ID: 902956981

View in Genome Browser
Species Human (GRCh38)
Location 1:19932141-19932163
Sequence AACATTCTGGCGCCCAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902956981_902956987 6 Left 902956981 1:19932141-19932163 CCCACGTTGGGCGCCAGAATGTT No data
Right 902956987 1:19932170-19932192 CAGCCTCAACACCACCCGTAGGG No data
902956981_902956986 5 Left 902956981 1:19932141-19932163 CCCACGTTGGGCGCCAGAATGTT No data
Right 902956986 1:19932169-19932191 CCAGCCTCAACACCACCCGTAGG No data
902956981_902956993 23 Left 902956981 1:19932141-19932163 CCCACGTTGGGCGCCAGAATGTT No data
Right 902956993 1:19932187-19932209 GTAGGGTACCCAAAGTCCGGTGG No data
902956981_902956991 20 Left 902956981 1:19932141-19932163 CCCACGTTGGGCGCCAGAATGTT No data
Right 902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902956981 Original CRISPR AACATTCTGGCGCCCAACGT GGG (reversed) Intergenic