ID: 902970508

View in Genome Browser
Species Human (GRCh38)
Location 1:20044777-20044799
Sequence GCACCCTGCCAGGCTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 7, 2: 20, 3: 36, 4: 604}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902970508_902970516 8 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970516 1:20044808-20044830 GTGGAGCAGTCTAGGGAGGAGGG 0: 1
1: 1
2: 26
3: 306
4: 509
902970508_902970519 22 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970519 1:20044822-20044844 GGAGGAGGGGAGAGGTCAGATGG 0: 199
1: 424
2: 212
3: 284
4: 2004
902970508_902970521 27 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970521 1:20044827-20044849 AGGGGAGAGGTCAGATGGGTCGG 0: 11
1: 18
2: 10
3: 27
4: 505
902970508_902970513 1 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970513 1:20044801-20044823 ATCTGAGGTGGAGCAGTCTAGGG 0: 1
1: 0
2: 4
3: 34
4: 152
902970508_902970514 4 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970514 1:20044804-20044826 TGAGGTGGAGCAGTCTAGGGAGG 0: 1
1: 2
2: 20
3: 39
4: 255
902970508_902970517 9 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970517 1:20044809-20044831 TGGAGCAGTCTAGGGAGGAGGGG 0: 1
1: 0
2: 32
3: 260
4: 634
902970508_902970512 0 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970512 1:20044800-20044822 GATCTGAGGTGGAGCAGTCTAGG 0: 1
1: 0
2: 22
3: 41
4: 188
902970508_902970518 14 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970518 1:20044814-20044836 CAGTCTAGGGAGGAGGGGAGAGG 0: 1
1: 29
2: 220
3: 340
4: 879
902970508_902970515 7 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970515 1:20044807-20044829 GGTGGAGCAGTCTAGGGAGGAGG 0: 1
1: 2
2: 16
3: 63
4: 567
902970508_902970520 23 Left 902970508 1:20044777-20044799 CCTGATTCAGCCTGGCAGGGTGC 0: 1
1: 7
2: 20
3: 36
4: 604
Right 902970520 1:20044823-20044845 GAGGAGGGGAGAGGTCAGATGGG 0: 386
1: 360
2: 122
3: 126
4: 945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902970508 Original CRISPR GCACCCTGCCAGGCTGAATC AGG (reversed) Intronic
900353469 1:2248266-2248288 GCTGCCAGCCAGGCTGAGTCCGG - Intronic
901114291 1:6829147-6829169 GCACCTTGGGAGGCTGAAGCGGG - Intronic
901166964 1:7228313-7228335 CCACCATGCCCGGCTGAGTCCGG - Intronic
901236681 1:7671000-7671022 GCAGCACCCCAGGCTGAATCAGG - Exonic
902249445 1:15144335-15144357 CCACCCTGCCCGGCTGATTTGGG + Intergenic
902272397 1:15314257-15314279 GCACCCAGGCAGGGTGGATCTGG + Intronic
902464873 1:16610782-16610804 GCACTCTGGGAGGCTGAAGCGGG + Intronic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
903155927 1:21442906-21442928 GCACTCTGGGAGGCTGAAGCGGG - Intronic
903231179 1:21923117-21923139 CCACCGTGCCCGGCTGAGTCTGG - Intronic
903512183 1:23884550-23884572 GCACTTTGGGAGGCTGAATCGGG - Intronic
903512334 1:23885631-23885653 GCACTCTGGGAGGCTGAAGCAGG + Intronic
903697884 1:25222167-25222189 GCACTTTGCGAGGCTGAGTCAGG - Intergenic
904186456 1:28708747-28708769 GCACTCTGGGAGGCTGAAGCAGG + Intronic
904190535 1:28739586-28739608 CCACCATGCCCGGCTGAGTCAGG + Intronic
904273200 1:29363769-29363791 TCAACCAGCCAGGCTGACTCTGG + Intergenic
904351024 1:29906819-29906841 TCCCTCTGCCATGCTGAATCAGG + Intergenic
904487419 1:30836117-30836139 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
904530937 1:31168728-31168750 GCACTTTGGCAGGCTGAAACAGG - Intergenic
904732599 1:32606241-32606263 GCTCCATGCCAGGCTGCAGCGGG + Intronic
905302924 1:36997817-36997839 AAACCCTCCCAGGCTGTATCTGG - Intronic
906049430 1:42858194-42858216 GCTCCTTGCCAGGCTGAATTGGG + Intergenic
906138173 1:43515128-43515150 TCTCCCTGCCAGGCTGGCTCTGG + Intergenic
906978140 1:50598045-50598067 GCACTTTGCAAGGCTGAGTCAGG + Intronic
907153068 1:52306784-52306806 GCTCTCTGCCAGGCTGCAGCTGG - Intronic
907450052 1:54540609-54540631 CCACCCTGGCAAGATGAATCTGG - Intergenic
908845423 1:68319862-68319884 ACACAATGCCAGGCTAAATCTGG - Intergenic
909014627 1:70369042-70369064 ACTCCCCGCCACGCTGAATCAGG + Intronic
909087039 1:71180617-71180639 GCACTCTGGGAGGCTGAAGCGGG + Intergenic
909729300 1:78873585-78873607 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
910602023 1:89042756-89042778 GCTCCCTGCGAGGCTGAAACTGG + Intergenic
911983768 1:104597655-104597677 AGTCCCTGCCAGGCTGAATCAGG + Intergenic
913234239 1:116766274-116766296 GCACCCTGCCTGGTTCAAGCAGG - Intronic
914399131 1:147299783-147299805 GCACTTTGGGAGGCTGAATCAGG + Intergenic
915002177 1:152603464-152603486 GCACCCTCCCGGGATGTATCAGG + Intergenic
915443242 1:155959793-155959815 GCACTTTGGGAGGCTGAATCAGG - Intronic
916030183 1:160869913-160869935 GCACTTTGGGAGGCTGAATCAGG + Intergenic
916532644 1:165672688-165672710 GCACCTTGGGAGGCTGAAGCAGG + Intronic
916941704 1:169684511-169684533 GCTCCCCGCCAGGCTGAATCAGG + Intronic
917339953 1:173965892-173965914 GCACTCTGGGAGGCTGAAGCGGG + Intronic
917387784 1:174495963-174495985 GCACACTGGCAGGCTGAGGCAGG - Intronic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
919091014 1:192979167-192979189 ACTCCCCACCAGGCTGAATCAGG - Intergenic
919632102 1:199969480-199969502 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
919655934 1:200197267-200197289 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
920180746 1:204130426-204130448 GCAGCCTGCCAGGTGGACTCTGG - Intergenic
920244563 1:204578002-204578024 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
920290200 1:204916817-204916839 GCACCCTGGAAGGCTGAGACAGG - Intronic
920944804 1:210518544-210518566 GCACTTTGGGAGGCTGAATCGGG + Intronic
921097458 1:211899561-211899583 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
921241772 1:213191998-213192020 GCACTTTGGGAGGCTGAATCGGG - Intronic
922314304 1:224428648-224428670 GCACTCTGCGAGGCTGAGGCGGG + Intronic
922368355 1:224886748-224886770 GCTCCTCACCAGGCTGAATCGGG + Intergenic
922421985 1:225466309-225466331 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
922766822 1:228160332-228160354 GCAGCCGGCCAGGCTGCACCAGG - Intergenic
922845543 1:228681351-228681373 GCTCCCCGCCAGGCTGAATCAGG - Intergenic
923125937 1:231034524-231034546 GCACTCTGGGAGGCTGAAGCGGG + Intronic
923263970 1:232294771-232294793 GCACTCTGGGAGGCTGAGTCAGG - Intergenic
923901595 1:238332024-238332046 GCACCTTGAGAGGCTGAAGCAGG - Intergenic
924404749 1:243730855-243730877 GCTCCTTGCCAGGCTGCAGCTGG - Intronic
924543136 1:245000063-245000085 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1064413416 10:15127654-15127676 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1065201354 10:23316260-23316282 GCTCCCTGCAAGGCTGCAGCTGG + Intronic
1065281048 10:24138392-24138414 GCACTCTGGGAGGCTGAAACAGG - Intronic
1065690289 10:28325738-28325760 GCACTTTGGGAGGCTGAATCAGG - Intronic
1066017353 10:31261056-31261078 GCACTTTGGCAGGCTGAAGCAGG - Intergenic
1066092204 10:32034262-32034284 GCACCATGCCAGGCTAATTTTGG + Intronic
1066259335 10:33713764-33713786 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1067317428 10:45181268-45181290 AGATCCTGGCAGGCTGAATCTGG + Intergenic
1067746527 10:48940533-48940555 GGACCCTGCCGGGCTCAGTCTGG - Intronic
1068024272 10:51623446-51623468 GCACTTTGGCAGGCTGAAGCAGG - Intronic
1068360696 10:55972870-55972892 ACTCCCCACCAGGCTGAATCAGG + Intergenic
1068483815 10:57630476-57630498 GCACCTTGTGAGGCTGAAGCAGG + Intergenic
1069440202 10:68421505-68421527 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1069533356 10:69235014-69235036 GCACCCTGGGAGGCTGAGGCGGG + Intronic
1069561665 10:69435229-69435251 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1069825483 10:71252847-71252869 ACAGACTGCCAGGCTGAGTCAGG - Intronic
1069896582 10:71683834-71683856 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1069985713 10:72281766-72281788 GCACTTTGGGAGGCTGAATCGGG - Intergenic
1070055407 10:72929787-72929809 GCACTCTGGCAGGCTGAGGCAGG - Intronic
1070195040 10:74149532-74149554 GCACTTTGGCAGGCTGAAGCGGG - Intronic
1070401283 10:76055732-76055754 GCTCCCTGTGAGGCTGCATCTGG + Intronic
1070893663 10:79963229-79963251 GCTACTTGGCAGGCTGAATCTGG + Intronic
1071408427 10:85361960-85361982 GCACTCTGGGAGGCTGAACCGGG + Intergenic
1071516393 10:86300615-86300637 CCACCCTCCCAGGCTGATCCTGG + Intronic
1071550879 10:86565304-86565326 GCTCCTTGCCAGGCTGAGCCAGG - Intergenic
1072167526 10:92828578-92828600 GCACCCTGGGAGGCTGAGGCTGG - Intergenic
1072512337 10:96140102-96140124 GCACTCTGCGAGGCTGAGGCAGG - Intronic
1073394496 10:103206868-103206890 GCTTTCTGCCAGGCTGAATCAGG + Intergenic
1073436513 10:103520028-103520050 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1073683448 10:105729016-105729038 ACTCCCCACCAGGCTGAATCAGG + Intergenic
1074508086 10:114088843-114088865 GCACTGTGCCAGGCAGAGTCGGG - Intergenic
1075604549 10:123795014-123795036 GCACTTTGCAAGGCTGAAGCAGG - Intronic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1078788042 11:14515798-14515820 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1079118432 11:17656361-17656383 GCAGGCTCCCAGGCTGAACCTGG + Intergenic
1079187704 11:18252464-18252486 GCACTTTGCCGGGCTGAAGCAGG + Intergenic
1079539853 11:21560237-21560259 GCCCCCTGCCAGGTTGATGCAGG - Exonic
1080510370 11:32963911-32963933 GCACTCTGGAAGGCTGAAGCAGG - Intronic
1080668000 11:34352807-34352829 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1081159569 11:39735694-39735716 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1081649347 11:44813166-44813188 GCACCCGGTCAGGCTGCTTCTGG + Intronic
1081692533 11:45088111-45088133 CCACCCTGCCATGCTGCAGCCGG - Intergenic
1082197845 11:49325472-49325494 ACTCCCTGCCAGGCTGAATCAGG - Intergenic
1082209806 11:49485157-49485179 GCACACTGAGAGGCTGAAGCGGG - Intergenic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1084167478 11:67382579-67382601 GCATCCTCCCAGGCTGAGACAGG - Intronic
1084379294 11:68800866-68800888 GCACTTTGGGAGGCTGAATCAGG + Intronic
1085009976 11:73132574-73132596 GCACTTTGGCAGGCTGAGTCAGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085433271 11:76475008-76475030 GCACCTTGGTAGGCTGAAGCGGG - Intronic
1086352800 11:85959824-85959846 GCACCCTGGGAGGCTGATGCGGG - Intronic
1086639861 11:89140375-89140397 GCACACTGGGAGGCTGAAGCGGG + Intergenic
1086657972 11:89382654-89382676 ACTCCCTGCCAGGCTGAATCAGG + Intronic
1087210950 11:95446211-95446233 GCTCCCTGCGAGGCTGCAGCTGG + Intergenic
1087693933 11:101354009-101354031 GCACTTTGGCAGGCTGAAGCGGG + Intergenic
1089424815 11:118363862-118363884 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1090940715 11:131385604-131385626 GCACTCTGGGAGGCTGAAGCTGG + Intronic
1092286565 12:7132078-7132100 GCCCCTCACCAGGCTGAATCTGG + Intronic
1092366438 12:7880891-7880913 GCACTTTGCCAGGCTGAGGCGGG + Intronic
1093678778 12:21976004-21976026 GCACTCTGGGAGGCTGAAGCTGG + Intergenic
1093695652 12:22157295-22157317 GCACCCTGGGAGGCTGAGGCTGG - Intronic
1094666802 12:32528181-32528203 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1095085893 12:38057034-38057056 GCACCTTGAGACGCTGAATCAGG + Intergenic
1095490590 12:42729396-42729418 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1095888184 12:47210517-47210539 GCACTCTGAGAGGCTGAAGCAGG + Intronic
1095999172 12:48114522-48114544 GCTCCCCGCCAGGCTGAATCAGG - Intronic
1096174626 12:49505008-49505030 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1096907268 12:54946967-54946989 GCTCCCCACCAGGCTGAATCAGG - Intergenic
1097028970 12:56078430-56078452 GCACTTTGGCAGGCTGAAGCAGG + Intergenic
1097177224 12:57150435-57150457 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1097694100 12:62760429-62760451 GCTCCCTGCCAGGTTGAATCAGG + Intronic
1097934373 12:65228640-65228662 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1098273249 12:68789434-68789456 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1099191735 12:79568343-79568365 GCACTCTGGGAGGCTGAAGCGGG + Intergenic
1099294824 12:80817012-80817034 GCACTTTGCGAGGCTGAAGCAGG - Intronic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1099815765 12:87645571-87645593 CCACCCTGCAGGGCTGATTCTGG + Intergenic
1100034721 12:90236538-90236560 GCACTCTGGCAGGCTGAGGCAGG + Intergenic
1100318996 12:93472341-93472363 GCACTTTGGCAGGCTGAAGCAGG + Intronic
1100450486 12:94701302-94701324 GCACTCTGCGAGGCTGAGACAGG + Intergenic
1100636560 12:96440112-96440134 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1100959957 12:99951626-99951648 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1101770939 12:107750297-107750319 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1102119718 12:110430534-110430556 GCACTCTGAGAGGCTGAAGCAGG + Intergenic
1102604333 12:114057147-114057169 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1103177091 12:118873694-118873716 GCACTCTGGGAGGCTGAAACAGG + Intergenic
1103290822 12:119844872-119844894 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1103470565 12:121176950-121176972 ACACCCTGCACGGCTGAAGCAGG + Intronic
1103976491 12:124706002-124706024 GCACCCTCCCCAGCTGAATGAGG + Intergenic
1104668350 12:130663296-130663318 GCCCCCTCCCAGGCTGTCTCAGG - Intronic
1104852720 12:131885127-131885149 GCACTTTGCGAGGCTGAAGCAGG - Intergenic
1105034167 12:132906642-132906664 GCACTCTGCGAGGCTGAGGCGGG + Intronic
1105502591 13:20985797-20985819 GCACCCTGGGAGGCTGAGACAGG + Intronic
1105885039 13:24634744-24634766 GCACTTTGGGAGGCTGAATCAGG + Intergenic
1106698572 13:32204954-32204976 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1108616150 13:52134269-52134291 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1109687893 13:65844540-65844562 GCACCATGCGAGGCTGCAGCTGG - Intergenic
1111156656 13:84336908-84336930 GCACTTTGGGAGGCTGAATCAGG + Intergenic
1111768666 13:92568073-92568095 GCACTCTGGCAGGCTGAGGCAGG + Intronic
1112037171 13:95507538-95507560 GCACCTTGGGAGGCTGAGTCAGG + Intronic
1112274190 13:98001118-98001140 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1112680196 13:101755390-101755412 GCACTTTGGGAGGCTGAATCAGG + Intronic
1113684467 13:112272761-112272783 GCATCCTGACAGGCTGGTTCTGG + Intergenic
1114196172 14:20478277-20478299 GCACCTTGGTAGGCTGAAGCAGG - Intergenic
1114252772 14:20975735-20975757 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1114344629 14:21781743-21781765 GCTCCCTGCCAGGCTGAAGCTGG - Intergenic
1114756188 14:25262866-25262888 GGACCCTGACATGCTGCATCTGG + Intergenic
1115458369 14:33631706-33631728 GCACCATGCCAGGGTTATTCAGG - Intronic
1116514588 14:45789507-45789529 GCACCTTGGGAGGCTGAAGCCGG - Intergenic
1116889987 14:50258757-50258779 GCACTTTGGGAGGCTGAATCAGG - Intronic
1117682103 14:58214735-58214757 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1118625265 14:67653033-67653055 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1118820897 14:69345246-69345268 GCTGGCTGCCAAGCTGAATCTGG - Intronic
1119303342 14:73588244-73588266 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1119865031 14:77966272-77966294 GCGCCCCGCCTGGCTGAACCTGG - Intergenic
1120414068 14:84196787-84196809 GCACTCTGGGAGGCTGAAGCGGG + Intergenic
1120988749 14:90356351-90356373 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1121213064 14:92223739-92223761 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1122884700 14:104705810-104705832 GCGCCCTGCCAGGCTGCCCCCGG - Intronic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1124499908 15:30218786-30218808 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1124510204 15:30317781-30317803 GAACTCTGCCAGGCTGGTTCAGG + Intergenic
1124709164 15:31991055-31991077 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1124732685 15:32212772-32212794 GAACTCTGCCAGGCTGGTTCAGG - Intergenic
1124925713 15:34068451-34068473 GCACTTTGCCAGGCCAAATCGGG - Intergenic
1125629084 15:41132817-41132839 GCTCCCCACCAGGCTGAATCAGG + Intergenic
1125961061 15:43830314-43830336 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1126614414 15:50562181-50562203 CCACCATGCCCGGCTGAATTAGG + Intronic
1126711090 15:51456923-51456945 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1126795041 15:52253797-52253819 CCACCCAGCCAGGCTGCATTAGG - Intronic
1126990747 15:54373530-54373552 GCTCCCTGCAAGGCTGCAGCTGG + Intronic
1127031236 15:54865921-54865943 GCTCCTTGGCAGGCTGAAGCAGG - Intergenic
1128076424 15:64829082-64829104 GCACTCTGGCAGGCTGAGGCTGG - Intergenic
1128794774 15:70458328-70458350 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1129259350 15:74355572-74355594 CTCCCCAGCCAGGCTGAATCAGG + Intronic
1129845395 15:78765706-78765728 GCTCCCAGCCTGGCTGAAGCGGG - Exonic
1129964671 15:79723655-79723677 GAACCCTCCCAGGCTAAGTCCGG - Intergenic
1130338415 15:82977898-82977920 GCACTTTGCGAGGCTGAAGCAGG + Intronic
1130704628 15:86221084-86221106 GCTACCTGGGAGGCTGAATCAGG + Intronic
1131164778 15:90134467-90134489 TTTCCCTGCCAGGCTGAATCAGG + Intergenic
1131487449 15:92833424-92833446 GCACTTTGGGAGGCTGAATCGGG - Intergenic
1131850812 15:96541456-96541478 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1132529839 16:441186-441208 GCACTCTGCGAGGCTGAGGCAGG - Intronic
1133192155 16:4142064-4142086 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1133363191 16:5190194-5190216 GCACTCTGGCAGGCTGAGGCAGG - Intergenic
1133767756 16:8849664-8849686 GCACCCAGCCTGGCAGACTCGGG - Intergenic
1133798415 16:9065238-9065260 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1133818758 16:9218012-9218034 GCTCCTTGCAAGGCTGAAGCAGG - Intergenic
1133905228 16:10016205-10016227 GCACCATTGCAGGCTGAATTAGG - Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134783161 16:16917131-16917153 GTGCCCTACAAGGCTGAATCAGG - Intergenic
1135003084 16:18793675-18793697 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1135283277 16:21171453-21171475 CCACTCTGCCAGGCTGTATTTGG - Intronic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135996020 16:27249074-27249096 GCACTCTGGGAGGCTGAAGCCGG - Intronic
1136424739 16:30162157-30162179 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1136594386 16:31237700-31237722 GCACTTTGGCAGGCCGAATCGGG - Intergenic
1137055468 16:35744332-35744354 ACTCACTGCCAGGCTGAATCAGG - Intergenic
1138246494 16:55470710-55470732 GCAACCTCCCAGGAGGAATCCGG - Intronic
1138401508 16:56748684-56748706 GAGCCCTGTCATGCTGAATCTGG + Intronic
1138473460 16:57256832-57256854 TCACCCTGCAAGCCTGAAGCTGG - Exonic
1138505751 16:57477515-57477537 CCACCCTGGCAGGGTGTATCTGG - Intronic
1139388333 16:66588899-66588921 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
1139465410 16:67151336-67151358 GCACCCTGCCTGATGGAATCAGG - Intergenic
1140097940 16:71891625-71891647 GCACCCTGGGAGGCCGAAGCCGG + Intronic
1140108557 16:71983391-71983413 GCACTTTGGGAGGCTGAATCAGG - Intronic
1140152882 16:72389857-72389879 GCTTCCTGCCAGTCTGTATCTGG - Intergenic
1141184334 16:81776353-81776375 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1141351316 16:83300577-83300599 GCACCATGCCAGGCAGGGTCTGG + Intronic
1141416631 16:83880501-83880523 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
1141942391 16:87285991-87286013 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1142040167 16:87888353-87888375 GTCCCCTCCCATGCTGAATCAGG + Intronic
1142270654 16:89087742-89087764 CCACCCAGCCAGGCTGCTTCTGG - Intergenic
1142368663 16:89665239-89665261 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1142394924 16:89826857-89826879 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1142529339 17:568491-568513 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1142541031 17:659566-659588 CCACCGTGCCCGGCTGCATCAGG + Intronic
1142959869 17:3545730-3545752 GCACCCTGGGAGGCTGAGGCGGG + Intronic
1143273436 17:5692607-5692629 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1143549052 17:7617835-7617857 GCACTTTGCGAGGCTGAAGCAGG + Intronic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1143860706 17:9888711-9888733 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1144119143 17:12133326-12133348 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1145247189 17:21277019-21277041 GCACTTTGGGAGGCTGAATCAGG + Intergenic
1145732904 17:27206094-27206116 GCACCCTGCAAAGCTGAAAAAGG - Intergenic
1146524214 17:33552274-33552296 GCCTCCTGCCAGGCTGAGTGGGG + Intronic
1146667053 17:34712210-34712232 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1147015006 17:37484778-37484800 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1147324477 17:39663711-39663733 GCCCCCTGCCAGGCTTCAGCGGG + Intergenic
1147424817 17:40341540-40341562 GCCCCCTGCCCGGCCGAACCGGG - Intronic
1147454488 17:40528318-40528340 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1147510979 17:41068689-41068711 GCACCATGGCAGGCTGATGCTGG + Intergenic
1147619059 17:41851657-41851679 GCACCCTGGGAGGCTGATACGGG + Intergenic
1147696323 17:42357032-42357054 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1147785680 17:42977042-42977064 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1147841994 17:43378534-43378556 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1147871910 17:43593438-43593460 CCACCCTGCCCGGCTGAAAGTGG - Intergenic
1148137271 17:45302075-45302097 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1148272361 17:46272004-46272026 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
1149759889 17:59219679-59219701 CCACCGCGCCCGGCTGAATCAGG + Intergenic
1150017538 17:61573377-61573399 GCACTTTGCAAGGCTGAAACAGG - Intergenic
1150102857 17:62439349-62439371 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1150107431 17:62472624-62472646 GCTCCTTGCTAGGCTGAAGCAGG + Intronic
1150116112 17:62551062-62551084 GCACTTTGGGAGGCTGAATCAGG - Intronic
1150372035 17:64647432-64647454 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1150640705 17:66947640-66947662 GGGCCCTGCCAGGCTGCAGCTGG - Intergenic
1150760465 17:67956562-67956584 GCACTCTGGGAGGCTGAAGCTGG - Intronic
1151312316 17:73300798-73300820 GCACTCTGGGAGGCTGAGTCAGG + Intronic
1151340252 17:73466498-73466520 ACACCCTGCCAGGCAGAAGAAGG + Intronic
1152142270 17:78543669-78543691 GCACTCTGGGAGGCTGAGTCGGG - Intronic
1152461888 17:80445946-80445968 ACACCCTGCCAGACTGATCCGGG + Intergenic
1152864098 17:82711994-82712016 GCTCCCTGCGAGGCTGCAGCTGG + Intergenic
1153670930 18:7411512-7411534 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
1153957202 18:10107647-10107669 ACAACCTGCAAGACTGAATCAGG - Intergenic
1154072052 18:11161626-11161648 GAACCCTGCCAGCCTTATTCAGG + Intergenic
1154199178 18:12287596-12287618 GCTGCCTGCCAGGCTGACCCAGG + Intergenic
1154221193 18:12455690-12455712 GGACCCTGCCAGGCTGCAAGGGG + Intronic
1154405004 18:14082929-14082951 GCACCTTGGCAGGCTGAGACAGG - Intronic
1154936311 18:21061324-21061346 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1155004343 18:21714584-21714606 GTATCCTCCCATGCTGAATCTGG + Intronic
1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG + Intergenic
1155202212 18:23527135-23527157 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1156774514 18:40770805-40770827 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
1156915729 18:42463214-42463236 ACTCCCTGCCAGGCTGAATCAGG + Intergenic
1157042766 18:44060272-44060294 ACAACCTGCCAGGCTGAGTGGGG - Intergenic
1157657151 18:49401777-49401799 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1157932832 18:51842071-51842093 GCACTTTGGCAGGCTGAAGCAGG - Intergenic
1158465558 18:57686780-57686802 GCACCTTGGGAGGCTGAGTCAGG - Intronic
1158810466 18:61028011-61028033 GCACTATGGAAGGCTGAATCGGG + Intergenic
1159238501 18:65709136-65709158 GCACTCTGGGAGGCTGAATTGGG + Intergenic
1159819256 18:73119269-73119291 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
1159984915 18:74830533-74830555 GCACTCTGGCAGGCTTAGTCAGG - Intronic
1160015374 18:75136050-75136072 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1160632541 18:80256908-80256930 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1161819445 19:6520625-6520647 GCACCCTGGGAGGCTGAGACGGG + Intergenic
1162025318 19:7890500-7890522 CCACCGTGCCCGGCTGAAGCAGG - Intronic
1162200711 19:9018139-9018161 GCACTCTGGGAGGCTGAGTCGGG - Intergenic
1162259707 19:9522432-9522454 GCACTCTGGAAGGCTGAAGCGGG - Intergenic
1162274313 19:9640783-9640805 GCTCCTCGCCAGGCTGAATTGGG - Intronic
1162286530 19:9743134-9743156 GCTCCTCGCCAGGGTGAATCAGG + Intergenic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162442776 19:10703306-10703328 GCACTCTGCGAGGCCGAAGCAGG - Intronic
1162447461 19:10732197-10732219 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1162570420 19:11468670-11468692 GCACTTTGGCAGGCTGAAGCAGG - Intronic
1163309769 19:16506917-16506939 GCACTTTGGGAGGCTGAATCGGG - Intronic
1163946498 19:20540512-20540534 GCACCGTGGGAGGCTGAAGCAGG + Intronic
1164202579 19:23030857-23030879 GCTCCTTGCCAGGCCGAGTCAGG - Intergenic
1164783934 19:30914446-30914468 GCACCCTGGCAGGCTTCAACTGG - Intergenic
1164929426 19:32164135-32164157 GCACTTTGCGAGGCTGAAACAGG + Intergenic
1165411193 19:35662785-35662807 GCACCTTGGGAGGCTGAAGCGGG - Intergenic
1165779040 19:38421463-38421485 GCACTTTGGGAGGCTGAATCGGG + Intronic
1165920589 19:39295488-39295510 GCACTTTGCGAGGCTGAAGCAGG + Intergenic
1166044890 19:40224199-40224221 GCACCTTGGAAGGCTGAAACCGG - Intronic
1166190552 19:41173817-41173839 GAACCAGGCCAGGCTGACTCTGG + Intergenic
1166323290 19:42033071-42033093 GCACTCTGGGAGGCTGAAGCGGG + Intronic
1166724177 19:45015621-45015643 GCACCATGGGAGGCTGAATGGGG + Intronic
1166845171 19:45722812-45722834 GCACCTTGGGAGGCTGAAGCGGG + Intronic
1167394975 19:49222590-49222612 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1168248048 19:55124206-55124228 GCTCCCCACCAGGCTGAATCAGG + Intergenic
926674339 2:15607799-15607821 GCACTCTGGGAGGCTGAAGCAGG - Intronic
928561660 2:32494653-32494675 GCACCCTGGGAGGCTGAGGCGGG + Intronic
929005433 2:37388851-37388873 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
929014676 2:37482347-37482369 GCTCCCTGCGAGGCTGCAGCTGG - Intergenic
929893621 2:45939052-45939074 GCACCCTGCCAGGGTGGAGGAGG + Intronic
929970198 2:46567636-46567658 GCACTCTGCGAGGCTGAGACAGG - Intronic
930099206 2:47590072-47590094 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
931217753 2:60262354-60262376 GCACGCTGCCAGCCTGGCTCTGG + Intergenic
932054609 2:68431929-68431951 GCTCCCTGCAAGGCTGCATCTGG + Intergenic
932129517 2:69175361-69175383 GCACCTTGGGAGGCTGAAGCAGG + Intronic
932184569 2:69682096-69682118 GCACTTTGGGAGGCTGAATCAGG - Intronic
932196198 2:69786137-69786159 CCACACTGCCACTCTGAATCTGG + Intronic
933411512 2:81931056-81931078 GCATCATGCCACACTGAATCAGG + Intergenic
934696984 2:96407070-96407092 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
934765251 2:96876838-96876860 GCACCCTGCTGGGCTGGCTCGGG - Intronic
934990967 2:98921266-98921288 GCGCCCTGCCAGACTGACTCAGG - Intronic
935625891 2:105172096-105172118 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
937913475 2:127087554-127087576 GCCCCCTCCCAGCCTGACTCTGG - Intronic
938161088 2:128985148-128985170 GCACCCTGCCTGGGTGAAGGGGG + Intergenic
938256174 2:129861669-129861691 GCTCCCTCCCATCCTGAATCAGG + Intergenic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
940541947 2:155031321-155031343 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
941595129 2:167466972-167466994 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
942151833 2:173083463-173083485 GCACTCTGCAAGGCTGAGGCAGG - Intronic
942563757 2:177246842-177246864 GCACCTTGGGAGGCTGAAGCCGG - Intronic
943081742 2:183265014-183265036 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
943426898 2:187749264-187749286 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
943652146 2:190468703-190468725 GCACCCTGGGAGGCTGAGGCAGG - Intronic
944250943 2:197579784-197579806 GCTCCCTGCCAGGCTGAATCAGG + Intronic
944540977 2:200753260-200753282 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
944595425 2:201256897-201256919 GCACTCTGCCAGGCCGAGGCGGG + Intronic
944801046 2:203238513-203238535 GCACCTTGGGAGGCTGAAGCGGG - Intronic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
945282819 2:208052088-208052110 GCACTCTGGCAGGCTGAGGCGGG + Intergenic
945611621 2:212011502-212011524 GCACCCTGGGAGGCTGAGACGGG + Intronic
947761865 2:232609305-232609327 GCACCTTGGGAGGCTGAAGCAGG - Intronic
948362463 2:237432776-237432798 GCTCCCTGCCAGGCTGTCCCAGG + Intergenic
948969425 2:241413694-241413716 GCACCCTGGGAGGCTGAGGCAGG + Intronic
949050405 2:241894800-241894822 GCACCCTGCCCGGCTGCCTGTGG + Intronic
1168943408 20:1732131-1732153 GCTCCCCGCCAAGCTAAATCAGG - Intergenic
1169222017 20:3829500-3829522 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1169278071 20:4246891-4246913 CCACACTGCCAGGCTGAGTCAGG - Intronic
1169649411 20:7850261-7850283 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1169943316 20:10961486-10961508 GCATCCTGCCAGTCTGAAAGGGG + Intergenic
1169986200 20:11447611-11447633 GCACCCTGCTAAGCTGCACCTGG + Intergenic
1170249966 20:14270475-14270497 GCTCCCTGGGAGGCTGAAGCAGG + Intronic
1170458483 20:16554846-16554868 GCTCCCTGCAAGGCTGCAGCTGG - Intronic
1170834641 20:19873370-19873392 GCACATTGGCAGGCTGAAGCAGG - Intergenic
1171460895 20:25297383-25297405 GCCCCCTGCCAGGCAGAAAATGG - Exonic
1172314511 20:33943425-33943447 GCACTTTGCAAGGCTGAAGCAGG - Intergenic
1172701355 20:36855473-36855495 GCTCCATGCCAGGCTGACCCTGG - Intronic
1172727623 20:37058269-37058291 GCACTTTGCGAGGCTGAAGCAGG + Intronic
1174081800 20:47975153-47975175 GCACTCTGGCAGGCTGAGGCGGG + Intergenic
1174230184 20:49039991-49040013 GCACGGTGCCAGGCTAGATCTGG - Intergenic
1175138664 20:56843483-56843505 GCTCCCTGCGAGGCTGCAGCTGG - Intergenic
1175879790 20:62250672-62250694 GCACCTTGGGAGGCTGATTCGGG + Intronic
1175909039 20:62395867-62395889 GCACCCTGAGAGGCTGTGTCGGG - Intronic
1177063108 21:16397398-16397420 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
1178443147 21:32614515-32614537 GCACTTTGGGAGGCTGAATCAGG - Intergenic
1178515972 21:33247494-33247516 GCACCTTGGCAGGCTGAGGCGGG - Intronic
1178643734 21:34367212-34367234 GCACCTTGGGAGGCTGAAGCAGG + Intronic
1178893248 21:36537892-36537914 GCACCTTGGGAGGCTGAAGCAGG - Intronic
1178915637 21:36704421-36704443 GAAGCCTGCCAGGCTGCAGCTGG + Intronic
1179244540 21:39620070-39620092 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1179650459 21:42805089-42805111 GCTCCTTGCCAGGCTGAGCCAGG - Intergenic
1180203871 21:46244855-46244877 GCACCTGGCCTGGCTGAAGCAGG - Exonic
1181098247 22:20520984-20521006 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1181136780 22:20772841-20772863 GCACTTTGCAAGGCTGAAGCAGG + Intronic
1181837710 22:25624450-25624472 GCTACCTGGGAGGCTGAATCAGG + Intronic
1182201405 22:28574256-28574278 GCACCCTGGGAGGCTGAAGCAGG - Intronic
1182267043 22:29125187-29125209 CCACCCTGCCAGGCTCCTTCAGG + Intronic
1182672735 22:32010859-32010881 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
1182704414 22:32267588-32267610 GCACCCTGGGAGGCTGAGTCGGG - Intergenic
1183046269 22:35222905-35222927 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1184221458 22:43103120-43103142 GCACTTTGCAAGGCTGAAGCAGG + Intergenic
1184361146 22:44019505-44019527 CCACCGTGCCCGGCTGAAGCTGG + Intronic
1184963156 22:47946351-47946373 GCACCCAGCCAGGCAGTTTCAGG - Intergenic
949439815 3:4068089-4068111 GCTTCCTGCCAGGCAGAATTAGG + Intronic
949912220 3:8921534-8921556 GCTACCTGGCAGGCTGAAACAGG + Intronic
950338856 3:12223922-12223944 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
950483729 3:13260739-13260761 GCACCCTGCCAGGAGGACTGTGG - Intergenic
951095934 3:18631214-18631236 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
951511130 3:23503435-23503457 GCACCTTGGGAGGCTGAAGCAGG - Intronic
952296734 3:32068905-32068927 GCTCCCCGTCAGGCTGAATCAGG + Intronic
952674408 3:36009845-36009867 GCACCCTGAGAGGCTGAGGCGGG + Intergenic
952764426 3:36942932-36942954 GCACTCTGGCAGGCAGAAGCGGG + Intronic
952779051 3:37076275-37076297 GCACTCTGGGAGGCTGAAGCAGG + Intronic
952785737 3:37153148-37153170 GCACTTTGGGAGGCTGAATCAGG + Intronic
954158381 3:48701318-48701340 GCACCCTGGGAGGCTGAGGCGGG + Intronic
954161886 3:48728749-48728771 GCTCTCCGCCAGTCTGAATCAGG - Intronic
954252509 3:49378840-49378862 GCACTTTGGGAGGCTGAATCGGG - Intronic
954729788 3:52650071-52650093 CCACCCTGCCAGGCCTCATCAGG - Intronic
955357973 3:58247248-58247270 GCACCTTGGGAGGCTGAAGCAGG - Intronic
956233584 3:67042744-67042766 ACTCCCTGCCAGGCTGAATCAGG - Intergenic
956605804 3:71071820-71071842 GCACCTTGGGAGGCTGAAGCAGG - Intronic
956934554 3:74085269-74085291 GCACTTTGGCAGGCTGAAGCAGG - Intergenic
957024045 3:75159460-75159482 GCACTCTGCCAGGCTGAGGCGGG - Intergenic
957451357 3:80386546-80386568 ACTCCCCACCAGGCTGAATCAGG + Intergenic
957646852 3:82940393-82940415 ACAGCCTGCCAGGCTGAGTGGGG + Intergenic
957768020 3:84650729-84650751 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
957788076 3:84906125-84906147 GCTCCCTGCAAGGCTGCAGCTGG - Intergenic
957985612 3:87571023-87571045 GCTCCCCACCAGGCTGAATCAGG + Intergenic
958421868 3:93939446-93939468 GCTCCCCGCCAGGCTGAATCAGG + Intronic
958427111 3:93991615-93991637 GCACTCTGCGGGGCTGAAGCAGG - Intronic
958750920 3:98192640-98192662 ACTCCCTGTGAGGCTGAATCAGG + Intronic
958755392 3:98245291-98245313 GCTCCTTCCCAGGCTGAATCAGG + Intergenic
958818765 3:98948777-98948799 GCACTCTGGGAGGCTGAAGCGGG - Intergenic
959698292 3:109273236-109273258 GCACCTTGGGAGGCTGAGTCAGG - Intergenic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960700194 3:120431830-120431852 GCAGCATGTCAGGCTGCATCTGG + Intronic
962022265 3:131513140-131513162 ACTCCCTGCAAGGCTGAATCAGG - Intergenic
962443245 3:135442606-135442628 TGACCCTGCCATGCTGCATCAGG + Intergenic
962518641 3:136177426-136177448 GCACCCTGGGAGGCTGAGGCAGG + Intronic
962524106 3:136222291-136222313 GCTCCCCACCAGGCTGAATCAGG - Intergenic
963042904 3:141082294-141082316 GCCCAGTGCCAGGCTGCATCAGG + Intronic
963140091 3:141939759-141939781 GCACTCTGGGAGGCTGAAGCGGG + Intergenic
963319648 3:143798929-143798951 GCTCCTTGCCAGGCTGAGCCAGG + Intronic
965509680 3:169554770-169554792 GCAGCTAGTCAGGCTGAATCTGG + Intronic
966144964 3:176800698-176800720 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
966341863 3:178934134-178934156 GCACTTTGGCAGGCTGAAGCGGG - Intergenic
967015573 3:185478642-185478664 GCACTTTGGGAGGCTGAATCAGG + Intronic
967373541 3:188775295-188775317 GCACCTTGGGAGGCTGAAGCAGG - Intronic
967837524 3:193977381-193977403 GCATTTTGCCAGGCTGAATATGG + Intergenic
968001730 3:195211145-195211167 GCACTCTGGGAGGCTGAAGCAGG + Intronic
968073774 3:195804638-195804660 GCCCCTTGCCAGGCTGCCTCGGG + Intronic
968190951 3:196666747-196666769 GCACTCTGGAAGGCTGAAGCAGG + Intronic
968238001 3:197049070-197049092 GCACTCTGGGAGGCTGAAGCAGG + Intronic
970612638 4:17739800-17739822 GCACCTTGCAAGGCTGAGGCAGG - Intronic
971335042 4:25714816-25714838 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
972544112 4:40064042-40064064 GCACCTTGGGAGGCTGAAGCAGG - Intronic
972661272 4:41118891-41118913 GCACTTTGGCAGGCTGAAGCAGG + Intronic
972663976 4:41146077-41146099 GCACTCTGGGAGGCTGAAGCAGG + Intronic
973547130 4:51993157-51993179 GCACTTTGACAGGCTGAAGCAGG + Intergenic
973981547 4:56312407-56312429 GCACTCTGGGAGGCTGAAGCGGG - Intronic
974056820 4:56991902-56991924 GCACTCTGGGAGGCTGAAGCAGG - Intronic
974059297 4:57016003-57016025 GCACTCTGGGAGGCTGAAGCAGG - Intronic
974173508 4:58295363-58295385 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
974903693 4:68032289-68032311 ACTCCCCGCCAGGCTGAGTCAGG + Intergenic
975254251 4:72215493-72215515 GCTCCCTGTGAGGCTGAAGCTGG + Intergenic
975445274 4:74456653-74456675 GCTACTTGCCAGGCTGAGTCGGG + Intergenic
975517450 4:75262094-75262116 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
976206055 4:82624588-82624610 GCACCTTGGGAGGCTGAAGCGGG + Intergenic
976243099 4:82979690-82979712 GCACTCTGGGAGGCTGAAGCAGG + Intronic
976706264 4:88022834-88022856 GCACTTTGTCAGGCTGAAGCAGG + Intronic
976740043 4:88347789-88347811 GCTCCTTGCCAGGCTGAGCCAGG - Intergenic
977612919 4:99055142-99055164 GCACCTTGGGAGGCTGAAGCAGG + Intronic
977782529 4:100995846-100995868 GCTCCTTGCCAGGCTGAGCCAGG - Intergenic
978149247 4:105414516-105414538 GCTCCCTGCGAGGCTGCAGCTGG + Intronic
978183890 4:105835448-105835470 GCTCCCTGCGAGGCTGCAGCTGG + Intronic
979448115 4:120838988-120839010 GCTCTCTGCCAGGCTGCAGCTGG + Intronic
979646431 4:123075544-123075566 GCACTCTGCGAGGCCGAAGCAGG - Intronic
979882826 4:125984312-125984334 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
980493414 4:133560284-133560306 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
980669323 4:135983647-135983669 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
980714281 4:136611577-136611599 GCTCCTTGCCAGGCTGAATAGGG + Intergenic
981484648 4:145272248-145272270 GCACTCTGGGAGGCTGAAACAGG - Intergenic
981630574 4:146814333-146814355 GCACTCTGGGAGGCTGAAGCAGG + Intronic
981709213 4:147692335-147692357 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
981924659 4:150125641-150125663 GCACTCTGGGAGGCTGAAGCAGG + Intronic
982089680 4:151869491-151869513 GTCTCCTGCCAGGCTTAATCAGG - Intergenic
982244301 4:153334592-153334614 GCACTTTGGGAGGCTGAATCAGG + Intronic
982691518 4:158552936-158552958 GCACACTGGGAGGCTGAAGCAGG + Intronic
982759126 4:159260224-159260246 GCACTCTGGGAGGCTGAAGCAGG - Intronic
984855465 4:184191405-184191427 GCTCCCTGCTTGACTGAATCCGG + Intronic
984979187 4:185261421-185261443 GCACCTTGGCAGGCTGAGGCAGG - Intronic
985021052 4:185691144-185691166 GCACTCTGGGAGGCCGAATCAGG - Intronic
986050280 5:4083831-4083853 GCACCCTGACAGGCTTTTTCTGG + Intergenic
986385191 5:7226389-7226411 ACACCCACCCAGGCTGAAGCTGG - Intergenic
988199001 5:28047281-28047303 GCTCCTTGCCAGGCTGAGCCAGG + Intergenic
988566641 5:32324372-32324394 GCACCTTGGAAGGCTGAAGCAGG - Intergenic
988804810 5:34730428-34730450 GCACTCTGGGAGGCTGAAGCAGG + Intronic
989547171 5:42688257-42688279 GCACCCTGCCGGGCAGACTCAGG + Intronic
990331905 5:54735968-54735990 GCACCATGCAGGGCTGAATGGGG + Intergenic
990516430 5:56534956-56534978 TCACCCTGCCTGCCTGAACCTGG + Intronic
991049538 5:62257903-62257925 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
991302627 5:65144273-65144295 CCATCTTGCCAGGATGAATCAGG + Intergenic
994375882 5:99015371-99015393 TCTCCCCGCCAGGCTGAATCAGG - Intergenic
994388987 5:99167004-99167026 GCCCCCTGGCAGCATGAATCAGG + Intergenic
994755458 5:103789145-103789167 CCACCATGCCCAGCTGAATCTGG + Intergenic
995582386 5:113615549-113615571 GCACCATCCCAGGCACAATCGGG + Intergenic
995912374 5:117203153-117203175 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
996095944 5:119399297-119399319 GCTCCCTGGCAGGCAGAAGCTGG - Intronic
996194934 5:120593429-120593451 ACACCCTCCCAAGCTGAACCAGG + Intronic
997157144 5:131573145-131573167 GCACCTTGCCAGGCTGAATCAGG + Intronic
997366047 5:133325737-133325759 CCACCCTGCCAGGTTGAAGAGGG - Intronic
998275880 5:140753199-140753221 GTACCCTGCCATGCTGCTTCTGG - Intergenic
998713521 5:144852514-144852536 GCACTTTGGCAGGCTGAAGCAGG - Intergenic
999307801 5:150531743-150531765 GCACCCTGGGAGGCTGAGGCAGG - Intronic
999396137 5:151229667-151229689 GCACTCTGGGAGGCTGAAGCAGG - Intronic
999574692 5:152962762-152962784 GCACTTTGGGAGGCTGAATCGGG - Intergenic
1000780350 5:165472763-165472785 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1000864212 5:166492749-166492771 GCACCTTGGGAGGCTGAGTCGGG + Intergenic
1000972259 5:167727356-167727378 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1001244127 5:170093018-170093040 ACATCCTGCCTGGCTGAAGCAGG - Intergenic
1001354607 5:171007422-171007444 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1002131519 5:177085050-177085072 GCACTGTGGGAGGCTGAATCGGG - Intergenic
1002282435 5:178139653-178139675 GCAACTTGCGAGGCTGAAGCAGG - Intronic
1002330331 5:178436393-178436415 GGACCCTGCAAGGCTGCATTGGG + Intronic
1002975793 6:2074748-2074770 GCACTTTGAGAGGCTGAATCAGG - Intronic
1003423389 6:5978182-5978204 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1004064203 6:12227034-12227056 GCACTCTGCGAGGCTGAGGCGGG - Intergenic
1005775950 6:29130744-29130766 GCTCCCTGCAAGGCTGCAGCTGG - Intergenic
1006226541 6:32542617-32542639 GCACTTTGCAAGGCTGAAGCGGG - Intergenic
1006699007 6:35956590-35956612 GCACACTGCCAGGTAGAGTCTGG - Intronic
1006908488 6:37548729-37548751 CCACCATGCCAGGCTGTTTCAGG - Intergenic
1006984764 6:38169133-38169155 GCACCCTGCCCTGCTGACCCTGG + Exonic
1007181424 6:39931933-39931955 GCAACCTGCCAGCCTGCATCTGG - Intronic
1008762637 6:54871470-54871492 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1008911511 6:56738867-56738889 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1009028203 6:58025143-58025165 GCACCCTGCAAAACTGAAACCGG - Intergenic
1009241613 6:61192806-61192828 GCTCCCTGCGAGGCTGCAGCTGG + Intergenic
1009464257 6:63951576-63951598 ACTCCCCACCAGGCTGAATCAGG + Intronic
1009737225 6:67691482-67691504 TCACCTTTCCAGGCTGAACCAGG + Intergenic
1009750125 6:67871363-67871385 ACTCCCCTCCAGGCTGAATCAGG + Intergenic
1009750388 6:67872998-67873020 ACTCCCCTCCAGGCTGAATCAGG - Intergenic
1009844877 6:69122200-69122222 GCACCCTGGGAGGCTGAGACGGG + Intronic
1009846797 6:69145308-69145330 GCTCCCTGCAAGGCTGCAGCTGG + Intronic
1009969617 6:70613220-70613242 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1012864178 6:104597640-104597662 GCATCCTGCCTGGCTGATCCAGG - Intergenic
1013808223 6:114016721-114016743 ACTCCCCGCCAGGCTGAATCAGG - Intergenic
1015732535 6:136363133-136363155 TCATCTTCCCAGGCTGAATCTGG - Intronic
1016390066 6:143565779-143565801 GGAGCCTGCCAAGCTGGATCTGG + Intronic
1016564918 6:145441615-145441637 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1017081631 6:150674927-150674949 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1017494568 6:154972127-154972149 GCACCTTGCCTGGCTAAATAAGG + Intronic
1017774793 6:157672574-157672596 GCTCCCTGCCTGGCTGACTGAGG + Intronic
1018024452 6:159793071-159793093 GCACCTTGGGAGGCTGAATCAGG - Intronic
1018050397 6:160004420-160004442 CCACCATGCCAGGCTGCACCAGG - Intronic
1018819220 6:167360171-167360193 GCACCCTGGGAGGCCGAAGCAGG - Intronic
1018861303 6:167712581-167712603 GCACCTGGCCTGGCAGAATCAGG - Intergenic
1018912050 6:168107036-168107058 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1019073641 6:169369810-169369832 ACACCCTGCCAGCCTCAATACGG - Intergenic
1019813217 7:3180370-3180392 GCAACCTGGGAGGCTGAGTCAGG + Intergenic
1021105480 7:16634417-16634439 GCAGTCTGCCAGGCTCAGTCTGG - Intronic
1021172582 7:17415461-17415483 ACTCCCTGCCAGGCCGAATCAGG + Intergenic
1023419020 7:39959405-39959427 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1025729083 7:64094037-64094059 GCACCGTGGGAGGCTGAAGCGGG + Intronic
1025846782 7:65206300-65206322 GCACTTTGGGAGGCTGAATCGGG + Intergenic
1025897028 7:65712174-65712196 GCACTTTGGGAGGCTGAATCGGG + Intergenic
1025960760 7:66219142-66219164 GCACTCTGGGAGGCTGAAGCGGG - Intronic
1026039525 7:66856030-66856052 GCACTCTGGGAGGCTGAAGCAGG - Intergenic
1026424492 7:70276623-70276645 GCACCTTGGCAGGCTGAGGCAGG - Intronic
1026619865 7:71940856-71940878 GCACCTTGGGAGGCTGAAGCGGG - Intronic
1026818344 7:73529705-73529727 GCACCTTGGGAGGCTGAAGCAGG + Intergenic
1026962956 7:74421032-74421054 GCACTCTGGGAGGCTGAAGCAGG + Intergenic
1026978068 7:74510800-74510822 GCACCCTGAGAGGCTGAGTGGGG + Intronic
1027409958 7:77905742-77905764 GCACTCTGACAGGCTGAGGCGGG - Intronic
1027410994 7:77917657-77917679 TAACCCTGCCAGGCTGCACCTGG + Intronic
1027615733 7:80421785-80421807 GCACTTTGGCAGGCTGAGTCGGG - Intronic
1027661975 7:80998067-80998089 GCAGACTGCCAGGCTCCATCTGG + Intergenic
1028640884 7:93040481-93040503 GCTCCCTGCAAGGCTGCAGCTGG - Intergenic
1028996835 7:97110151-97110173 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1029022325 7:97377894-97377916 GCACAGTGCCAGGCAGAATCAGG - Intergenic
1029354823 7:100044021-100044043 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1030269608 7:107656153-107656175 GCACCCTGGGAGGATGAAGCAGG + Intergenic
1030445864 7:109646156-109646178 GCTCCCCGCCAGGCTGAATCAGG - Intergenic
1032032059 7:128492526-128492548 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1032755312 7:134884777-134884799 ACACCCTCCTAGGCTGTATCAGG + Intronic
1033093153 7:138405304-138405326 GCACCCTGGGAGGCTGAAGTGGG - Intergenic
1033164267 7:139025884-139025906 GCACTCTGGGAGGCTGAAGCAGG + Exonic
1033346961 7:140533235-140533257 GCACTTTGGGAGGCTGAATCGGG - Intronic
1033370533 7:140703519-140703541 GCACTCTGGGAGGCTGAGTCAGG - Intronic
1034188100 7:149194882-149194904 GCACTCTGAGAGGCTGAAGCAGG - Intergenic
1034210306 7:149357503-149357525 GCTCCCTGCAAGGCTGGAGCTGG + Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034635928 7:152567115-152567137 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1034704859 7:153132133-153132155 GCACCATGGCAGGCTGAGGCAGG - Intergenic
1034913439 7:155017181-155017203 GCACTCTGGGAGGCTGAAGCTGG + Intergenic
1035212768 7:157340778-157340800 GCTACCTGGCAGGCTGAAGCAGG - Intronic
1035397597 7:158545464-158545486 GCACCCTTCCAGGATGGATGTGG + Intronic
1036539079 8:9686065-9686087 GCCCCCTGCCACACTGACTCTGG + Intronic
1037770157 8:21794098-21794120 GCACTTTGCCAGGCTGAGGCAGG - Intronic
1038489175 8:27957538-27957560 GTACCCTGGCAGTCTGACTCCGG + Intronic
1039106443 8:33995023-33995045 GCACACTGGCAGGCTGAAGCAGG + Intergenic
1039488398 8:37928760-37928782 GCAACTTGCAAGGCTGAAGCAGG + Intergenic
1039622296 8:39009483-39009505 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1040563729 8:48547254-48547276 GAACCCTGCCATGCTGAAGGAGG + Intergenic
1041745152 8:61200365-61200387 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1041895734 8:62923048-62923070 GCACTTTGCAAGGCTGAAGCAGG + Intronic
1042705997 8:71666064-71666086 GCTCCGTGCCAGGCTGAATCAGG + Intergenic
1043432790 8:80210873-80210895 GCACTCTGGCAGGCTGAGGCAGG + Intronic
1043702749 8:83312209-83312231 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1043908469 8:85833536-85833558 GCACTTTGGGAGGCTGAATCAGG - Intergenic
1044581138 8:93827473-93827495 CCACCCTCCCAGGCTGAGCCTGG - Intergenic
1044894112 8:96870534-96870556 GAACCCTGGCAATCTGAATCTGG - Intronic
1045084824 8:98670975-98670997 TCAGCCTGCCAGGCCGCATCTGG - Intronic
1045217413 8:100162080-100162102 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1045222232 8:100210765-100210787 GCACTCTGGCAGGCTGAGGCAGG - Intronic
1046503647 8:115110865-115110887 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1047943363 8:129848816-129848838 GCACTTTGGCAGGCTGAAGCAGG - Intronic
1048643878 8:136395945-136395967 GAACCCTGCCAGACTGATTCCGG + Intergenic
1049101641 8:140583625-140583647 GCACTCTGAGAGGCTGAAGCAGG + Intronic
1049599494 8:143500441-143500463 GCACACTGCCAGGATGAGGCGGG + Intronic
1051356166 9:16241358-16241380 GCTCCATGCCTGGCTGATTCAGG - Intronic
1052466692 9:28838962-28838984 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1052910288 9:33874912-33874934 GCACCTTGCGAGGCTGAGGCGGG - Intronic
1052921470 9:33974077-33974099 GCTACCTGACAGGCTGAAGCAGG + Intronic
1053134066 9:35638337-35638359 GCTCCCCACCAGGCTGAATCAGG + Intronic
1055059723 9:72056106-72056128 GGAACCTGCCAGGCAGAACCTGG - Exonic
1055479426 9:76695282-76695304 GCACTTTGCAAGGCTGAGTCGGG - Intronic
1055852092 9:80644251-80644273 GCTGCCTGGGAGGCTGAATCTGG - Intergenic
1055987963 9:82072631-82072653 GCACTCTGGCAGGCTGAGGCAGG + Intergenic
1056994337 9:91442658-91442680 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1057255184 9:93540634-93540656 GCACCAGGCCAGGCTCATTCAGG + Intronic
1057510727 9:95677834-95677856 GCTCCCTGCAAGACTGCATCTGG + Intergenic
1058683891 9:107464301-107464323 GCACTTTGGCAGGCTGAAGCAGG + Intergenic
1059144615 9:111887278-111887300 GCACTTTGGGAGGCTGAATCTGG - Intergenic
1059869429 9:118555237-118555259 GCACTTTGGCAGGCTGAAGCAGG + Intergenic
1060804655 9:126567103-126567125 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1061145380 9:128794719-128794741 GCACTTTGCGAGGCTGAAGCGGG - Intronic
1061187429 9:129063111-129063133 CCACACTGCCAGGCTGAGGCAGG + Intronic
1061347738 9:130041081-130041103 GCACCTTGGGAGGCTGAGTCGGG - Intronic
1061445284 9:130634028-130634050 GCACCCTGCCAGGCACAAGAGGG - Intronic
1061909902 9:133716940-133716962 GCACCCTGTGAGGCTGAGCCAGG - Intronic
1062030724 9:134360797-134360819 GCCCCCAGGCAGGCTGAAGCTGG + Intronic
1062328829 9:136026980-136027002 GCACTCTGGGAGGCTGAAGCAGG + Intronic
1062543151 9:137050401-137050423 GCTCCCTGACAGGCTGACCCTGG + Exonic
1062691430 9:137844045-137844067 GCTCCCCGCCAGGCTGAATCAGG + Intronic
1186122490 X:6379034-6379056 GCACTTTGACAGGCTGAGTCAGG + Intergenic
1187537551 X:20156780-20156802 GCACCTTGAGAGGCTGAAGCGGG - Intronic
1188201094 X:27293551-27293573 GCTCCCTGCCAGACTGAATCAGG - Intergenic
1188890960 X:35610756-35610778 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1189031902 X:37459852-37459874 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1190076005 X:47317669-47317691 GCACTCTGGCAGGCTGAGTGGGG - Intergenic
1190338799 X:49280098-49280120 GCGACCTGCCAGGCTGATACGGG + Intronic
1190765410 X:53472169-53472191 GCACTTTGGCAGGCTGAAGCAGG + Intergenic
1191166848 X:57400874-57400896 GCACCCTGAGAGGCTGAGGCGGG + Intronic
1192190804 X:68990131-68990153 GCCGCCTGCCAGGCGGAATGTGG - Intergenic
1192764741 X:74129219-74129241 GCTCCTTGCCAGGCTGAATCAGG - Intergenic
1192789368 X:74366150-74366172 GCACTTTGGCAGGCTGAAGCAGG + Intergenic
1193505869 X:82343415-82343437 GCACTCTGGGAGGCTGAAGCTGG + Intergenic
1194146785 X:90276208-90276230 GCACCTTGGGAGGCTGAAGCAGG - Intergenic
1194310500 X:92300721-92300743 GCACTCTGGGAGGCTGAAGCAGG - Intronic
1195660796 X:107375971-107375993 GCACTGTGGCAGGCTGAAGCAGG - Intergenic
1196571844 X:117274780-117274802 GCACTTTGCCAGGCTGAGGCAGG + Intergenic
1197609445 X:128622539-128622561 GCTCCCTGCAAGGCTGCAGCTGG + Intergenic
1198433543 X:136591816-136591838 GCACCTTGGAAGGCTGAAGCAGG + Intergenic
1199347101 X:146754461-146754483 GCACGCTGCCAGGCTGAAGTAGG - Intergenic
1199873151 X:151914785-151914807 ACCCCCTTCCACGCTGAATCGGG + Intronic
1199873678 X:151916829-151916851 ACCCCCTTCCACGCTGAATCGGG + Intronic
1200002180 X:153067684-153067706 GTACCCTGGCAGGCTGGAGCAGG + Intergenic
1200005553 X:153082341-153082363 GTACCCTGGCAGGCTGGAGCAGG - Intergenic
1200007926 X:153100078-153100100 GCTCCTCGCCAGGCTGAATCGGG - Intergenic
1201307590 Y:12563965-12563987 GCTCCCCACCAGGCTGAATCAGG - Intergenic
1201540757 Y:15102638-15102660 ACTCCCTGCCAGGCTGAATCAGG - Intergenic