ID: 902964990

View in Genome Browser
Species Human (GRCh38)
Location 1:19994693-19994715
Sequence GAGGCTGATGACTTCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902964985_902964990 12 Left 902964985 1:19994658-19994680 CCTCATCTTTGTGGATTTATCTA 0: 318
1: 5680
2: 2445
3: 861
4: 590
Right 902964990 1:19994693-19994715 GAGGCTGATGACTTCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902964990 Original CRISPR GAGGCTGATGACTTCTGGAT GGG Intergenic
No off target data available for this crispr