ID: 902956597

View in Genome Browser
Species Human (GRCh38)
Location 1:19928914-19928936
Sequence CCTTTTAAGCAACCGATAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902956594_902956597 10 Left 902956594 1:19928881-19928903 CCTGGAATTTTAACTAGCCAATG No data
Right 902956597 1:19928914-19928936 CCTTTTAAGCAACCGATAGCCGG No data
902956593_902956597 27 Left 902956593 1:19928864-19928886 CCGGTCTTTGATTATGACCTGGA No data
Right 902956597 1:19928914-19928936 CCTTTTAAGCAACCGATAGCCGG No data
902956595_902956597 -7 Left 902956595 1:19928898-19928920 CCAATGTTGTCAGTAGCCTTTTA No data
Right 902956597 1:19928914-19928936 CCTTTTAAGCAACCGATAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902956597 Original CRISPR CCTTTTAAGCAACCGATAGC CGG Intergenic
No off target data available for this crispr