ID: 902960619

View in Genome Browser
Species Human (GRCh38)
Location 1:19960702-19960724
Sequence GCCCTTGGCCCACACTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902960611_902960619 29 Left 902960611 1:19960650-19960672 CCATTAGAAACTGGGTCCACCCA 0: 85
1: 108
2: 68
3: 34
4: 114
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data
902960617_902960619 -10 Left 902960617 1:19960689-19960711 CCGCCTTCTTCTTGCCCTTGGCC No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data
902960614_902960619 9 Left 902960614 1:19960670-19960692 CCAAACATGACGATTCCTGCCGC No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data
902960612_902960619 13 Left 902960612 1:19960666-19960688 CCACCCAAACATGACGATTCCTG No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data
902960615_902960619 -6 Left 902960615 1:19960685-19960707 CCTGCCGCCTTCTTCTTGCCCTT No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data
902960613_902960619 10 Left 902960613 1:19960669-19960691 CCCAAACATGACGATTCCTGCCG No data
Right 902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902960619 Original CRISPR GCCCTTGGCCCACACTTGCC TGG Intergenic
No off target data available for this crispr