ID: 902963077

View in Genome Browser
Species Human (GRCh38)
Location 1:19978377-19978399
Sequence CACCGATCCGTTGCATCCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902963060_902963077 29 Left 902963060 1:19978325-19978347 CCCAGCCCTGCCTGGGCCAGAGT 0: 1
1: 0
2: 5
3: 40
4: 430
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
902963067_902963077 19 Left 902963067 1:19978335-19978357 CCTGGGCCAGAGTCTAGGAGGGT 0: 1
1: 0
2: 2
3: 42
4: 324
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
902963064_902963077 23 Left 902963064 1:19978331-19978353 CCTGCCTGGGCCAGAGTCTAGGA 0: 1
1: 0
2: 5
3: 39
4: 877
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
902963062_902963077 24 Left 902963062 1:19978330-19978352 CCCTGCCTGGGCCAGAGTCTAGG 0: 1
1: 0
2: 0
3: 29
4: 347
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
902963061_902963077 28 Left 902963061 1:19978326-19978348 CCAGCCCTGCCTGGGCCAGAGTC 0: 1
1: 0
2: 4
3: 49
4: 468
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
902963070_902963077 13 Left 902963070 1:19978341-19978363 CCAGAGTCTAGGAGGGTAGGGAG 0: 1
1: 0
2: 4
3: 29
4: 285
Right 902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902963077 Original CRISPR CACCGATCCGTTGCATCCTT GGG Exonic
902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG + Exonic
902975646 1:20086208-20086230 CACCAATCGGTGCCATCCTTGGG - Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
1064300570 10:14119247-14119269 CACCTATCGGGAGCATCCTTAGG + Intronic
1120916281 14:89713326-89713348 CAGCAATCCTTTGCATCCTTTGG + Intergenic
1124876639 15:33601145-33601167 CACCGATGGTTTGCATCGTTTGG + Intronic
1162502993 19:11065171-11065193 TACCAATCTGTTTCATCCTTAGG + Intronic
1163304717 19:16470932-16470954 CACCCATCAGTTGCTTCCTTTGG - Intronic
1167985092 19:53308181-53308203 CACGGGTCCGTGGCGTCCTTAGG + Intergenic
934041510 2:88131015-88131037 CACCCATCAGTTGCTTCGTTTGG + Intergenic
947867929 2:233414272-233414294 CACTTATCCTTTGCATCCTAAGG + Intronic
1173135460 20:40435027-40435049 CACCTAAGCTTTGCATCCTTGGG - Intergenic
1174850078 20:53985386-53985408 CCCCGATGGGTTGCATCCTTTGG + Exonic
1179827177 21:43972642-43972664 CACCAATCCGTTGCTGCCCTTGG + Intronic
969448110 4:7256922-7256944 CACCCATTCCTAGCATCCTTTGG + Intronic
978232843 4:106421628-106421650 CAGCAATCCTTGGCATCCTTTGG + Intergenic
1001743382 5:174071622-174071644 CACCGATCCATTCCACTCTTTGG + Intronic
1015418184 6:132974566-132974588 GGCCTATCCTTTGCATCCTTCGG + Intergenic
1038379638 8:27080376-27080398 CACCTCTCCCTTGCAGCCTTAGG - Intergenic
1057211006 9:93201114-93201136 CACCCATCCTTTCCATCCTGTGG + Intronic
1059973706 9:119693832-119693854 CACCAGTTCTTTGCATCCTTAGG - Intergenic