ID: 902959638

View in Genome Browser
Species Human (GRCh38)
Location 1:19953905-19953927
Sequence CAGGGGAATCAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902959626_902959638 17 Left 902959626 1:19953865-19953887 CCTTTGGCTCCTGGTTGGGTTTG No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data
902959625_902959638 18 Left 902959625 1:19953864-19953886 CCCTTTGGCTCCTGGTTGGGTTT No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data
902959621_902959638 24 Left 902959621 1:19953858-19953880 CCCTTGCCCTTTGGCTCCTGGTT No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data
902959620_902959638 25 Left 902959620 1:19953857-19953879 CCCCTTGCCCTTTGGCTCCTGGT No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data
902959629_902959638 8 Left 902959629 1:19953874-19953896 CCTGGTTGGGTTTGGCAACAGGA No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data
902959622_902959638 23 Left 902959622 1:19953859-19953881 CCTTGCCCTTTGGCTCCTGGTTG No data
Right 902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902959638 Original CRISPR CAGGGGAATCAGATGGAGGG AGG Intergenic
No off target data available for this crispr