ID: 902956982

View in Genome Browser
Species Human (GRCh38)
Location 1:19932142-19932164
Sequence CAACATTCTGGCGCCCAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 3, 1: 1, 2: 1, 3: 8, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902956982_902956987 5 Left 902956982 1:19932142-19932164 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 902956987 1:19932170-19932192 CAGCCTCAACACCACCCGTAGGG 0: 18
1: 22
2: 14
3: 7
4: 90
902956982_902956993 22 Left 902956982 1:19932142-19932164 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 902956993 1:19932187-19932209 GTAGGGTACCCAAAGTCCGGTGG 0: 10
1: 11
2: 17
3: 15
4: 48
902956982_902956986 4 Left 902956982 1:19932142-19932164 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 902956986 1:19932169-19932191 CCAGCCTCAACACCACCCGTAGG 0: 16
1: 26
2: 13
3: 12
4: 132
902956982_902956991 19 Left 902956982 1:19932142-19932164 CCACGTTGGGCGCCAGAATGTTG 0: 3
1: 1
2: 1
3: 8
4: 72
Right 902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG 0: 9
1: 12
2: 9
3: 12
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902956982 Original CRISPR CAACATTCTGGCGCCCAACG TGG (reversed) Intergenic
902956982 1:19932142-19932164 CAACATTCTGGCGCCCAACGTGG - Intergenic
907510886 1:54957858-54957880 CAACAATTTGGCACCAAACGTGG + Intergenic
912950334 1:114116322-114116344 CAAAATTCTTGTCCCCAACGCGG + Intronic
914379447 1:147103337-147103359 GCTCATTCTGGCGCCCAACCTGG - Intergenic
917838892 1:178961608-178961630 CAACATTCTGGAGCTCATAGTGG - Intergenic
920871400 1:209798185-209798207 CAACATTCTGCTGCCCCAGGTGG + Intronic
1073370104 10:102980515-102980537 CACCACTCTGGAGCCCAAGGCGG - Intronic
1074761878 10:116673175-116673197 CAACATTCAGGAGCCAAATGAGG - Exonic
1076898608 10:133326033-133326055 CAGCATCCTGGCGGCCATCGGGG - Exonic
1077048797 11:557574-557596 AAACATTCAGGCCCCCACCGGGG - Exonic
1084561381 11:69907430-69907452 CAACATTCTGTCACCCAAGTTGG + Intergenic
1085327193 11:75615638-75615660 CAACATTCTGGTGCCCAGAGTGG + Intronic
1088057616 11:105604197-105604219 CCAGATTCTGGCGCCCCGCGCGG - Intergenic
1091644137 12:2260728-2260750 CAACATTCTTGCTCCTAAAGTGG + Intronic
1093421130 12:18976292-18976314 CAACACTCTAGAGCCCAAAGAGG - Intergenic
1094362934 12:29649783-29649805 CAACTTTCTGGTGCCCAGAGTGG + Intronic
1097178693 12:57158583-57158605 CAATCTTCTGGCGGCCAATGAGG - Exonic
1098310126 12:69140270-69140292 CAATAATCTGGCGCCCAATGTGG + Intergenic
1103788534 12:123452007-123452029 TAACATTCTGTCGCCCAAGCTGG - Intergenic
1105810724 13:23992791-23992813 CAGCATTGTGGAGCCAAACGTGG - Intronic
1107097990 13:36557462-36557484 CAACATTTTGGAGGCCAAGGAGG + Intergenic
1108470842 13:50765507-50765529 CCACATTCTGGTTCCCAACTTGG + Intronic
1111132568 13:83996378-83996400 CACCATTTTGGCGCGCAACGTGG + Intergenic
1120974818 14:90239348-90239370 CAGTAATCTGGCGCCCAACATGG + Intergenic
1124130073 15:26975760-26975782 TAACATTCTGGCTCCCATCTGGG + Intronic
1132339078 15:101066674-101066696 AAGGATTCTGGCGCCCAGCGGGG + Exonic
1132608194 16:802191-802213 CCACTCTCTGGCGCCCAAAGTGG - Intergenic
1137330743 16:47492842-47492864 CAACAGTTTAGCACCCAACGTGG - Intronic
1141488612 16:84356860-84356882 CTACATTCAGGCGCCCACCCCGG - Intergenic
1145364226 17:22241794-22241816 CAACATTTTGGAGCCCATTGAGG - Intergenic
1152430330 17:80245287-80245309 CAACGTTAGGGCGTCCAACGTGG - Intronic
1153580545 18:6569207-6569229 CAGAATTCTGGGTCCCAACGTGG - Intronic
1156098668 18:33566513-33566535 CAACATTTTGGCACCCAATGTGG - Intergenic
1158727974 18:59992076-59992098 CAACATTTTGGGGGCCAAGGTGG - Intergenic
1162009135 19:7801030-7801052 CCACCATCTGGCGCCCAACGTGG - Intergenic
1162215325 19:9129182-9129204 CAAAATTCAGGCCCCCAACCGGG + Intergenic
1162526285 19:11208766-11208788 CGACATCCTGTCGCCCGACGAGG - Exonic
1166056698 19:40294160-40294182 CGAGTTTCTGGTGCCCAACGTGG + Intergenic
1166161203 19:40954748-40954770 CCAACATCTGGCGCCCAACGTGG + Intergenic
925742640 2:7019349-7019371 CAACATGCTGGCGCCGCACGTGG - Intronic
926792021 2:16583595-16583617 CACCATTATGGCACCCAACTTGG - Intronic
939088148 2:137746459-137746481 CAAGATTCTGGTGCCCACAGTGG + Intergenic
941537846 2:166743633-166743655 ACACATTTTGGCGCCCAACGTGG - Intergenic
945983544 2:216336286-216336308 CAACATTCTGGTGTCTAATGAGG + Intronic
1170318250 20:15065998-15066020 CCACATTCTGGGGCCCAGCTTGG + Intronic
1172919855 20:38472489-38472511 CAAGATTCTGGCTCCCACCTAGG - Intergenic
1175501494 20:59454069-59454091 CAACATCCTGGAGCCCAAGAAGG - Intergenic
1178014365 21:28326596-28326618 CAAGATTCTGGAGCCCAGGGAGG + Intergenic
1180616182 22:17129426-17129448 CAACATTCTAGAGGCCAAGGTGG + Intronic
1180990937 22:19935770-19935792 CCAATATCTGGCGCCCAACGTGG + Intronic
1182164641 22:28161281-28161303 CAACACTCTGGAGGCCAAGGAGG + Intronic
952403910 3:32988561-32988583 CAAAATTCTGGTGCCCAGAGTGG + Intergenic
954232560 3:49228521-49228543 ACACATTTTGGCGCCCAATGTGG - Intronic
954598628 3:51850615-51850637 ACACATTTTGGCACCCAACGTGG + Intergenic
957902509 3:86513259-86513281 AAAAATTCTGGAGCCCAACGAGG - Intergenic
963024770 3:140908779-140908801 CAACATTCTGCCCCACAATGTGG + Intergenic
969669363 4:8581240-8581262 CACCTTCCTGGCGTCCAACGCGG + Exonic
981854627 4:149273143-149273165 TAACATTTTGGAGCCCAACAGGG - Intergenic
983544283 4:168946200-168946222 CAGCATTCTGGAACCCAAAGAGG - Intronic
1002661381 5:180792966-180792988 CAGCATCCTGGCCCCCACCGGGG + Exonic
1003434559 6:6073852-6073874 CAAATTTCTGGAGCCCAACTTGG + Intergenic
1005575788 6:27188066-27188088 CAACATTCTGGTGCCCAACGTGG + Intergenic
1005942910 6:30574383-30574405 CAACATTTTGGGGACCAAGGTGG - Intronic
1006151104 6:31990487-31990509 CAACATTCTGGCGCCCAACGTGG - Intronic
1006157405 6:32023225-32023247 CAACATTCTGGCGCCCAACGTGG - Intronic
1010534906 6:77014276-77014298 CAACATTTTGGAGGCCAAGGCGG - Intergenic
1012160113 6:95873782-95873804 CATCATTTTGGAGCCCAACCAGG + Intergenic
1012316793 6:97791129-97791151 CCAGATGCTGGCGCCCAAGGCGG - Intergenic
1014526887 6:122511529-122511551 CAACATTTTGTCACCCAACATGG - Intronic
1016233171 6:141830844-141830866 CAACATTTTGAGGCCCAATGTGG - Intergenic
1018560364 6:165096324-165096346 CTACATGCTGGCACCCAATGTGG + Intergenic
1022633205 7:32105569-32105591 CAACATTCTGGGAGCTAACGGGG - Intronic
1025534893 7:61935440-61935462 CAACATTTTGGAGCCCATTGAGG + Intergenic
1029628468 7:101735122-101735144 CAACATGCTGGGGCCCAGAGAGG - Intergenic
1031042612 7:116854641-116854663 CTCCAGTCTGGAGCCCAACGTGG + Intronic
1042325408 8:67522749-67522771 CCAGATGCTGGCGCCCAAGGTGG + Intronic
1044068516 8:87726310-87726332 CAGCATTCTGGGACCCAACTGGG + Intergenic
1046770186 8:118110629-118110651 AAACATTCTAGCGGCCATCGAGG - Exonic
1049966769 9:787087-787109 CAACCTTCTGGAGCCTAAAGAGG + Intergenic
1050920081 9:11189176-11189198 CTGCATTATAGCGCCCAACGTGG - Intergenic
1053406942 9:37885614-37885636 CAATAATACGGCGCCCAACGTGG + Intronic
1061856527 9:133444742-133444764 CAACATCCAGGAGCCCAAAGAGG - Intronic
1199177680 X:144810930-144810952 CTACATTCTTGCACCCAAGGTGG - Intergenic
1201292831 Y:12438688-12438710 CAACACTCTTTCACCCAACGTGG - Intergenic
1201347470 Y:13000518-13000540 CAACATTCTGGCATCCAACGTGG - Intergenic