ID: 902966918

View in Genome Browser
Species Human (GRCh38)
Location 1:20011879-20011901
Sequence TCCAGGGGGTGGTGGGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902966905_902966918 18 Left 902966905 1:20011838-20011860 CCTGGTCTCTGCTACCAAGATGG No data
Right 902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG No data
902966909_902966918 -7 Left 902966909 1:20011863-20011885 CCTCATTGCTCTGTTCTCCAGGG No data
Right 902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG No data
902966907_902966918 4 Left 902966907 1:20011852-20011874 CCAAGATGGTGCCTCATTGCTCT No data
Right 902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902966918 Original CRISPR TCCAGGGGGTGGTGGGGAAT GGG Intergenic
No off target data available for this crispr