ID: 902955516

View in Genome Browser
Species Human (GRCh38)
Location 1:19922214-19922236
Sequence AGACAGGAAGCCCCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902955516_902955518 6 Left 902955516 1:19922214-19922236 CCATCAGGAGGGGCTTCCTGTCT 0: 1
1: 0
2: 0
3: 17
4: 215
Right 902955518 1:19922243-19922265 GCCTCCACCCACCTCACCGCAGG 0: 1
1: 0
2: 1
3: 28
4: 496
902955516_902955524 15 Left 902955516 1:19922214-19922236 CCATCAGGAGGGGCTTCCTGTCT 0: 1
1: 0
2: 0
3: 17
4: 215
Right 902955524 1:19922252-19922274 CACCTCACCGCAGGGTGTCTAGG 0: 1
1: 0
2: 2
3: 11
4: 130
902955516_902955527 25 Left 902955516 1:19922214-19922236 CCATCAGGAGGGGCTTCCTGTCT 0: 1
1: 0
2: 0
3: 17
4: 215
Right 902955527 1:19922262-19922284 CAGGGTGTCTAGGTCACTTCAGG 0: 1
1: 0
2: 2
3: 10
4: 150
902955516_902955520 7 Left 902955516 1:19922214-19922236 CCATCAGGAGGGGCTTCCTGTCT 0: 1
1: 0
2: 0
3: 17
4: 215
Right 902955520 1:19922244-19922266 CCTCCACCCACCTCACCGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 265
902955516_902955528 26 Left 902955516 1:19922214-19922236 CCATCAGGAGGGGCTTCCTGTCT 0: 1
1: 0
2: 0
3: 17
4: 215
Right 902955528 1:19922263-19922285 AGGGTGTCTAGGTCACTTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902955516 Original CRISPR AGACAGGAAGCCCCTCCTGA TGG (reversed) Intronic
900409272 1:2505400-2505422 AGCCTCGAAGCCCCTCCTGTGGG - Exonic
900625578 1:3607117-3607139 GGACAAGAAGGCCCTTCTGAGGG - Intronic
900959519 1:5910152-5910174 AGACCCCAAGCCCATCCTGACGG + Intronic
902955516 1:19922214-19922236 AGACAGGAAGCCCCTCCTGATGG - Intronic
903027794 1:20442004-20442026 AGCAAGGAAGCACCTCCTGCAGG - Intergenic
903131147 1:21280243-21280265 AGACAGGAAGGGTCTCCTGAAGG + Intronic
905399817 1:37692933-37692955 AGACAGGCAGAACCTCCTCAAGG + Exonic
905596866 1:39215160-39215182 AGAGAGGAAGCTCCTCCCTAGGG - Intronic
906299142 1:44669437-44669459 ATTCAGGCAGCCCCTCCTAATGG + Intronic
907266517 1:53264899-53264921 AGGCAGGAACCCCATCTTGATGG + Intronic
907440546 1:54475679-54475701 AGACAGGAAGCCCCTGCCTCGGG - Intergenic
908514982 1:64883331-64883353 GGACAGGGAGCCCCTCCGGCTGG - Exonic
909120001 1:71590459-71590481 GGACTGGAACCCCATCCTGAAGG - Intronic
909563850 1:77033637-77033659 AGTCAGGAAGGGCCTCCTGGAGG + Intronic
910204938 1:84740547-84740569 CGACAGAAAGCCTCTCCTGCTGG + Intergenic
913233309 1:116759920-116759942 AGCCAGGAACCCCATCCTGGAGG - Intronic
914899868 1:151706181-151706203 AGACAGGAATGCCCTCGTTATGG - Intronic
915356304 1:155256878-155256900 TGACAGGGAGCCACTGCTGATGG - Intronic
915936627 1:160093495-160093517 AGATAGGAGGCCCATGCTGAGGG - Intronic
916525327 1:165603908-165603930 TGGAAGGAAGCCACTCCTGAGGG - Intergenic
920445055 1:206010166-206010188 AGACACAAGGCCCCTCCTTAGGG + Exonic
1063494621 10:6495393-6495415 AGGCTGGAAGACCCTGCTGAGGG - Intronic
1065881216 10:30039241-30039263 CTACAGGAAGCCACCCCTGAGGG + Intronic
1068186632 10:53593885-53593907 AGACAGGAAGGAGCTCCTGGAGG - Intergenic
1068639968 10:59392513-59392535 TGAAAGGAAGCCCCTTATGAAGG - Intergenic
1069788856 10:71006596-71006618 AGAACTGCAGCCCCTCCTGAAGG + Intergenic
1069960121 10:72074652-72074674 AGGCAGGAAGGCCAGCCTGAGGG - Intronic
1072048534 10:91681053-91681075 CAACAGGAAGCCCTCCCTGATGG - Intergenic
1073350825 10:102818657-102818679 AGGCAGGAACCCCTTCCTGGAGG - Intergenic
1073945362 10:108743862-108743884 AGACTAGGAGCCCCTCCTGCAGG - Intergenic
1074340978 10:112629527-112629549 AGACAAGAAGCCCCTTCCTAAGG - Intronic
1075171561 10:120120594-120120616 AGACCTGCAGCCCCACCTGAAGG - Intergenic
1075474319 10:122720214-122720236 AGCCAGGAAGCCATTCCTGCTGG + Intergenic
1075567735 10:123516774-123516796 AGCCGGGAAGCCCCTCGTTAGGG + Intergenic
1075616778 10:123895663-123895685 AGACTCACAGCCCCTCCTGAGGG - Intronic
1076519476 10:131071988-131072010 AGGCAGGAAGGGCTTCCTGATGG - Intergenic
1076838480 10:133032975-133032997 GGGCACCAAGCCCCTCCTGAGGG - Intergenic
1077055054 11:587495-587517 AAACAGGGAGGCCATCCTGAAGG - Intronic
1077433711 11:2528266-2528288 AGCCTGGAAGCCCCTCCTCCAGG - Intronic
1078663391 11:13304915-13304937 AGACAGGCTGCCCTACCTGAGGG + Intronic
1078663653 11:13306895-13306917 AGACAGGCTGCCCTGCCTGAGGG + Intronic
1079003186 11:16774538-16774560 AGCCAGGAAGCACTTGCTGAGGG - Intergenic
1079129059 11:17737103-17737125 AGACAGACACCCCCTCCTCAGGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083659005 11:64243496-64243518 AGGTAAGAGGCCCCTCCTGAGGG + Exonic
1084108115 11:66994178-66994200 AGACAGTATGTACCTCCTGATGG + Intergenic
1084215873 11:67646605-67646627 AGTCAGGAAGGCCTTCCTGGAGG + Intronic
1084769475 11:71333547-71333569 ATACAAGAAGCCCCCCCAGAAGG + Intergenic
1085740546 11:79074808-79074830 TGACAGGTAGCCCCTCCTCCAGG + Intronic
1086231062 11:84570314-84570336 AGACAGGAGGACCTTCCTGTAGG - Intronic
1088470579 11:110184552-110184574 AGAAGGGAAACCCCTTCTGATGG + Intronic
1089645261 11:119874719-119874741 AGACAGAAAGCCCTTCGAGATGG + Intergenic
1089999115 11:122938788-122938810 TGATAGGAAGCCCTTCCTGTAGG + Intronic
1090531377 11:127594489-127594511 GGACAGGAACCACCTCATGAGGG - Intergenic
1090643012 11:128745517-128745539 AGTCAGGAAGCAGGTCCTGAGGG - Intronic
1090984842 11:131757044-131757066 AGACAGGCTGCCCCTGCTGAAGG - Intronic
1093396930 12:18694064-18694086 AAACAGGAAGACACCCCTGAGGG + Intronic
1093961962 12:25283916-25283938 AGTCACTAAGCCCCTACTGAAGG - Intergenic
1095948192 12:47765846-47765868 ATGCAGGAAACCTCTCCTGAGGG - Intronic
1096396599 12:51270545-51270567 AGAAAGGAAGCGGCTCCGGATGG - Exonic
1096797292 12:54085844-54085866 AGGTAGGAAGCCCATCCAGAGGG + Intergenic
1098152325 12:67559650-67559672 AGAAAGGAAGCCCCTTAAGAAGG + Intergenic
1098640971 12:72838512-72838534 AGTCTGGAAGCCCCACCTGGGGG - Intergenic
1098975598 12:76898978-76899000 AGACAGGACGCTGATCCTGAAGG - Intergenic
1102569373 12:113818273-113818295 AGACAGGCAGCTGCTCCTGTGGG + Intronic
1102569677 12:113819798-113819820 AGAGATGAAGCCCCTCCTCTGGG + Intronic
1104904432 12:132205755-132205777 AGAAAGGAAGCCCCGGCTCAGGG - Intronic
1105462833 13:20607953-20607975 AGTCAGGAAGCACCTCCTCCTGG + Intronic
1106024409 13:25943149-25943171 AGAGAGGATGCCTCTCCAGATGG - Intronic
1106248101 13:27965594-27965616 AGGCAGAAAACCCCTCCTGCTGG + Intronic
1106411231 13:29513024-29513046 AGACAGAAGGCCCATGCTGATGG - Exonic
1107776674 13:43851496-43851518 AGACAGGGGGTCCCTGCTGATGG - Intronic
1113095426 13:106658667-106658689 AAACAGGAATTCCCACCTGATGG - Intergenic
1114424405 14:22610337-22610359 AAGCAGGAAGCCCCTAATGAAGG - Intronic
1114972419 14:28049713-28049735 AGACAGGAAGCAGATACTGAGGG - Intergenic
1115522893 14:34251089-34251111 AGCCAGGAACCCCTTGCTGAAGG + Intronic
1116181987 14:41546444-41546466 AGACAGGATACCTCTCCTCATGG + Intergenic
1117767179 14:59095368-59095390 AGAGATGAGGCCCCTCCAGATGG - Intergenic
1118200774 14:63670334-63670356 AAAAAGGAAGCCCCTTTTGATGG - Intergenic
1119260038 14:73232538-73232560 AGACAAGAAGGCCATCCAGAGGG - Intergenic
1120978666 14:90272372-90272394 AAACAGGAAGGCACCCCTGAGGG + Exonic
1121716347 14:96078747-96078769 AGGCAGGCAGGTCCTCCTGAAGG - Intronic
1121953070 14:98189161-98189183 TCACAGGAAGGCCCTCTTGAAGG + Intergenic
1122588529 14:102827942-102827964 AGACTCAAAGCCCCTGCTGAGGG - Intronic
1122953549 14:105059343-105059365 ACACAGGCAGCCCCACCTGCTGG - Intronic
1124422853 15:29537770-29537792 ACTCAGGAGGCCCCTACTGATGG + Intronic
1125520640 15:40346161-40346183 AGGCAGGGAGACCCTCCAGATGG + Intergenic
1128078782 15:64843979-64844001 GGAAAGGAAGCCCCTGCTGTGGG - Intronic
1128084404 15:64875839-64875861 AGATAGGAAGCCCCTGGGGAGGG + Intronic
1129906997 15:79195489-79195511 AGACAGGAAGGGACTCCTGCAGG + Intergenic
1130014529 15:80176401-80176423 TGACAGGAACCACCTCATGAAGG - Intronic
1130255207 15:82322776-82322798 AGAGATGAAGCCCCTGCTGGCGG - Intergenic
1130599767 15:85267230-85267252 AGAGATGAAGCCCCTGCTGGCGG + Intergenic
1133421009 16:5646929-5646951 AGCCAGGAAGACCCTCTTGATGG + Intergenic
1136281355 16:29213322-29213344 CGGCAGGAAGCCATTCCTGAGGG - Intergenic
1138315721 16:56068390-56068412 AGCCTGGAACCTCCTCCTGAGGG + Intergenic
1138477424 16:57280070-57280092 TGCCAGGAAGCCCTCCCTGATGG + Intronic
1139444479 16:66988397-66988419 AGACAGGAAGCCCTGGCTGAAGG + Intergenic
1139528986 16:67532907-67532929 AGACAGGAGGTCCCTCAGGAAGG + Intronic
1141198687 16:81881020-81881042 ACACAGGCATCCCCTCCTGGAGG - Intronic
1141445285 16:84054231-84054253 AGCCACTAAGTCCCTCCTGACGG + Exonic
1141981116 16:87550999-87551021 GGACAGGCAGCCCATCCTGGTGG + Intergenic
1142085727 16:88179250-88179272 CGGCAGGAAGCCATTCCTGAGGG - Intergenic
1146525502 17:33563875-33563897 TGAAAGGAAGCCCATCCTGCTGG - Intronic
1146633258 17:34485486-34485508 AGAGAGGCAGAGCCTCCTGAAGG - Intergenic
1149465724 17:56877496-56877518 AGCCAGGAAGCCTTTCCTGGAGG - Intergenic
1149695313 17:58611780-58611802 AGACAGAAAGTGCCTCCTAAGGG + Intronic
1151563103 17:74881291-74881313 CAGCAGGGAGCCCCTCCTGATGG - Intronic
1151599134 17:75095392-75095414 AGCCAGGAATCCCATGCTGATGG - Intronic
1151747349 17:76018611-76018633 AGAAAGGGAGCAGCTCCTGAGGG + Intronic
1152314712 17:79573435-79573457 AGCCTGGAAGCCCCTCCTCCAGG - Intergenic
1152614019 17:81329727-81329749 AGACAGGAAACCCCACCCCAGGG + Intronic
1157026245 18:43847423-43847445 AGATATGCAGCCTCTCCTGATGG + Intergenic
1157293832 18:46427756-46427778 AGACACGAAGCCCAGCCTGGTGG + Intronic
1157368868 18:47091781-47091803 AGACAGGAAGTCACTCTGGATGG + Intronic
1158432382 18:57401012-57401034 AGAAGCTAAGCCCCTCCTGATGG - Intergenic
1159910273 18:74138987-74139009 AGCCTGGTAGCCCCACCTGATGG + Intronic
1159994776 18:74953561-74953583 AGGCAGGGAGCTCCTCCTCAAGG - Intronic
1160388294 18:78511619-78511641 GGACAGGAAGCCTCTCCAGCAGG + Intergenic
1162524704 19:11200680-11200702 AGACACGAGACCCCTCCTGGGGG + Intronic
1165328922 19:35130742-35130764 GGACAGGAAGGGCTTCCTGAAGG - Intronic
926725113 2:15991740-15991762 AGAGAGGAAGACCTTCCTCAGGG + Intergenic
926868485 2:17386382-17386404 AAACAGGAAGGCACCCCTGAGGG + Intergenic
929509649 2:42556669-42556691 AGCCAGAAAGCCACTCCTGGAGG + Intronic
932819555 2:74887779-74887801 AGACAGGCAGACTCCCCTGATGG - Intronic
935736525 2:106110987-106111009 AGCAAGGAAGCCCGGCCTGAGGG + Intronic
937115980 2:119405264-119405286 AGACAGGAAGCCCTGCCAGTAGG + Intergenic
940066433 2:149634883-149634905 AGACAGGAACCACATCATGATGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
945150880 2:206789775-206789797 AGAGAGAAAGCCTCTTCTGAGGG - Intronic
946148250 2:217747096-217747118 AGGCAGGAAGCCCCACTTCATGG - Intronic
948564972 2:238879150-238879172 AGACTGTGAGCCCCTCCTGGTGG + Intronic
1169258459 20:4117691-4117713 AGACACGAAGCCATTCCTGAAGG + Intergenic
1169316082 20:4592229-4592251 CGAAAGCAAGCCCCTCTTGAGGG - Intergenic
1171849138 20:30295702-30295724 AGGTAGGAAGCCCATCCAGAGGG + Intergenic
1172110805 20:32543901-32543923 GGACAGGGAGCCTCTGCTGAAGG + Intronic
1172436520 20:34932446-34932468 AGACAGGAGCCAGCTCCTGAAGG - Intronic
1174206844 20:48846589-48846611 AGCCAGGCAGCCGCTCCTGGCGG + Intergenic
1174860765 20:54088997-54089019 AGACAGTAAGCCCCTGAGGATGG + Intergenic
1175740200 20:61414745-61414767 ACTCAGGAAGTCCCTCCAGATGG + Intronic
1175923475 20:62460952-62460974 GGTCAGGAAGCCCCAGCTGACGG + Intergenic
1176070938 20:63226214-63226236 AAGCTGGAAGCCCCTCCTGTGGG + Intergenic
1176149583 20:63583070-63583092 GGCCAGGGAGCCCCTCCTGCTGG + Intergenic
1179615563 21:42580998-42581020 AGGCAGGAAGCACCTCCGGTTGG + Exonic
1180259968 21:46662192-46662214 AGACAGGGAGCTCCTCCCGTTGG - Intronic
1181571361 22:23769343-23769365 AGAGAGGAGGCCCCTCCATAAGG + Intronic
1184190594 22:42892018-42892040 AGAATGGAAGCCCATCCTGCAGG + Intronic
1184863429 22:47189708-47189730 AGAGACGCAGCCCCTCCTGGGGG + Intergenic
949629917 3:5913730-5913752 AGACATGAAGCACCTCTTCAAGG - Intergenic
950647485 3:14385948-14385970 AGGAAGGAAGCCTCTCCTCATGG - Intergenic
950697634 3:14715518-14715540 AGACAGGAAGCCTGCCCTGAAGG + Intronic
950726591 3:14921064-14921086 AGATGGGCAGCCCCACCTGAAGG - Intronic
950906594 3:16544548-16544570 AGTCAGGGAGCCCTTGCTGATGG - Intergenic
950951683 3:17006632-17006654 AGACAGGAAGTCTCTGCTAAGGG + Intronic
951779347 3:26345923-26345945 AGACAGGGAGCACATCCTGTAGG + Intergenic
953431810 3:42846226-42846248 ATCCAGGAAGCCCTTCCTGAGGG - Intronic
955664484 3:61335845-61335867 GTACAGGAAGCCTCTCCTAAAGG - Intergenic
956378097 3:68636992-68637014 AAACAGGAAGGCACCCCTGAGGG + Intergenic
958678222 3:97293608-97293630 AGGGAGGAAGCCTGTCCTGATGG + Intronic
959520749 3:107320645-107320667 TGACAGGATGCACCTCATGATGG - Intergenic
961311891 3:126007591-126007613 GGACAGTCAGCCCTTCCTGAAGG + Intronic
962331865 3:134485716-134485738 AGGCAGGAAGCCGCAGCTGAGGG - Exonic
963874027 3:150453157-150453179 AGACAGGAAGCCTTTTCTTAGGG + Intronic
968594806 4:1476838-1476860 AGCCAGGAAGCCCATCTTGCTGG - Intergenic
968644292 4:1731240-1731262 AGGCAGGCTGCCCCTGCTGATGG - Exonic
968750135 4:2384559-2384581 AAGCAGGAATCTCCTCCTGAGGG + Intronic
968893528 4:3385293-3385315 AGGCAGGAACCCCTTCCTGCGGG - Intronic
969257472 4:6011925-6011947 AGAAAGGAAACTCCTCCGGAAGG - Intergenic
969451275 4:7274879-7274901 AGCCAGGAAGCACCACGTGATGG - Intronic
972969555 4:44555956-44555978 AGACAGGAAAAGCCTACTGAAGG + Intergenic
974240883 4:59244978-59245000 AGAAAGGAAGCCCATCCTTAGGG - Intergenic
975801976 4:78069601-78069623 ACAAAGAAAGCCTCTCCTGAGGG + Intronic
976521251 4:86030139-86030161 GGACAGGAAGGCACTCCTTAGGG - Intronic
981243508 4:142507206-142507228 AGACACCATGCCCATCCTGAAGG - Intronic
982000059 4:151014554-151014576 AGAGAAGAAACCCCTACTGAAGG - Exonic
984027328 4:174558836-174558858 AGACAGGAAGCTCCTCTTCTTGG - Intergenic
985591144 5:766188-766210 AGACATGAGTCCCCGCCTGATGG + Intronic
985963556 5:3322128-3322150 AGCCAGGGAGCACCTCATGAGGG + Intergenic
990617926 5:57526375-57526397 AGGCACCAAGCCCTTCCTGAAGG - Intergenic
992267998 5:75036785-75036807 AGAGAGCAAGCTCATCCTGAGGG + Intergenic
993666217 5:90699698-90699720 AGACACGGAGGCCCTCCTGCTGG + Intronic
995005913 5:107195102-107195124 AAACAGGAAGGCACCCCTGAGGG - Intergenic
997895063 5:137709029-137709051 AGACAGGAAGCTCAGCCTGTGGG + Intronic
999154508 5:149448836-149448858 AGACTGGGTGGCCCTCCTGAGGG - Intergenic
1000282789 5:159796572-159796594 ATACAGGAATCACCTCTTGAAGG + Intergenic
1001153656 5:169254253-169254275 GGACAGGCAGCCTCTCCTCAGGG - Intronic
1002567417 5:180119697-180119719 AGCCATGGAGCCTCTCCTGAAGG - Intronic
1003282183 6:4703744-4703766 AAACAGGAAGGCACCCCTGAGGG + Intergenic
1004251469 6:14026407-14026429 AGACAGGAACTCCCTACTGATGG - Intergenic
1004993090 6:21161019-21161041 ATACAGGAAGCCCCTTTTGTTGG + Intronic
1006453839 6:34121048-34121070 AGAGAGTAAGCCCTTCATGACGG + Intronic
1012000159 6:93644708-93644730 ATACAGGCAGCCCATCCTAAGGG + Intergenic
1013067956 6:106701790-106701812 AGAGAGGATGCCCCTCCAGATGG - Intergenic
1014772869 6:125476603-125476625 AGACAGAAAGATCTTCCTGATGG - Intergenic
1015344895 6:132144798-132144820 AGAGAGGAAGACCCTCCAAAAGG + Intergenic
1017050006 6:150382045-150382067 AGACAGCAAGCCCTTCCTCAAGG - Intronic
1017503512 6:155046789-155046811 AGACAGGTGGCCTCTCCTGCAGG - Intronic
1019322437 7:421819-421841 AGACAGGAAGGACCTCAGGAGGG - Intergenic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019789540 7:3001994-3002016 ATACAGGAAGCCCTTTCTCAGGG + Intronic
1024082467 7:45866352-45866374 AGATAGGAGGCACCTCCCGATGG + Intergenic
1024132013 7:46362716-46362738 AGGTAGGAATCCCATCCTGAAGG - Intergenic
1024557201 7:50613843-50613865 ATACGGGGAGCCCCTCCTTAGGG - Intronic
1026847164 7:73704755-73704777 AGCCAGGTGGCCCCTCCTGCAGG + Intronic
1033062252 7:138120413-138120435 AGACAGGAAATCCTTACTGAGGG - Intergenic
1033109485 7:138561833-138561855 AGAAAAGGAGCCCCTCCTGTGGG - Intronic
1035353467 7:158263472-158263494 GGTGAGGAAGCCCCTCCTGTGGG - Intronic
1037098706 8:15016968-15016990 GGACAGCAAGCCATTCCTGAAGG + Intronic
1039808351 8:41023007-41023029 AGAGAAAAATCCCCTCCTGAGGG + Intergenic
1040300790 8:46186988-46187010 AGGCTGGGAGCCTCTCCTGAAGG - Intergenic
1040587635 8:48758025-48758047 AGAGGGGAAGCCCCTCCTGCTGG - Intergenic
1041717283 8:60943680-60943702 AGTCAGGAAGGGCCTCCTGAAGG - Intergenic
1045559417 8:103246442-103246464 AGACAGAAAGCCCTTCCAGGCGG + Intergenic
1049199704 8:141334080-141334102 AGACAGGAAGGACTTCCTGGAGG + Intergenic
1049299585 8:141862483-141862505 AGACAGGAGGCCAGCCCTGATGG - Intergenic
1049833034 8:144714138-144714160 ATACAGGAAGCCTCACCTCAGGG - Intergenic
1050032718 9:1403472-1403494 AGCCAGGAAGCCATCCCTGATGG + Intergenic
1052355083 9:27495531-27495553 AGACAAGGAACCCATCCTGATGG + Intronic
1053248607 9:36555915-36555937 AGACATGAGGCACCTCCTGATGG - Intergenic
1058991842 9:110261241-110261263 AGGCAGGCAGCCCACCCTGAGGG + Intergenic
1059316775 9:113432412-113432434 AGACATTAAGGGCCTCCTGATGG - Intergenic
1059685708 9:116633723-116633745 AGGGAGGAAGCCTCTCCTGCTGG + Intronic
1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG + Intronic
1061731968 9:132622490-132622512 GGGCAGGAAGCCTCTCCTGAAGG - Intronic
1062696887 9:137880180-137880202 AGACAGGGAGCCTGTCCTGGAGG + Intronic
1185862476 X:3592202-3592224 AGAGGGGAGGCCCCTCCTGCAGG + Intergenic
1185943953 X:4353630-4353652 AGACAGGCAGCCCCTCAAGGGGG + Intergenic
1188031272 X:25267108-25267130 AGGAAGGAAGCCCTTCCAGATGG + Intergenic
1190411480 X:50140918-50140940 GGACAAGGAGCCCTTCCTGATGG - Intergenic
1196819013 X:119688203-119688225 TGACAGGAAGGGCTTCCTGAGGG - Intronic
1199709412 X:150458270-150458292 AGACAGGATGCCCCTCTAGAAGG + Intronic
1200330010 X:155285692-155285714 AGACTGGAAGCCTCACTTGAAGG + Intronic
1200766872 Y:7087633-7087655 AGACACGATGCCCTTCCTTAGGG - Intronic