ID: 902957796

View in Genome Browser
Species Human (GRCh38)
Location 1:19937912-19937934
Sequence GTGTTAAGTCACCGAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902957796_902957800 14 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957800 1:19937949-19937971 TTCATGTAACAGGAGAATGCGGG No data
902957796_902957799 13 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957799 1:19937948-19937970 TTTCATGTAACAGGAGAATGCGG No data
902957796_902957798 4 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957798 1:19937939-19937961 TTATTTCTCTTTCATGTAACAGG No data
902957796_902957801 18 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957801 1:19937953-19937975 TGTAACAGGAGAATGCGGGTTGG No data
902957796_902957803 24 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957803 1:19937959-19937981 AGGAGAATGCGGGTTGGCGAGGG No data
902957796_902957802 23 Left 902957796 1:19937912-19937934 CCCAAGTTTCGGTGACTTAACAC No data
Right 902957802 1:19937958-19937980 CAGGAGAATGCGGGTTGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902957796 Original CRISPR GTGTTAAGTCACCGAAACTT GGG (reversed) Intergenic
No off target data available for this crispr