ID: 902954814

View in Genome Browser
Species Human (GRCh38)
Location 1:19918343-19918365
Sequence CTGTGCTAGCAAAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902954814_902954817 -2 Left 902954814 1:19918343-19918365 CCTCCTTCCTTTTGCTAGCACAG 0: 1
1: 0
2: 0
3: 25
4: 235
Right 902954817 1:19918364-19918386 AGAGCTTCTTCACCTTTTAAAGG 0: 1
1: 0
2: 1
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902954814 Original CRISPR CTGTGCTAGCAAAAGGAAGG AGG (reversed) Intergenic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
902184243 1:14713164-14713186 CTGTGCTAGCGTAATGAAGGAGG - Intronic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
903514787 1:23903003-23903025 CTCTGCAAGCAAAAGCAGGGAGG + Intronic
905970919 1:42141775-42141797 CAGTGCTGGCAAAAAGAATGTGG - Intergenic
906468698 1:46108715-46108737 CTGTGCTAGCTCAGGGAAGGAGG - Intronic
908467288 1:64409173-64409195 CTCTGTTATCAAAAGAAAGGTGG + Intergenic
909514337 1:76490190-76490212 CTGAGGTAGAAATAGGAAGGTGG + Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
910358585 1:86392141-86392163 CTGTGCTTGCAGGAGTAAGGTGG - Intronic
911119493 1:94281389-94281411 CTGGGCAAGCACAAGGCAGGAGG + Intergenic
911389493 1:97221252-97221274 ATGTGCTAGCAAAATGAAAGAGG - Intronic
911397947 1:97335800-97335822 CTTTGCTTTCAAAAGGCAGGTGG - Intronic
912507665 1:110167194-110167216 CTGTGCCAGAAAAATGGAGGAGG + Exonic
912663669 1:111559686-111559708 CAGTGATAGCAAAAGGAACATGG - Intronic
914202984 1:145503032-145503054 GTGAGGTAGCAAAAGGAAGAGGG - Intergenic
914236914 1:145820966-145820988 GTGAGGTAGCAAAAGGAAGAGGG - Intronic
914482106 1:148076183-148076205 GTGAGGTAGCAAAAGGAAGAGGG - Intergenic
915743120 1:158134896-158134918 CTGAGATAGAAAAAGGAAAGAGG - Intergenic
915757855 1:158279949-158279971 CTTTCCTAGCCAAGGGAAGGGGG - Intergenic
916090271 1:161303216-161303238 CTGAGCTAGCAAAATGCAGGTGG + Intergenic
916827445 1:168456147-168456169 ATGTTCGAGCCAAAGGAAGGTGG + Intergenic
916896093 1:169163542-169163564 CTTTGCTAGCAAAAGGATCCAGG - Intronic
917041031 1:170806696-170806718 CTCTGCTACCAAAGGAAAGGGGG - Intergenic
918484971 1:185019083-185019105 CTAGACTAGCAAAAGGAAGCAGG - Intergenic
919394267 1:197024585-197024607 CTGTGCAATCAAAAGGAAAGTGG - Intergenic
919919111 1:202157876-202157898 CTGTTCTAGAAAAAGGTAGAAGG - Intronic
920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG + Exonic
920962084 1:210672326-210672348 CAGTGGTAGGAATAGGAAGGAGG - Intronic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063246087 10:4220278-4220300 CTGGGGCAGAAAAAGGAAGGGGG - Intergenic
1065866593 10:29920041-29920063 AGGTGCTGGCAAAATGAAGGGGG - Intergenic
1066483540 10:35822163-35822185 CTGTGCTAGATACTGGAAGGAGG + Intergenic
1066827848 10:39628550-39628572 CTGCTCTATGAAAAGGAAGGTGG - Intergenic
1066843113 10:39957094-39957116 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066854994 10:40192046-40192068 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066858486 10:40261327-40261349 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066861680 10:40324810-40324832 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066868645 10:40463685-40463707 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066907098 10:41222828-41222850 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1066910618 10:41291796-41291818 CTGTTCTATGAAAAGAAAGGTGG - Intergenic
1067225721 10:44374510-44374532 CAGTGCTGGCAAGAGGAACGTGG + Intronic
1068545668 10:58342452-58342474 CTCTGCTCGCATAAGGAGGGTGG - Intronic
1070381341 10:75883080-75883102 CTGAGCTAGCAAGGAGAAGGAGG - Intronic
1071672761 10:87624960-87624982 GTGTGCAAGAAAAAGAAAGGGGG - Intergenic
1072173800 10:92895648-92895670 CTGTTCAAACAAAAGGAAGCAGG + Intronic
1072492899 10:95925786-95925808 ATTTGCTAGCAAAAGGGAAGTGG + Intronic
1076927645 10:133500986-133501008 CTCAGCTATCAAAAGCAAGGTGG - Intergenic
1077317753 11:1926955-1926977 CTGGGCTGCCAACAGGAAGGTGG + Intronic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1081964069 11:47158921-47158943 CTCAACTGGCAAAAGGAAGGGGG - Intronic
1085925773 11:81018835-81018857 CTGTGGAAGCAAATGGAATGGGG - Intergenic
1087054207 11:93917762-93917784 ATTTGCTAGATAAAGGAAGGAGG + Intergenic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1088507811 11:110542956-110542978 ATGTGCTAGCAACAGCAGGGTGG - Intergenic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090022675 11:123141528-123141550 CTGTCACAGCACAAGGAAGGAGG - Intronic
1091035792 11:132232201-132232223 CTGTGCGAGGAAAGGAAAGGAGG + Intronic
1091695195 12:2623667-2623689 CTGGGCTAGCATTTGGAAGGAGG - Intronic
1092621598 12:10277292-10277314 CTGAGCTAAGAAAAGCAAGGAGG + Intergenic
1092629099 12:10359400-10359422 CTGTACTATCAAATGGAAGGAGG - Intergenic
1093149822 12:15607536-15607558 CAATGCTTGCATAAGGAAGGTGG - Intergenic
1093969425 12:25361328-25361350 TTGAGCTAGCAAAAGCAAGTGGG - Intergenic
1096788657 12:54031878-54031900 CTGAGCTACCAAGAGGAATGGGG - Intronic
1100317717 12:93460878-93460900 GGGTGCTAGCAAAAGCAATGAGG - Intergenic
1104201001 12:126588745-126588767 TTGTGGTTACAAAAGGAAGGTGG + Intergenic
1106635194 13:31521619-31521641 CTGTCTTAGCAAAAGGAATCAGG - Intergenic
1107268910 13:38591350-38591372 CTGTGCTAGTGATAGGCAGGTGG - Intergenic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1110755874 13:79172991-79173013 CTATTCTTGCAAAAGTAAGGTGG + Intergenic
1112593093 13:100782455-100782477 CTCTGCTTACAAAGGGAAGGAGG + Intergenic
1114203633 14:20547154-20547176 CTCTGCAAACAAAGGGAAGGAGG + Intergenic
1115514576 14:34172900-34172922 CGGTGCAAGCATGAGGAAGGGGG + Intronic
1117572532 14:57062100-57062122 CTGTTTTGGGAAAAGGAAGGGGG - Intergenic
1117797546 14:59409677-59409699 CTTTCCTAGCCAAGGGAAGGGGG + Intergenic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1122993239 14:105248761-105248783 CTCTGCAAGCAAAAGCAAGGAGG - Exonic
1125522638 15:40356779-40356801 CTGTGCAAACAAAGGTAAGGGGG - Intergenic
1125970296 15:43905947-43905969 CTCCGCTTTCAAAAGGAAGGTGG + Exonic
1127616345 15:60689949-60689971 GTGTGGTAGCTAAAGGATGGTGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128550413 15:68594745-68594767 GTGTGCTTGCAGAAGGAAGTGGG + Intronic
1128733195 15:70034554-70034576 CTGTGCTACCACAAGGTAGAAGG + Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131470515 15:92692871-92692893 CTCTGCTGGCAACAGCAAGGGGG + Intronic
1133173607 16:3997556-3997578 CTGCGCTTGCAGAAGGAAGGGGG + Intronic
1133483352 16:6193800-6193822 CAGAGCTTTCAAAAGGAAGGAGG - Intronic
1135330862 16:21558447-21558469 CCGTGGTGGCAAAAGGAAGGGGG + Intergenic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1137892161 16:52174140-52174162 TTGTCCTAGCAACAGGTAGGCGG + Intergenic
1137928139 16:52561450-52561472 CTGTAGTGGCAAAAGGATGGTGG - Intergenic
1138488967 16:57365043-57365065 CTTTGGGAGCACAAGGAAGGTGG - Exonic
1138890046 16:61130778-61130800 CTGTGCCATCTAAAGGGAGGTGG - Intergenic
1143336009 17:6171959-6171981 CTGTGCTAGAGGTAGGAAGGCGG + Intergenic
1143569901 17:7750185-7750207 CTGCGCTAGCAAAAATAATGAGG - Intronic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145921710 17:28614662-28614684 CTGTGCCAGGAAACGGGAGGGGG - Exonic
1151554800 17:74841377-74841399 GTGTGATAGAAAAAGGAAGTGGG + Intergenic
1152191481 17:78890875-78890897 CTGAGCTAGAAAAAGAGAGGAGG - Exonic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1152482890 17:80567423-80567445 CATTGATAGCAAAAGGACGGGGG - Intronic
1153455409 18:5276086-5276108 CTCTCATAGCAAAAGGCAGGAGG - Intergenic
1156280008 18:35627810-35627832 CTTTCCTAGCCAAGGGAAGGAGG + Intronic
1156289280 18:35731679-35731701 ATCTGCCTGCAAAAGGAAGGTGG + Intergenic
1160355886 18:78228195-78228217 CTGGGCAAGGCAAAGGAAGGCGG + Intergenic
1160409324 18:78664358-78664380 CTGTCCTGGCAACAGGATGGAGG + Intergenic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1163177511 19:15574728-15574750 CTCTGCCTGCAAATGGAAGGAGG + Intergenic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1164230667 19:23284967-23284989 CTGTGGAAGCAAAATGAAAGTGG + Intergenic
925270105 2:2599615-2599637 CTGTGCACTCAAAAGGCAGGGGG + Intergenic
925296257 2:2779596-2779618 CTGTGCAAGCAGGAGGCAGGGGG - Intergenic
925740769 2:7004243-7004265 CTGTGGTAGCAAAATGGTGGTGG + Intronic
926249778 2:11147976-11147998 CAGTGCCAGCAAAAGGAAATGGG + Intergenic
926429735 2:12773693-12773715 TGTGGCTAGCAAAAGGAAGGGGG + Intergenic
927058455 2:19389864-19389886 CTTTCCTAGCCAAGGGAAGGGGG - Intergenic
927171689 2:20375528-20375550 TTGTGCTAAGAAAAGGAGGGAGG + Intergenic
927426930 2:22991316-22991338 TTGTGCTGGCAAATGGGAGGAGG - Intergenic
927877350 2:26667216-26667238 CTGTGCTAATAAAATGGAGGTGG - Intergenic
929131245 2:38574962-38574984 CTGTACAAGCAAATGGTAGGTGG - Intronic
929512517 2:42575883-42575905 CTGTGCTGACAACAGGTAGGCGG - Intronic
930459076 2:51647397-51647419 CTCTTCTTGCAAAATGAAGGAGG - Intergenic
930481596 2:51954313-51954335 TTGGGCTAGTAAGAGGAAGGTGG + Intergenic
931207634 2:60163581-60163603 CTGTGATACAAAAAGAAAGGAGG - Intergenic
931897753 2:66752060-66752082 CGGTGTTAACAAAAGAAAGGAGG + Intergenic
931900840 2:66785988-66786010 CTATGCCAGGAAAAGCAAGGCGG - Intergenic
936608273 2:113978633-113978655 CTTTTCTGGCAAAAGGAAGCAGG - Intergenic
938695533 2:133832096-133832118 CCCTGCTAACACAAGGAAGGAGG + Intergenic
938862177 2:135381092-135381114 CTTTCCTAGCCAAGGGAAGGGGG + Intronic
939363064 2:141198661-141198683 CTGTGCTAGAAGAAGGAATTGGG - Intronic
941193281 2:162414121-162414143 CAGCGCTAGTAAAGGGAAGGGGG + Intronic
941380948 2:164791732-164791754 CTCTGCTACCATCAGGAAGGTGG - Intronic
941632526 2:167900411-167900433 CTGAGCTGGGGAAAGGAAGGAGG - Intergenic
943063213 2:183060494-183060516 CCGTGCTAACAAAGGGAAAGGGG - Intergenic
944878565 2:203987678-203987700 CTATTCTAGCAGAAGTAAGGTGG + Intergenic
945160247 2:206883126-206883148 CTCTGCACTCAAAAGGAAGGAGG + Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
1170789491 20:19496099-19496121 CTGTGCCAGCCAAAGGGAGCCGG - Intronic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1173519987 20:43692187-43692209 CTCTACCATCAAAAGGAAGGTGG + Exonic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1174085230 20:48003303-48003325 TGGTGCTTGCAAAAGGAAAGAGG - Intergenic
1175074767 20:56363089-56363111 ATGTGCTGGCCAAAGAAAGGGGG + Intronic
1177301630 21:19252977-19252999 CTAGGATAGCAAAAGGTAGGAGG - Intergenic
1177730483 21:25022417-25022439 ATGAGCTAGCAAATAGAAGGTGG - Intergenic
1178026522 21:28474601-28474623 CTGAGATACCAAAAGGAATGGGG - Intergenic
1179180577 21:39041578-39041600 GTGTGCTAGGAAAATGAAGAAGG - Intergenic
1180164512 21:46017027-46017049 CTGGTCTAGCAAAGGGAGGGAGG + Intergenic
1181573620 22:23780842-23780864 CTGTGCCTGAAAAAGGGAGGTGG - Exonic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1183173762 22:36206851-36206873 CCCTGCAAGCAAACGGAAGGTGG - Intergenic
1184579488 22:45404991-45405013 ATGTGCTAGTACAAGGGAGGGGG + Intronic
949809717 3:7993184-7993206 ATGTGTTAGGAAAAGGATGGGGG - Intergenic
954629702 3:52041183-52041205 CTGTGAGAGCAAAAGGGTGGAGG - Intergenic
955544221 3:60010762-60010784 GTGTGCTAGGAGAAGAAAGGAGG - Intronic
956377518 3:68631500-68631522 ATGTGTTGGCAAAAGGAAAGAGG - Intergenic
956879716 3:73498536-73498558 TTGTGCTAGCAGGAGAAAGGGGG + Intronic
958223213 3:90773865-90773887 CTCTTCTATCAAAAGGAAGGTGG - Intergenic
958223408 3:90777266-90777288 CTCTTCTATCAAAAGGAAGGTGG - Intergenic
958235817 3:90986249-90986271 CTCTTCTATCAAAAGGAAGGTGG - Intergenic
958240868 3:91071193-91071215 CTCTTCTATCAAAAGGAAGGTGG - Intergenic
958243363 3:91112827-91112849 CTCTTCTATCAAAAGGAAGGTGG - Intergenic
958915055 3:100040549-100040571 ATGTGCTGAAAAAAGGAAGGGGG - Intronic
959900900 3:111661208-111661230 CTGTCCTGGGAACAGGAAGGGGG + Intronic
960063915 3:113350712-113350734 CTTTGCTAGCAGAAGAAAGTGGG + Intronic
962267693 3:133955310-133955332 CTGTGCTAGCAAATGGGACATGG + Intronic
963750636 3:149175788-149175810 CTGTGCTTCCAAGGGGAAGGAGG - Intronic
964288191 3:155144685-155144707 CTGTTCAAGCAAATGTAAGGTGG + Intronic
966364548 3:179170023-179170045 CTGTGCTGGAGAAAGGAAGAGGG - Intronic
968081980 3:195852890-195852912 CTGTGCTTCCAAAAGTATGGAGG + Intergenic
970732554 4:19123910-19123932 CAGAGCTAGCCGAAGGAAGGAGG + Intergenic
972729923 4:41784353-41784375 CTGTGCTAACAAAAAGATTGAGG - Intergenic
972908979 4:43789825-43789847 CAGTACTAGCAAAAGGAAGAAGG - Intergenic
974020268 4:56686906-56686928 CTGTGCTAGTAGAAAGCAGGGGG + Intergenic
974220264 4:58960133-58960155 CTAAGCTAGCAAAAAGTAGGAGG - Intergenic
974437224 4:61871428-61871450 TTGTGCGATCAAAAGGAATGAGG + Intronic
976411648 4:84720384-84720406 TTATGCAAGTAAAAGGAAGGGGG + Intronic
978449384 4:108814418-108814440 CAAGGCTTGCAAAAGGAAGGAGG - Intronic
979599809 4:122575080-122575102 CTTTCCTAGCCAAGGGAAGGGGG - Intergenic
979904251 4:126264985-126265007 TTGTGCTTAGAAAAGGAAGGAGG + Intergenic
981143621 4:141300182-141300204 CTGAGTTAGGAAAAGGAAAGAGG + Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
986035928 5:3939622-3939644 CTATGCAAGCAAAAAGAAAGTGG - Intergenic
986384444 5:7217854-7217876 CTGTGGGAGCATGAGGAAGGAGG - Intergenic
987914679 5:24196628-24196650 CTATGCTAGAGTAAGGAAGGTGG - Intergenic
988410756 5:30882886-30882908 CAGTGATATGAAAAGGAAGGAGG - Intergenic
988666021 5:33328658-33328680 CTTTGCTAGCAAAAGAAAATGGG + Intergenic
990172045 5:53062378-53062400 TTGTCATAGCAAAAGGCAGGAGG - Intronic
990183100 5:53184570-53184592 CTTTGCTGGCATCAGGAAGGAGG - Intergenic
990833512 5:59987436-59987458 CTGTGTTAGAAAAAGGTATGAGG - Intronic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
991147559 5:63324487-63324509 GTGTACTAGGAAAAGAAAGGAGG - Intergenic
992454303 5:76902120-76902142 CTCTTCAAGCAGAAGGAAGGGGG + Intronic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
995467579 5:112466633-112466655 CTTTCCTAGCCAAGGGAAGGGGG - Intergenic
996700506 5:126445959-126445981 CTGTGCTAGCAAGAGCCATGTGG + Intronic
996924109 5:128802482-128802504 TAGTGCTAGCAAAAGGATGGAGG + Intronic
999295146 5:150454817-150454839 ATGTTCTAGCAACAGCAAGGAGG + Intergenic
999936706 5:156494429-156494451 TTTTGCTAGGCAAAGGAAGGAGG + Intronic
1001098786 5:168796898-168796920 CTCTCCAGGCAAAAGGAAGGGGG + Intronic
1001490139 5:172149295-172149317 GGGTGGTAACAAAAGGAAGGAGG - Intronic
1003528995 6:6921957-6921979 CAGTTCTAACAAATGGAAGGTGG + Intergenic
1004137332 6:12980110-12980132 GTGTCATAGCAAAAGGAGGGTGG + Intronic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1011111412 6:83840682-83840704 CTGGGCTAGGAAAAGAAAAGAGG + Intergenic
1017371873 6:153720861-153720883 GAGTGCTAGGAAAAAGAAGGAGG - Intergenic
1017676232 6:156816962-156816984 CTGTGGTATCAAAAAGAATGTGG - Intronic
1019170782 6:170132184-170132206 CTGTCCTTGCAAAAGGGAGGAGG + Intergenic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022488420 7:30798341-30798363 CTGTGTTAGAGAAAGAAAGGAGG + Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1024767617 7:52679109-52679131 CTGTGCTGGGAGATGGAAGGTGG - Intergenic
1024981786 7:55163346-55163368 AAGTGATAGAAAAAGGAAGGAGG - Intronic
1026639856 7:72114689-72114711 GTGTGCTAGAAAAAGGAGGCTGG + Intronic
1032118420 7:129137476-129137498 CAGTGCTCAAAAAAGGAAGGGGG - Intergenic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1035403512 7:158584200-158584222 CTTCTTTAGCAAAAGGAAGGGGG + Intronic
1035645219 8:1213895-1213917 CTGGGCCAGCAAAAGGAGTGAGG - Intergenic
1036583697 8:10102745-10102767 CTGTGCTAGCAGGGGAAAGGGGG + Intronic
1036734389 8:11297877-11297899 CTGTGCCAGGAAAAGGATAGAGG - Intronic
1039444996 8:37623951-37623973 AGGTGCTAGCTAAAGGTAGGTGG - Intergenic
1039731912 8:40289009-40289031 CTGTCCTTCCAAGAGGAAGGAGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1045241065 8:100402038-100402060 CTTTCCTAGCCAAGGGAAGGGGG + Intronic
1046809859 8:118521315-118521337 CTCTGCTAGCAAAGGGATGAAGG - Intronic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1048008534 8:130438500-130438522 CTGTGCTAGGAAATGGACTGGGG + Intronic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1050818188 9:9841965-9841987 CTTTGCTAGGACAAGGAAGTAGG + Intronic
1051068552 9:13134929-13134951 ATGTGGTAGCAACAGTAAGGAGG - Intronic
1051116251 9:13697776-13697798 ATGTGCTAGCAAAATGATGTGGG + Intergenic
1051718352 9:20009053-20009075 CTATGCTAGCTTAAGGAAGGAGG - Intergenic
1053390962 9:37735871-37735893 CTGTTCTATCAAACGGAAAGTGG + Intronic
1055659784 9:78491322-78491344 CAATGCCAGCAAGAGGAAGGAGG - Intergenic
1057759657 9:97861910-97861932 CTGTGCAGGGAAAATGAAGGCGG - Intergenic
1058496399 9:105563393-105563415 CTTTCCTAGCCAAGGGAAGGGGG + Intronic
1058854142 9:109043629-109043651 CTGAGCTACCAAAAGGAGGGAGG - Intronic
1059454463 9:114390764-114390786 CTGTCCCAGGAAAAGCAAGGAGG - Intronic
1059657561 9:116369907-116369929 ATGTGGTAGAAAAAGGGAGGAGG + Intronic
1061353871 9:130088246-130088268 CTGTCCGAGAAAAAGCAAGGCGG - Intronic
1061379339 9:130244717-130244739 TTGTGCTTGCACCAGGAAGGTGG - Intergenic
1062046644 9:134427505-134427527 CTGTGCAACCAAAATGAGGGAGG - Intronic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1188625520 X:32279738-32279760 TTGTGCTAGCAAATAGTAGGTGG - Intronic
1189225243 X:39407525-39407547 CAGAGCTAGCTAAAGGAAAGAGG + Intergenic
1190955313 X:55187261-55187283 CTGTGCTGGATAACGGAAGGGGG - Intronic
1193358843 X:80556280-80556302 ATGTGCTAAAAAAAGGTAGGGGG - Intergenic
1194041936 X:88952035-88952057 TTGTGCTAGCAAATGGAACAGGG - Intergenic
1197025310 X:121740586-121740608 CTCTGCTAGCAATAGCAATGTGG + Intergenic
1197356078 X:125438647-125438669 CTGTCACATCAAAAGGAAGGAGG - Intergenic
1197748947 X:129952108-129952130 CTGTGCTAGCAAAATGCCAGAGG - Intergenic
1198059251 X:133027768-133027790 TTGAGATAGCAAAAGGAAGTGGG - Exonic
1198474534 X:136983023-136983045 CTTTCCTAGCCAAGGGAAGGGGG - Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1200683183 Y:6236885-6236907 TTCTGATAGCCAAAGGAAGGGGG - Intergenic
1201049450 Y:9917501-9917523 TTCTGATAGCCAAAGGAAGGGGG + Intergenic