ID: 902966905

View in Genome Browser
Species Human (GRCh38)
Location 1:20011838-20011860
Sequence CCATCTTGGTAGCAGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902966905_902966910 2 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966910 1:20011863-20011885 CCTCATTGCTCTGTTCTCCAGGG No data
902966905_902966908 1 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966908 1:20011862-20011884 GCCTCATTGCTCTGTTCTCCAGG No data
902966905_902966915 11 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966915 1:20011872-20011894 TCTGTTCTCCAGGGGGTGGTGGG No data
902966905_902966911 3 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966911 1:20011864-20011886 CTCATTGCTCTGTTCTCCAGGGG No data
902966905_902966914 10 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966914 1:20011871-20011893 CTCTGTTCTCCAGGGGGTGGTGG No data
902966905_902966916 12 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966916 1:20011873-20011895 CTGTTCTCCAGGGGGTGGTGGGG No data
902966905_902966913 7 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966913 1:20011868-20011890 TTGCTCTGTTCTCCAGGGGGTGG No data
902966905_902966918 18 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG No data
902966905_902966912 4 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966912 1:20011865-20011887 TCATTGCTCTGTTCTCCAGGGGG No data
902966905_902966917 17 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966917 1:20011878-20011900 CTCCAGGGGGTGGTGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902966905 Original CRISPR CCATCTTGGTAGCAGAGACC AGG (reversed) Intergenic
No off target data available for this crispr