ID: 902960615

View in Genome Browser
Species Human (GRCh38)
Location 1:19960685-19960707
Sequence AAGGGCAAGAAGAAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902960615_902960623 2 Left 902960615 1:19960685-19960707 CCTGCCGCCTTCTTCTTGCCCTT No data
Right 902960623 1:19960710-19960732 CCCACACTTGCCTGGCAACATGG No data
902960615_902960619 -6 Left 902960615 1:19960685-19960707 CCTGCCGCCTTCTTCTTGCCCTT No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902960615 Original CRISPR AAGGGCAAGAAGAAGGCGGC AGG (reversed) Intergenic
No off target data available for this crispr