ID: 902956402

View in Genome Browser
Species Human (GRCh38)
Location 1:19926854-19926876
Sequence CTAATTTTCAGTTGTTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 2, 1: 0, 2: 2, 3: 32, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902956402_902956406 18 Left 902956402 1:19926854-19926876 CCTTCTAAACAACTGAAAATTAG 0: 2
1: 0
2: 2
3: 32
4: 356
Right 902956406 1:19926895-19926917 GTAGAGTACCTGAAGTCCGGTGG No data
902956402_902956405 15 Left 902956402 1:19926854-19926876 CCTTCTAAACAACTGAAAATTAG 0: 2
1: 0
2: 2
3: 32
4: 356
Right 902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902956402 Original CRISPR CTAATTTTCAGTTGTTTAGA AGG (reversed) Intergenic
900824477 1:4914869-4914891 CTAGTTTTCACTTGTTTAATTGG + Intergenic
900914858 1:5629691-5629713 CTACTTTTCAAATGTTTAGAGGG - Intergenic
902338316 1:15766596-15766618 CTAATTTTTTTTTTTTTAGATGG + Intronic
902446409 1:16467949-16467971 CTAATTTACCATTGTATAGAAGG - Intergenic
902956201 1:19925565-19925587 CTAATTTTCAGTTGTTTAGAAGG - Intergenic
902956402 1:19926854-19926876 CTAATTTTCAGTTGTTTAGAAGG - Intergenic
905579509 1:39073136-39073158 CTAATTTTTTTTTTTTTAGATGG - Intergenic
906297989 1:44660666-44660688 CTAATTTTCACATTTTTAAATGG + Intronic
906305134 1:44713262-44713284 CTAATTTTCATATTTTTAGCGGG + Intronic
906414884 1:45613657-45613679 CTAATTTTATTTTGTTTAGACGG + Intronic
906473170 1:46148062-46148084 CTAATTTTCAGTGATGGAGAGGG + Intronic
906827990 1:49002485-49002507 TTAATTTTCTATTGTTTTGAAGG - Intronic
907184611 1:52600366-52600388 TTAATTTTTATTTTTTTAGATGG + Intergenic
908733704 1:67253849-67253871 CTAATTTTCAGTTCATAACAAGG + Intronic
909271437 1:73627992-73628014 CAGCTTTTCAGCTGTTTAGATGG - Intergenic
909514980 1:76497005-76497027 CTATTTTTCATTTATGTAGAAGG + Intronic
909835808 1:80253238-80253260 CTAATTTTTACTTATTTAAATGG + Intergenic
910787500 1:91016777-91016799 TTAATTTTCAGTTGTCTATTTGG + Intronic
911622485 1:100081030-100081052 TTAATTTTCAGTTGAAAAGAGGG - Intronic
912140525 1:106720282-106720304 TTTATTTTTAGTTTTTTAGACGG + Intergenic
912766263 1:112414357-112414379 CTAATTTTCTTTTTTTGAGATGG - Intronic
916220702 1:162442232-162442254 TTATTTTTCAGTTTTTTAGTTGG + Intergenic
916247571 1:162704500-162704522 ATAAATTTCTGTTGTTTATAAGG - Intronic
916391068 1:164331514-164331536 CTGATATTTACTTGTTTAGAGGG + Intergenic
918051207 1:180974056-180974078 CTAATGTTCAGGGCTTTAGAGGG - Exonic
918533788 1:185551852-185551874 ATAAATTTCTGTTGTTTATAAGG + Intergenic
918765997 1:188484234-188484256 CTCTTTTTCAGTTGTTGAAAAGG - Intergenic
918994874 1:191744397-191744419 GAAATATTGAGTTGTTTAGAGGG + Intergenic
919122561 1:193359442-193359464 TTAAATTTCAGTTGTTTCAATGG + Intergenic
919242342 1:194931240-194931262 CTAAAATTCAGTGGTTAAGAAGG + Intergenic
919572066 1:199261265-199261287 CCAAATTTCTGTTTTTTAGAAGG - Intergenic
920221263 1:204403220-204403242 CAAATCTTCAGTTTCTTAGAAGG + Intergenic
921107052 1:211992361-211992383 CTAATATTCAGTTTTTTAAATGG - Intronic
921654273 1:217715919-217715941 CTAATTTGCATTTGTTTTCAAGG + Intronic
921659132 1:217777829-217777851 AAAATTTTCAGTTTTTTAGGGGG + Intronic
921705129 1:218313833-218313855 CTAATTTTCAGTTATTTGGAAGG + Intronic
922218186 1:223538010-223538032 ATAAATTTCTGTTGTTTATAAGG - Intronic
923581966 1:235226524-235226546 CTAATTTTTTTTTTTTTAGATGG + Intronic
1065502521 10:26396190-26396212 CTAATTTTTAGTTGCTTAGGAGG + Intergenic
1065590551 10:27257939-27257961 TTTATTTTCAGTTTTTTGGAGGG - Intergenic
1066416968 10:35230741-35230763 CTCATATTCATTTGTTAAGAAGG + Intergenic
1066559672 10:36656296-36656318 GTTTTTTTCAGTTGTTGAGAAGG - Intergenic
1067386866 10:45824746-45824768 CTAATTTTTTTTTTTTTAGATGG + Intergenic
1067784074 10:49229764-49229786 TTCATTTTCAGATGTCTAGAAGG - Intergenic
1068123638 10:52811191-52811213 TTAAATTTCAGTTTTTTAGCAGG - Intergenic
1070254362 10:74801187-74801209 CTAATTTTTTTTTTTTTAGATGG - Intergenic
1071908456 10:90202346-90202368 GTAATTTTCAGTTAACTAGATGG - Intergenic
1073304940 10:102495562-102495584 CTAATTTTTTTTTTTTTAGATGG - Intronic
1073972677 10:109062067-109062089 CTAATCTTCAGTTCATTTGATGG + Intergenic
1074010985 10:109479781-109479803 CTTAATTTCTCTTGTTTAGAGGG - Intergenic
1074089361 10:110233199-110233221 CAACTTTTCTGTTGTTTATAAGG + Intronic
1074657410 10:115608953-115608975 TAAATTTCCAGTTGTTTGGATGG + Intronic
1075060548 10:119253912-119253934 CTTATTTTCAGATGTTCACATGG + Intronic
1075965915 10:126611350-126611372 ATAATATTCTGTTGTATAGATGG + Intronic
1076216745 10:128701222-128701244 CTACTTTTTAGTTGTTCAGAAGG - Intergenic
1078464881 11:11542909-11542931 CTAAGTTTCAGTGGTTGAGAAGG + Intronic
1078843217 11:15097920-15097942 CTAATTTTTGGTTGTTATGAAGG + Intergenic
1079182719 11:18208148-18208170 CTAATTTACGGTTCTTAAGAAGG - Intronic
1080226479 11:29967179-29967201 TTAATTTTCACTTATTTATAGGG + Intergenic
1081193363 11:40131318-40131340 TAAATTTTCATTTGTTTATATGG - Intronic
1082894059 11:58171453-58171475 CTGATTTGCAGGTGTTTAGATGG - Intronic
1083588160 11:63875418-63875440 CTAATTTTTCTTTGTTGAGATGG + Intronic
1083930686 11:65842646-65842668 CTAATTTTAATTTCTTGAGATGG - Intronic
1084655821 11:70517499-70517521 CTAATATTCCGTTTTCTAGATGG - Intronic
1085986952 11:81799363-81799385 TTAAATTTCTGTTGTTAAGATGG - Intergenic
1086022020 11:82241626-82241648 CAAATTTTCAGTTGTTAGTATGG - Intergenic
1086109372 11:83182492-83182514 GTAATTTTCATTTCTTTATAAGG + Intronic
1086199803 11:84188263-84188285 CTAAAATTCAGATTTTTAGATGG - Intronic
1086600999 11:88633501-88633523 ATAATTTTCATTTTTTGAGATGG + Intronic
1086880828 11:92151599-92151621 CTAATTTTCATATTTTTAGTAGG - Intergenic
1088076952 11:105861360-105861382 CTAAGTTTCTGTTGTTTATTTGG + Intronic
1088312306 11:108473059-108473081 TTTATTTTCAGTTTTTGAGATGG + Exonic
1090170814 11:124602576-124602598 CTAATTTTTTTTTTTTTAGATGG + Intergenic
1091022110 11:132109485-132109507 ATAAATTTCTGTTGTTTATAAGG + Intronic
1091924570 12:4334586-4334608 ATTATCTTCATTTGTTTAGATGG + Intronic
1092073590 12:5654276-5654298 TTTCTGTTCAGTTGTTTAGAAGG + Intronic
1092198572 12:6565503-6565525 CTAATTTTCATATTTTTAGTAGG + Intronic
1093586453 12:20843027-20843049 GTAAATTTCTGTTGTTTATAAGG + Intronic
1094315153 12:29131525-29131547 CTAATTTTGAGTTAATTAAAAGG + Intergenic
1098091386 12:66905666-66905688 TGAATTTTCAGCTGATTAGAAGG + Intergenic
1098093638 12:66930941-66930963 CTAATTTAGAGTAGTTTAGATGG + Intergenic
1098599568 12:72314903-72314925 CTAATGTTCAGATGGTTAGATGG + Intronic
1098976815 12:76911204-76911226 CTAATTTTCTTTTTTTGAGATGG + Intergenic
1099049007 12:77761060-77761082 CTAATTTTTATTTTTTGAGATGG + Intergenic
1099328577 12:81251906-81251928 ATCATTTTCAGTAGTTGAGAAGG - Intronic
1099985021 12:89652129-89652151 CTAATTTTCACATGTTCACATGG - Intronic
1100332654 12:93599330-93599352 TTAATTTTTATTTGTATAGATGG + Intergenic
1101228548 12:102714868-102714890 CAAAATTTCAGTTATATAGAAGG - Intergenic
1102330827 12:112028808-112028830 TTAATTTATAGCTGTTTAGAGGG - Exonic
1102838455 12:116090753-116090775 CTTAGTTTCAGTTATTTAGCAGG + Intronic
1103697590 12:122829440-122829462 CTAATTTTTTTTTCTTTAGATGG + Intergenic
1107052987 13:36072326-36072348 CTCCTTTTCAGTTCTTTATACGG + Intronic
1107149721 13:37097133-37097155 GTAATTTTCATTCGTTTTGAAGG + Intergenic
1108108506 13:47041048-47041070 CTAATTTTCGTTTTTGTAGATGG + Intergenic
1108250064 13:48556515-48556537 TTAATTTTGAGATGTTTAAAGGG - Intergenic
1108696784 13:52909240-52909262 CTAAAATTCAGTTGTTTAATAGG - Intergenic
1108885984 13:55182402-55182424 CCAATTTTCAATTTTATAGAGGG + Intergenic
1109069961 13:57751999-57752021 ATAATTTTCAGGTGTTTAATTGG + Intergenic
1109571535 13:64198141-64198163 CTAATTTTCACTCCTTTACAAGG + Intergenic
1109971230 13:69771413-69771435 CTCATTTTAAATTTTTTAGAGGG + Intronic
1110066753 13:71116583-71116605 CAAATTTTCAGTTGTCTGGAAGG + Intergenic
1111331007 13:86762034-86762056 TTGGTTTTCAGTTGTGTAGAGGG + Intergenic
1111516464 13:89338137-89338159 CTAATTTTCTGCTGTTGTGAAGG - Intergenic
1111604013 13:90513855-90513877 CTCTTTTTCAGGTGTTTAAAAGG - Intergenic
1112078999 13:95947001-95947023 CTAAATGTGATTTGTTTAGAAGG - Intronic
1112282005 13:98071053-98071075 CTAATTTTTTTTTTTTTAGATGG - Intergenic
1112864951 13:103883531-103883553 CTAATTTTGATTTGTTTAAAGGG - Intergenic
1115304490 14:31919824-31919846 CAAACTGACAGTTGTTTAGATGG - Intergenic
1115361049 14:32503256-32503278 CTATTTTTCAGTTGTGTTGTTGG + Intronic
1115489210 14:33942846-33942868 CTAATTTTTGATTCTTTAGAAGG - Intronic
1116078278 14:40141274-40141296 ATAAATTTCTGTTGTTTATAAGG - Intergenic
1116758031 14:48973084-48973106 CAATTTTTTAGTTGTTGAGAGGG - Intergenic
1116944776 14:50826453-50826475 CTTATTTTGAGTTATTTGGAAGG - Intronic
1117048364 14:51835834-51835856 CTAATTTTCAGGTCTTTTGCTGG + Intronic
1118055529 14:62075721-62075743 GGAATTTTCAGTTCTTTAGAGGG + Intronic
1118693601 14:68363018-68363040 CCTATTTTCAGTTGTTTACCAGG - Intronic
1118830532 14:69427166-69427188 CTAATTTTCAGATTTTTTTATGG + Intronic
1119877954 14:78076557-78076579 CTAATTTTCATTTTTTGAGATGG + Intergenic
1121095419 14:91214981-91215003 CTAATTTTTATATTTTTAGAAGG - Intronic
1123438125 15:20270593-20270615 CTAATTTTTTTTTTTTTAGATGG + Intergenic
1124660044 15:31540121-31540143 ATAATTTTCAATTTTTTTGAAGG + Intronic
1125839252 15:42783387-42783409 ATAAATTTCTGTTGTTTATAAGG + Intronic
1126716220 15:51520548-51520570 GTATTTTTCAGTTCTTTAAATGG + Intronic
1127783546 15:62336368-62336390 CTAATTTTTTTTTTTTTAGACGG - Intergenic
1128432000 15:67605218-67605240 CTAATTTTCTGTATTTTAGTAGG + Intronic
1129480960 15:75825479-75825501 CTAATTTTTTTTTTTTTAGATGG - Intergenic
1130324818 15:82871481-82871503 CTAACTGTCACTTGTTGAGATGG + Intronic
1131196519 15:90359618-90359640 CTAATTTTCATATTTTTAGTAGG + Intronic
1131301872 15:91206801-91206823 TTAAATTTCAGGTGTTTAGGAGG + Intronic
1131416197 15:92260704-92260726 CTAATTTTCATATTTTTAGTAGG + Intergenic
1131913553 15:97235746-97235768 CTCATTTTCACTTTTATAGATGG - Intergenic
1132596777 16:755065-755087 CTAATTTTTATTTTTTGAGATGG + Intronic
1133582555 16:7160127-7160149 ATAATTTTCAATTGTTTCAAAGG + Intronic
1134260874 16:12649892-12649914 ATTAGTTTCTGTTGTTTAGATGG - Intergenic
1134587703 16:15426322-15426344 TTAATTATCACTTGTATAGATGG + Intronic
1134848043 16:17457577-17457599 CTGATTTTCTCTTGTTTAGAAGG - Intronic
1135020715 16:18960734-18960756 CTAATTTTTTTTTTTTTAGATGG - Intergenic
1138075073 16:54034100-54034122 TTTATTTTCAGTTGTTTCAATGG - Intronic
1138357915 16:56400137-56400159 CTACTTTTTTGTTTTTTAGATGG + Intronic
1139026965 16:62829948-62829970 ATAATTTGCAGTAGTTTACATGG - Intergenic
1139311032 16:66028288-66028310 CTAATTTTCATATTTTTAGTAGG + Intergenic
1140882384 16:79210571-79210593 CTAATTTTCAGCTGATGAGAGGG - Intronic
1141261880 16:82461930-82461952 CTAACATTCAGTTGTTGAGAGGG + Intergenic
1143040943 17:4035932-4035954 CTAATTTTTATATGTTTAGTAGG - Intronic
1144269693 17:13603679-13603701 CCATTTTTAAGTTGTTTTGAAGG + Intergenic
1144602884 17:16634148-16634170 CTAAAATTCAGTTCTTCAGATGG + Intronic
1146119165 17:30175596-30175618 CTAATTTTTATATTTTTAGATGG + Intronic
1146242706 17:31244788-31244810 CTGATTTTCAGTTCTTATGAAGG + Intronic
1146542491 17:33709576-33709598 GTAAATTTCTGTTGTGTAGAAGG + Intronic
1147016060 17:37492159-37492181 CTACTTTGAAGTTGTTTAAAAGG - Intronic
1149031734 17:52091429-52091451 TTAATTTTCAGTGGTATAGATGG + Intronic
1149615975 17:57999046-57999068 GTAATTTTCAGCTGTTAATATGG + Intronic
1149765480 17:59273640-59273662 CTAATTTTCAGGTGTATATTTGG + Exonic
1150184434 17:63165113-63165135 CTAATTTTTATTTTTGTAGAGGG - Intronic
1150200554 17:63352461-63352483 ATAATTTTTAGTTGTAAAGATGG - Intronic
1150241072 17:63633060-63633082 CTAATTTTGTGTTTTTTAGTAGG - Intronic
1150903164 17:69305703-69305725 CTAATTTTCAATTTTTTTGTAGG - Intronic
1151147992 17:72058898-72058920 CAAATCTTAAGGTGTTTAGAGGG + Intergenic
1151899636 17:77003279-77003301 CTAATTTTTTGTTTTTGAGATGG + Intergenic
1152372572 17:79898808-79898830 CAAATTTTCAGTTATTTATTTGG - Intergenic
1153176751 18:2383329-2383351 CTAATTTTCAATTGGATTGATGG - Intergenic
1153646338 18:7199455-7199477 ATAAATTTCTGTTGTTTATAAGG - Intergenic
1155769860 18:29682892-29682914 CTAATCTTCTGTTATGTAGATGG + Intergenic
1156812441 18:41269054-41269076 TTAATTTTAAGGTGTTCAGAGGG + Intergenic
1157219652 18:45818897-45818919 CTAATTTTCATATTTTTAGTAGG + Intergenic
1158059146 18:53317517-53317539 CTCTTTTTCTGTTGTTTGGATGG + Intronic
1158748539 18:60229974-60229996 TTAATTTTCTGTTTTTGAGATGG + Intergenic
1159285065 18:66337730-66337752 CTGATTTTCAGTTCTTATGAAGG + Intergenic
1159429398 18:68332063-68332085 GAAATTTTTATTTGTTTAGATGG - Intergenic
1160132669 18:76242274-76242296 ATAAATTTCTGTTGTTTATAAGG + Intergenic
1161387837 19:4006292-4006314 CTAATTTTTTTTTTTTTAGACGG - Intergenic
1161714744 19:5868984-5869006 CTAATTTTTTTTTTTTTAGACGG + Intronic
1162020477 19:7866070-7866092 CTAATTTTTTTTTTTTTAGACGG + Intergenic
1162049024 19:8020995-8021017 CTCTCTTTCAGTTGTCTAGATGG - Intronic
1162579247 19:11518421-11518443 CTAATTTTTTTTTTTTTAGATGG - Intronic
1163000614 19:14364372-14364394 CTAATTTTTATTTTTTGAGACGG - Intergenic
1164485173 19:28649986-28650008 CTATTTTGCAGTTGACTAGAGGG - Intergenic
1164781985 19:30900155-30900177 ATAAATTTCTGTTGTTTATAAGG + Intergenic
1166771098 19:45282828-45282850 CTAATTTTTAATTTTTTAGGGGG - Intronic
1167005146 19:46771328-46771350 CTAATTTTTATTTGTAGAGACGG - Intronic
1168042196 19:53767647-53767669 CTAATTTTCATATTTTTAGTAGG - Intergenic
925022238 2:580565-580587 CTAAATTTCATTTTTTTAAATGG - Intergenic
925725543 2:6867216-6867238 CAAATTTTCTATTGTTTAGGCGG - Intronic
926372007 2:12188187-12188209 CTAATCTTAAGTGATTTAGAGGG + Intergenic
927404476 2:22751624-22751646 CTGAGTTTCAGATGTTTTGAGGG - Intergenic
928426700 2:31184374-31184396 GAAATATTCAGATGTTTAGAAGG - Intronic
928452043 2:31386135-31386157 CTCATTTTCTGTTTTTTATATGG - Intronic
930111490 2:47682618-47682640 CTAATTTTTATTTTTTTAGTAGG - Intergenic
931338835 2:61378302-61378324 TTAATGTACAGTTGTTTATATGG - Intronic
931522216 2:63111503-63111525 CTAATTTTTTTTTTTTTAGACGG + Intergenic
932452627 2:71824050-71824072 GTATGTTTCAGTTTTTTAGATGG + Intergenic
932858914 2:75267855-75267877 CTAATTTTGAGTTCTTATGAAGG + Intergenic
932916146 2:75860375-75860397 CAAATTTTTATTTGTTGAGAAGG - Intergenic
935071171 2:99695099-99695121 GTAATTTTCATATGTTTAAATGG - Intronic
935140816 2:100351331-100351353 TTTATTTTCATTTGCTTAGAGGG - Intergenic
935216368 2:100978016-100978038 TTAAATTTCAGTAGTTTTGAGGG + Intronic
935508178 2:103933105-103933127 ATAATTCTCAGTTTTTTGGAAGG + Intergenic
936922794 2:117706533-117706555 CTATTATCCAGTTGTTTAGCTGG - Intergenic
937384980 2:121421411-121421433 CTAATTTTTTGTAGTTTAGTAGG + Intronic
938665203 2:133527726-133527748 CTGATATTCATTTGTTGAGAGGG + Intronic
939974046 2:148695920-148695942 CTCAATTTCAGGTGATTAGAAGG + Intronic
940123953 2:150301860-150301882 TTAATTTTCAGTTCTAGAGATGG + Intergenic
940284300 2:152018368-152018390 CTTTTTTTCAGGTGTGTAGAGGG - Intronic
940670143 2:156657503-156657525 ACAATTTTCAGTAGTTTAGGAGG + Intergenic
940686604 2:156858572-156858594 CTAATTTTCATATTTTTAGTAGG + Intergenic
940837521 2:158540026-158540048 CTAATTTTTTGATGTTGAGAAGG - Intronic
941619527 2:167760638-167760660 ATAATTTTCTTATGTTTAGAAGG - Intergenic
941954562 2:171191406-171191428 TTTATTTTCATTTTTTTAGAGGG - Intronic
942157270 2:173143514-173143536 ATAATTTTCAGTCTTTTAAAGGG + Intronic
942778021 2:179608077-179608099 CTAATTTTCATATTTTTAGTAGG + Intronic
942937385 2:181574623-181574645 CAAATTTTCTGTTGTTAGGAAGG + Intronic
943468773 2:188265476-188265498 CAAAATTTCAGTTATATAGAAGG + Intergenic
943800127 2:192046923-192046945 TTAATTTTTATTTTTTTAGATGG + Intronic
943923176 2:193737529-193737551 CTAATTTTCTGTTCTTATGAAGG - Intergenic
948495787 2:238348745-238348767 TTGATTGTCATTTGTTTAGAAGG + Exonic
1169697646 20:8408981-8409003 TTAATTTTCAGTATTTTACATGG + Intronic
1170094116 20:12626814-12626836 TTAATTTTCATGTGTTTATAAGG + Intergenic
1173624158 20:44459303-44459325 CTAATTTGAAGTGGTTTATATGG + Intronic
1173886765 20:46465947-46465969 CTAATTTTTTTTTTTTTAGACGG - Intergenic
1174715051 20:52748648-52748670 TCAATTTTCAGTTGCTTACACGG + Intergenic
1176970418 21:15259046-15259068 TTAACTTTCAGTTTTTGAGAAGG - Intergenic
1177058121 21:16334928-16334950 CTAAATTTCTGCTGATTAGATGG + Intergenic
1177185814 21:17794898-17794920 CTAATTTTCTATTTTTTATAGGG - Intronic
1177574216 21:22929851-22929873 CTCATTCTCAGTTGTTTGAATGG + Intergenic
1177793847 21:25751572-25751594 ATAATTTTAATTTGCTTAGAAGG + Intronic
1177975320 21:27842335-27842357 GTTTTTTTCAGTTGTTTAGTGGG + Intergenic
1178152121 21:29807361-29807383 CCAAGTTACAGTTGCTTAGAAGG - Intronic
1182055743 22:27353267-27353289 ATAAATTTCTGTTGTTTAGAAGG - Intergenic
1182507884 22:30798094-30798116 GTTATTTTCAGTTTTTTAGATGG + Intronic
1184926544 22:47644881-47644903 CTATTTTTCAGTTCTTGAGCTGG - Intergenic
949625945 3:5866849-5866871 ATAATTTTTATTTTTTTAGATGG - Intergenic
949873095 3:8606129-8606151 ATAAATTTCTGTTGTTTATAAGG - Intergenic
949924820 3:9032717-9032739 CTCATTTTCTGTGGTTTAGGGGG + Exonic
950700120 3:14738331-14738353 CTAATTTTTTTTTTTTTAGATGG + Intronic
951480219 3:23152986-23153008 ATAAGTTTCTGTTGTTTATAAGG - Intergenic
951902424 3:27669943-27669965 ATAATTTTCAGTTCCTTATAAGG - Intergenic
952610591 3:35204106-35204128 CTAAATTTCAGTTCTTTACCTGG - Intergenic
952687808 3:36170198-36170220 CTAATTTCAATTTTTTTAGATGG + Intergenic
954491500 3:50910875-50910897 CTAATTTTTAGTTCTTAAGAAGG + Intronic
955953634 3:64266790-64266812 TTTATTTGCAGTTGTTTAGGTGG - Intronic
956998866 3:74860831-74860853 ATAATTTTCATTTACTTAGATGG - Intergenic
957197055 3:77082313-77082335 CTAATTGTCAGTTGTCTAATTGG + Intronic
957814550 3:85277392-85277414 CTATTTTTAAGTTCTTTAGAAGG + Intronic
958180077 3:90048869-90048891 ATAATTTTCAATTGTTTACAAGG - Intergenic
958410961 3:93815231-93815253 CGTATTGTCAGTTCTTTAGAAGG + Intergenic
959189974 3:103098359-103098381 CTGATTTTTAGTTGTTATGAAGG + Intergenic
959661597 3:108874656-108874678 CTAATTTTCAGTTAATTGGTGGG + Intergenic
959770244 3:110086670-110086692 GTAATTTTCAGGTGCTTTGATGG + Intergenic
960815716 3:121670069-121670091 TGAATTTTCAGTTTTTTAAATGG - Intronic
961925451 3:130474835-130474857 CTAATTTGTTGTTGTTGAGATGG - Intronic
963649813 3:147964499-147964521 TTATTTTTCAGTTGTTATGAAGG + Intergenic
964161344 3:153649016-153649038 CTAATTCTCAATTATTTGGATGG - Intergenic
964693957 3:159486249-159486271 CAAAGTTTCAGTTACTTAGAGGG - Intronic
965111623 3:164432192-164432214 CTAATTTTAAGTTAATTAGAGGG + Intergenic
966330897 3:178811852-178811874 CTAATTTTCAGTAATCAAGAGGG + Intronic
967853058 3:194096460-194096482 CTAATTTTCATATTTTTAGTAGG - Intergenic
968022556 3:195406499-195406521 ATAGTTTTCTGTTATTTAGATGG - Intronic
970069269 4:12138221-12138243 ATAACTTTCTGTTGTTTATAAGG - Intergenic
970677413 4:18467029-18467051 CTAATTTTCATTTATTTTGCAGG + Intergenic
970894948 4:21091617-21091639 ATAAATTTCTGTTGTTTATAAGG - Intronic
970932017 4:21523182-21523204 GTAATTTTCTGTTATTTATAAGG + Intronic
971475396 4:27067443-27067465 CTAATTTTCTTTTGTAGAGATGG + Intergenic
972650302 4:41011434-41011456 CTAATTTTTATTTTTTGAGATGG + Intronic
974620831 4:64351438-64351460 CTAATTTTTAAATTTTTAGAAGG + Intronic
975095778 4:70454632-70454654 CTAATTTTTGGTTCTTTGGAAGG + Intronic
975252575 4:72197326-72197348 CTGATTTTCAGTTGTTATGAAGG - Intergenic
977831793 4:101602980-101603002 CTATTTTTTATTTTTTTAGAAGG - Intronic
978183576 4:105832136-105832158 CTAATTTTTATTTTTTTATATGG + Intronic
978460588 4:108947274-108947296 CTAATTTTCATATTTTTAGTAGG - Intronic
978813661 4:112878636-112878658 TTAATTTTTTGTTTTTTAGACGG + Intronic
978891647 4:113835671-113835693 CAAAGTTGCAGTTGTTAAGAAGG - Intergenic
979049704 4:115914450-115914472 ATAATTTTTAGTTAATTAGATGG + Intergenic
979137182 4:117124500-117124522 CTAATTATCAGTTATTTATAGGG - Intergenic
980623919 4:135346187-135346209 CTAATTTTGAGATTTTCAGAAGG + Intergenic
981668147 4:147254858-147254880 CTAATTTTCATCTGTTTTGGGGG - Intergenic
982911439 4:161147890-161147912 CTGATTTTCAGTTCTTATGAAGG - Intergenic
983912757 4:173258376-173258398 CTTATTTACACTTGTTTATATGG + Intronic
984168498 4:176332732-176332754 ATGATTTTCTGTTGTTTTGAGGG - Intergenic
984821114 4:183883483-183883505 CTAATTTTTTGTTTTTTAGTAGG + Intronic
984957400 4:185058974-185058996 CTCATTTTCAGGTGCTTAAATGG - Intergenic
984998835 4:185464879-185464901 TTAATTTTCATTAGTTTACAGGG - Intronic
985177529 4:187217174-187217196 TTAATATTCAGTTGTTGATATGG - Intergenic
986730017 5:10628489-10628511 CTAATTTTTATTTTTTGAGATGG + Intronic
987179418 5:15351419-15351441 CTAGTTTTCAGTTCTTTACTGGG + Intergenic
988466356 5:31496132-31496154 CTACTTTACAGTTGTTTTTAAGG - Intronic
988479996 5:31621543-31621565 CCAGTTTTCTATTGTTTAGAGGG + Intergenic
989770038 5:45133528-45133550 ATAAAATTCAGTTGATTAGATGG + Intergenic
990546106 5:56823118-56823140 TTAATTTTAAGATGTTCAGATGG + Intronic
991775843 5:70084707-70084729 TTAATTTTCTGTTGTTTATATGG + Intergenic
992353890 5:75959226-75959248 CTAATTTTCTGGAGTTTAGCGGG + Intergenic
992507339 5:77399901-77399923 CTAAATTTAAGTTATTTATAAGG - Intronic
993264112 5:85699523-85699545 CTAATTTTTTGTATTTTAGATGG + Intergenic
994200537 5:96969694-96969716 TTATTTTTCAGTTGTTTATCTGG + Intronic
995016153 5:107311656-107311678 CTCATGTTCACTTGTTTATAAGG - Intergenic
995109843 5:108417062-108417084 CTAATTTACAGTTGGTTGAAAGG - Intergenic
995784402 5:115813831-115813853 CTAATTGTAAGAGGTTTAGAGGG - Intronic
995997339 5:118317720-118317742 ATAAATTTCTGTTGTTTATAAGG + Intergenic
996354512 5:122581046-122581068 CTAATTTTCAGTTTTCTACTTGG - Intergenic
997267507 5:132503743-132503765 CTGTTTTTCATTTTTTTAGATGG + Intergenic
997856270 5:137375703-137375725 CTTATTTTTAGTTTTTTACAAGG - Intronic
998124134 5:139604712-139604734 CTAATTTTTAGTTTTAAAGATGG - Intronic
998446392 5:142201955-142201977 TTATTTTTCAGTTTTTGAGACGG + Intergenic
999003597 5:147951449-147951471 CAAAGTTTCAGTTGGTTAGGAGG - Intergenic
999186658 5:149715715-149715737 CTAATTTTTTTTTTTTTAGATGG + Intergenic
999846633 5:155488512-155488534 ATAAATTTCTGTTGTTTATAAGG + Intergenic
1000898424 5:166884413-166884435 TTAATTTTCAGTAGTCTAGGAGG - Intergenic
1000928115 5:167218509-167218531 CTGGGTTTCAGTTGTTTAAAAGG + Intergenic
1002042668 5:176526199-176526221 CTAATTTTTTTTTTTTTAGACGG + Intergenic
1003730545 6:8817977-8817999 CTATTTCTCAGTATTTTAGAAGG - Intergenic
1004773481 6:18814162-18814184 TTAATTTTCAGTTGTTAACTAGG + Intergenic
1005075015 6:21898364-21898386 CTATTTTTCAGGTATGTAGAAGG + Intergenic
1005783595 6:29219193-29219215 CTAATTTTTTTTTTTTTAGATGG + Intergenic
1007740644 6:44007544-44007566 CAAAATTTCAGTTTTTTAAATGG + Intergenic
1007828895 6:44623021-44623043 TTAATTGTCAGTTGATTACATGG + Intergenic
1009681785 6:66903069-66903091 CTAATGTCCTGTTGTTGAGATGG - Intergenic
1009778019 6:68231172-68231194 CTAATTTTCAATTATTTTTATGG + Intergenic
1010070219 6:71735582-71735604 CTAATGCTTAGGTGTTTAGAGGG + Intergenic
1010184105 6:73122878-73122900 ATAATTTTCAGTGACTTAGAGGG + Intronic
1010685497 6:78850313-78850335 CTATTTTTTAGTTGTATAGGTGG - Intergenic
1011321803 6:86103949-86103971 TTAAGTGACAGTTGTTTAGATGG + Intergenic
1011386420 6:86802891-86802913 CTGATTTTTAGTTCTTAAGAAGG + Intergenic
1012714154 6:102648042-102648064 CTAATTTTTGGTTCTTAAGAAGG - Intergenic
1012891980 6:104907403-104907425 CTAATTTTTTGTTCTTTTGAAGG - Intergenic
1012893268 6:104920921-104920943 ATTTTTTTCAGTTGTTCAGATGG - Intergenic
1014929880 6:127322759-127322781 CTAATTTTCTTTTAGTTAGAAGG - Intronic
1015662096 6:135587243-135587265 CTAATTTTTGTTTGTTTAGTTGG - Intergenic
1015691697 6:135931509-135931531 CTAATATTCAGTTGTTTTCTTGG - Intronic
1017078357 6:150640953-150640975 CTATATGTCAGTTGTTTAGTGGG + Intronic
1017079150 6:150650617-150650639 CTAATTTTAAGTTGTTTAAAAGG - Intronic
1019719888 7:2562459-2562481 CTTCTTTTCTGTTTTTTAGAAGG + Intronic
1020246011 7:6430037-6430059 CTAATTTTCATTTTTTGAGATGG - Intronic
1021123604 7:16825464-16825486 CTTATTTTTAGTTGTTATGAAGG - Intronic
1025862088 7:65339655-65339677 CTAATTTTTGGTTGTTGTGAAGG + Intergenic
1026547033 7:71332068-71332090 CTAATTTTTAGTATTTTATATGG - Intronic
1026923001 7:74170123-74170145 CTATTTTTTAATTTTTTAGACGG + Intergenic
1027925608 7:84458968-84458990 ATAATTTTCAGAGGTTGAGAAGG - Intronic
1029214645 7:98938167-98938189 CTAATTTTCTTTTTTTGAGATGG - Intronic
1029873428 7:103720847-103720869 CTCATTATCATTTGTTTATATGG - Intronic
1031098338 7:117448024-117448046 CTGATTTTCAGTTCTTGTGATGG - Intergenic
1031223837 7:119008692-119008714 CTAATTTTCATATTTTTAGTAGG - Intergenic
1031813508 7:126402824-126402846 CTTATTTTGAGTAGATTAGAAGG - Intergenic
1037223245 8:16552128-16552150 CAGATTTGCAGTAGTTTAGAAGG + Intronic
1037716356 8:21404269-21404291 TTAATTTTTTGTTTTTTAGATGG - Intergenic
1038282792 8:26181075-26181097 ATAAATTTCTGTTGTTTATAAGG + Intergenic
1041507962 8:58622396-58622418 CTAATTTTTTTTTTTTTAGATGG + Intronic
1043274516 8:78376595-78376617 CTTATTTTCAGTTTTAGAGAAGG + Intergenic
1044301544 8:90590102-90590124 ATAATTTTCTGTTGTTTGTAGGG - Intergenic
1045921519 8:107535705-107535727 AAGATTTTCAGTTGTTTATAAGG - Intergenic
1045950695 8:107848851-107848873 TTAATTTTCTTCTGTTTAGAAGG - Intergenic
1046252199 8:111646617-111646639 TTAATTTTGAGTTATTTATATGG + Intergenic
1046668325 8:117030348-117030370 CTAATTTTTAGTTGTTCACCAGG + Intronic
1046928462 8:119819010-119819032 GTAATTTTCAGTGGGTTAGATGG - Intronic
1047960991 8:130011514-130011536 CTAATTTTTATTTTTTGAGATGG - Intronic
1048809430 8:138272500-138272522 CTCATTTTCAGTAGGTTAAATGG - Intronic
1048915141 8:139175407-139175429 TTAAATTTCAGTTGTTTAGTGGG - Intergenic
1049723489 8:144133222-144133244 CTAATTTTTTTTTTTTTAGATGG - Intergenic
1050366219 9:4876215-4876237 CTCATTTTCAGTTTTCTAAAAGG - Intronic
1050484337 9:6117586-6117608 CTAATTTTTTTTTTTTTAGATGG + Intergenic
1050983358 9:12049332-12049354 ATAAATTTCTGTTGTTTATAAGG - Intergenic
1052531016 9:29683882-29683904 CTAATTTACAGCTATATAGATGG + Intergenic
1052604181 9:30677771-30677793 CTGTTATACAGTTGTTTAGATGG + Intergenic
1053048824 9:34941590-34941612 ATAAATTTCTGTTGTTTATAAGG - Intergenic
1055305155 9:74921706-74921728 CAAATTTTCAGGTTTTTAAAAGG + Intergenic
1055505265 9:76941824-76941846 ATAAATTTCTGTTGTTTAAAAGG + Intergenic
1056409138 9:86307988-86308010 CTATTTTTTAGTTTTTGAGATGG - Intronic
1059019506 9:110559251-110559273 CTAATTCTGATTTTTTTAGAGGG - Intronic
1062557889 9:137124277-137124299 CTAATTTTAATTTGTAGAGATGG - Intergenic
1185481237 X:447953-447975 CTAATTTTCTTTTTTTGAGATGG + Intergenic
1186183673 X:6997600-6997622 TTAATTTTCAGTTTTCTAGATGG - Intergenic
1186602564 X:11053867-11053889 CAAATCTTTAGGTGTTTAGATGG - Intergenic
1186649565 X:11543787-11543809 CACATTTGCAGTTGTTTACAAGG - Intronic
1187711696 X:22060881-22060903 TTACTTTGCAGTTGTTCAGAAGG + Intronic
1187812419 X:23194011-23194033 GTAATTATGAGTTATTTAGAAGG - Intergenic
1188590931 X:31834325-31834347 CTAATCTTCAGATGTTTCCAAGG + Intronic
1188820616 X:34770467-34770489 CTAATTTCCAGCTACTTAGATGG + Intergenic
1188965006 X:36540246-36540268 CTCATTTTCATTTATTTAAAGGG + Intergenic
1189506397 X:41615311-41615333 CTAATTTCCAGATTTTTTGATGG - Intronic
1193721316 X:84990763-84990785 CTGATTTTCAGTTCTTATGAAGG - Intergenic
1194992323 X:100557804-100557826 CTAATATTCAGGTTTTTAAATGG + Intergenic
1195090260 X:101451545-101451567 CTGATTTTTAGTTCTTTTGAAGG + Intronic
1195543456 X:106088421-106088443 CTGATTTTCAGTTCTTATGAAGG + Intergenic
1196093276 X:111770544-111770566 CAAATTGTCAGTTTTTTGGATGG - Intergenic
1196577373 X:117335144-117335166 CTCAGCTTCAGATGTTTAGAAGG - Intergenic
1196931121 X:120683107-120683129 TTAATTTTCTCTTTTTTAGAGGG + Intergenic
1197583359 X:128312032-128312054 CTAATCCTCAGGTGTTTAGGGGG - Intergenic
1198383440 X:136105367-136105389 CTGATTTTCAATTGTTTACATGG - Intergenic
1198797737 X:140416839-140416861 CTAATTTTTTGTTGTTTGGTTGG + Intergenic
1199104704 X:143850740-143850762 CAAAATTTCAGTTAGTTAGAAGG + Intergenic
1199780650 X:151055926-151055948 CTACTTTTCATTTCTTTTGAAGG + Intergenic
1199782167 X:151071935-151071957 ATAATTTTCTCTGGTTTAGAGGG - Intergenic
1199845126 X:151687351-151687373 CTGATTTTCAGTTATTATGAAGG - Intergenic
1201467914 Y:14304930-14304952 ATAATTTTTAGATGTTTAGAAGG - Intergenic