ID: 902964482

View in Genome Browser
Species Human (GRCh38)
Location 1:19989421-19989443
Sequence CATCAGTTCTACAGGACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902964482_902964485 3 Left 902964482 1:19989421-19989443 CCAATTGTCCTGTAGAACTGATG No data
Right 902964485 1:19989447-19989469 ATGGTTTCTTTGAATAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902964482 Original CRISPR CATCAGTTCTACAGGACAAT TGG (reversed) Intergenic
No off target data available for this crispr