAAGCCAGTGTGTGTAAGG + Intergenic
1042787976 8:72571088-72571110 TGCCAGATCCCTAGTATGGAAGG + Intronic
1043284393 8:78511617-78511639 AGCCAGAGGCCCTGTGTGCTGGG - Intergenic
1044073281 8:87788702-87788724 ATCCAGAGCACTTTTGTGAAAGG - Intergenic
1045733532 8:105268205-105268227 AGCCAGCACCCCTGTATGGAGGG - Intronic
1045883240 8:107065301-107065323 ACCCAGGGCCCTGGTGTGGTAGG + Intergenic
1045994805 8:108350994-108351016 AGCCAGTGCCTGTGTATGGAGGG + Intronic
1046492944 8:114976819-114976841 AGCCACAGCCTGGGTGTGGAAGG + Intergenic
1047900992 8:129422483-129422505 AGCCAGTGCCCATGCATGGAAGG + Intergenic
1048963193 8:139596874-139596896 AGGCAGAGCCATTGTCTGGCAGG + Intergenic
1049014214 8:139908166-139908188 AGCCAGAGCCCTAGGATGGTTGG - Intronic
1049205003 8:141359528-141359550 AGCCTGGGCCCTTGTGTGGTGGG - Intronic
1049423255 8:142526073-142526095 AGCCAGGGCCCTTATGGGGTGGG + Intronic
1051618524 9:19029399-19029421 AGACAGCGCCCTTGAGTGGGAGG - Intronic
1052432214 9:28381162-28381184 TTCCAGAGTCCTAGTGTGGAAGG + Intronic
1053612083 9:39724319-39724341 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1053791447 9:41688983-41689005 ACCGGGAGCCCTTGTGGGGAAGG + Intergenic
1053870117 9:42482311-42482333 AGCCAGAGCCATGCTGTGGTGGG - Intergenic
1054179794 9:61900676-61900698 ACCGGGAGCCCTTGTGGGGAAGG + Intergenic
1054241435 9:62618074-62618096 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054473493 9:65556907-65556929 ACCGGGAGCCCTTGTGGGGAAGG - Intergenic
1054555563 9:66652597-66652619 AGCCAGAGCCATGCTGTGGTGGG + Intergenic
1054657745 9:67680144-67680166 ACCGGGAGCCCTTGTGGGGAAGG - Intergenic
1055075281 9:72208342-72208364 AGCAAGAGCCACTGTCTGGAGGG + Intronic
1055208572 9:73762537-73762559 AGCCAGAGACCCTGGTTGGAAGG - Intergenic
1055480835 9:76707834-76707856 AGCCAGAGAACGTGGGTGGAGGG - Exonic
1056907485 9:90666078-90666100 AGCCAGAGACCCTGACTGGAAGG + Intergenic
1057067984 9:92073046-92073068 AGCCAGAGCAGGTGTGAGGAGGG - Intronic
1058624521 9:106921001-106921023 AGCTACAGCCTTTGTGTTGAAGG + Intronic
1059262679 9:112993689-112993711 AGACTGAGCTCTTGTGGGGAGGG - Intergenic
1060554269 9:124500300-124500322 ACCCAGAGCCCTTCTCTGGAGGG - Exonic
1060920200 9:127415041-127415063 AGCCAGAGCGGGTGTGAGGAGGG - Intergenic
1061238926 9:129358035-129358057 AGCCAGAGCCCTGGGGTGGGGGG + Intergenic
1061615167 9:131774570-131774592 AGCCAGAGCCCTTGAGCAGGGGG - Intergenic
1062037486 9:134389263-134389285 AGCCAGCGCCCACGTGTGCAGGG - Intronic
1062542876 9:137049279-137049301 AGCCAGCGCCCATGCCTGGAAGG + Intronic
1203692085 Un_GL000214v1:52110-52132 AGCCTGAAGCGTTGTGTGGAAGG - Intergenic
1203644210 Un_KI270751v1:52081-52103 AGCCTGAAGCGTTGTGTGGAAGG + Intergenic
1185478354 X:428414-428436 CTCCAGAGCCCGTGTGAGGAGGG - Intergenic
1187572049 X:20514742-20514764 AACCAGAGACATTGTGTGGCAGG - Intergenic
1187729117 X:22234934-22234956 ACCCAGAGCCCTGGTGGGGTAGG + Intronic
1193389242 X:80906842-80906864 AGCCAGAGCTCTTCTGTGTGAGG - Intergenic
1197461458 X:126747132-126747154 AGCCAGAGGCCTTTTGTGTCTGG + Intergenic
1198805507 X:140490380-140490402 AGCAAGAGCACTTGAGTTGATGG + Intergenic
1199271104 X:145883482-145883504 AGCCAGAACCCTATTGCGGACGG - Intergenic