ID: 902956405

View in Genome Browser
Species Human (GRCh38)
Location 1:19926892-19926914
Sequence CCTGTAGAGTACCTGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902956402_902956405 15 Left 902956402 1:19926854-19926876 CCTTCTAAACAACTGAAAATTAG 0: 2
1: 0
2: 2
3: 32
4: 356
Right 902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902956405 Original CRISPR CCTGTAGAGTACCTGAAGTC CGG Intergenic
No off target data available for this crispr