ID: 902970593

View in Genome Browser
Species Human (GRCh38)
Location 1:20045302-20045324
Sequence TACTTGCCCCCCTGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 2, 2: 10, 3: 25, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902970583_902970593 25 Left 902970583 1:20045254-20045276 CCAGAGAAAAGAGAGGGTAGAGA 0: 79
1: 161
2: 74
3: 63
4: 475
Right 902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG 0: 1
1: 2
2: 10
3: 25
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902970593 Original CRISPR TACTTGCCCCCCTGGGGAGG TGG Intronic
900942798 1:5811816-5811838 TACTTGCCTCCCACGGAAGGAGG - Intergenic
902275081 1:15333776-15333798 TACCTGCCTCACTGGGTAGGTGG - Intronic
902576716 1:17382581-17382603 TACCTGCCTCCCAGGAGAGGAGG - Intronic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903396191 1:23003505-23003527 TACTTCCCGCCCAGAGGAGGTGG + Intergenic
903396199 1:23003528-23003550 TACTTGCCACCCAGGGTAGGTGG + Intergenic
903396205 1:23003551-23003573 TACTTGCCGCCAAGGAGAGGTGG + Intergenic
905632687 1:39527452-39527474 TCCTTGGGCCCATGGGGAGGTGG - Intergenic
905665129 1:39758965-39758987 TCCTTGGGCCCATGGGGAGGTGG + Exonic
906378550 1:45316765-45316787 TACTTGCCACTCAGGGGAGGTGG - Intergenic
906378559 1:45316788-45316810 TCCTTGCCACCCAGGGGAGGTGG - Intergenic
906704349 1:47883983-47884005 TGCTTGACCCCCAGGGGATGTGG + Intronic
911333786 1:96556420-96556442 CACTTGCCACCCTAGGGAAGAGG - Intergenic
911966721 1:104380991-104381013 TATTTGCCACCCAGAGGAGGTGG - Intergenic
913074692 1:115331928-115331950 TCCTCGCCCCACAGGGGAGGGGG - Intronic
913523294 1:119666624-119666646 TACTTGTTACCCTTGGGAGGGGG - Intronic
916941604 1:169683963-169683985 TGCTTGCCCCCCAGGAGAGGTGG - Intronic
916941612 1:169683986-169684008 TACTTGCCCCCCAGGAGAGGTGG - Intronic
919097934 1:193059566-193059588 TCCTCGCCCCTCTGGGGCGGAGG + Intronic
919624404 1:199897246-199897268 TCCTTGCTCCCCTGAGCAGGTGG - Intergenic
921112938 1:212056104-212056126 TTCTTGAGCCCCTGGGCAGGAGG - Intronic
922169828 1:223144645-223144667 CAGATGCCACCCTGGGGAGGGGG - Intergenic
1063290008 10:4735443-4735465 GGCTTTGCCCCCTGGGGAGGAGG - Intergenic
1069057740 10:63862427-63862449 TATGTGCACCCCTGGGGAAGGGG + Intergenic
1069249876 10:66254987-66255009 GACTTGCCACCCTTGGAAGGGGG - Intronic
1069713593 10:70506708-70506730 TACTTGCCCCTCTGAGCAGCAGG + Intronic
1069728765 10:70598126-70598148 TGCTTGCCCCACCTGGGAGGAGG - Exonic
1070905210 10:80066032-80066054 TGCTTGACCCCCTGGGATGGAGG + Intergenic
1071187060 10:83058283-83058305 TACTTGCCACCAAAGGGAGGTGG - Intergenic
1071522241 10:86338559-86338581 TAACAGCCCCCCAGGGGAGGGGG + Intronic
1073394409 10:103206344-103206366 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073683363 10:105728488-105728510 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1076999510 11:315705-315727 TCCCTGCTCCCCTGGGGTGGGGG + Intergenic
1078518811 11:12047343-12047365 TACTGGCAGCCCTGGGGAAGAGG - Intergenic
1079034053 11:17007116-17007138 TCCATGCCCCCCTGGGCAGCAGG - Intronic
1080188581 11:29520404-29520426 TCCTTGACCCCCTGGGGTGGGGG - Intergenic
1084266324 11:68007178-68007200 TCCTTGCCCTCCTGAGGAAGTGG - Intergenic
1085507648 11:77069347-77069369 TAGTTCCCTCCCTGGGGATGAGG + Intronic
1085627073 11:78081755-78081777 TACTTGCCACCCAGGGGAAGTGG - Intergenic
1085979964 11:81712834-81712856 CACTTGAGCCCCTGGGGCGGAGG + Intergenic
1086070895 11:82797807-82797829 AATTTGCCCCACTGGTGAGGAGG - Intergenic
1086552526 11:88069276-88069298 GCCCTGCCCCCGTGGGGAGGTGG - Intergenic
1086693347 11:89814233-89814255 TGCTTGAACCCCTGGGGTGGAGG + Intergenic
1094809516 12:34123991-34124013 CAATTGCCTCTCTGGGGAGGGGG + Intergenic
1098326858 12:69312281-69312303 TACTACTCTCCCTGGGGAGGTGG + Intergenic
1101642672 12:106599771-106599793 TACTTGTCCCCCTCTGTAGGAGG - Intronic
1101866153 12:108521364-108521386 TCCTTGCCCACCTAGGTAGGCGG - Intronic
1103631601 12:122266151-122266173 TACCTGCACCCCTGTGCAGGAGG - Intronic
1103937630 12:124484949-124484971 TGCTGGCCCCCCCGGGGAGCGGG + Intronic
1105445158 13:20447520-20447542 TACTTGTCAGCCTAGGGAGGGGG - Intronic
1106344857 13:28866102-28866124 TTCGTGCCTCCCTGGGTAGGTGG + Intronic
1106772546 13:32975833-32975855 TAGTTGCCCCACTGGAGAGAAGG + Intergenic
1107403218 13:40089647-40089669 TCCTTGGCCTCCTGAGGAGGAGG + Intergenic
1108168672 13:47718906-47718928 TACATGCACCGCTGGGGAGTTGG - Intergenic
1108543307 13:51465311-51465333 TCCCTGCCCTCATGGGGAGGAGG + Intergenic
1110774614 13:79393775-79393797 TAATGGCCCTCCTGGGCAGGAGG + Intronic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1114553281 14:23546602-23546624 GCCTTGCCAGCCTGGGGAGGAGG + Intronic
1117173997 14:53129601-53129623 TGCTTGCCTCCCAGGGAAGGTGG - Intronic
1118263453 14:64270334-64270356 TACTTCCCTCCCTGCAGAGGTGG - Intronic
1119248569 14:73133200-73133222 TACTTGCCACCCAGGGGAGGAGG + Intergenic
1119248577 14:73133223-73133245 TACTTGCCACCAAGGGGAGGTGG + Intergenic
1121558183 14:94854365-94854387 TTCATGTCCCCCTGGGGAGATGG - Intergenic
1121714690 14:96065210-96065232 TACAGGTGCCCCTGGGGAGGAGG + Intronic
1122156951 14:99755651-99755673 CACTTGCCCTCCTGGGGAACAGG + Intronic
1122301029 14:100731202-100731224 TCCTGGCCCCACTGGGGAGCTGG + Intronic
1122603089 14:102930785-102930807 TCCTTGGCCCCCGGAGGAGGGGG - Exonic
1124899709 15:33810728-33810750 TCCCCGCCCCCCAGGGGAGGAGG - Intronic
1125628973 15:41132249-41132271 GGCTTGCCACCCAGGGGAGGTGG - Intergenic
1125628983 15:41132272-41132294 GGCTTGCCACCCAGGGGAGGTGG - Intergenic
1125628993 15:41132295-41132317 TACTTGCCACCCAGGGGAGGTGG - Intergenic
1128796112 15:70467920-70467942 TACTTGCCCCCTAGGGGATTGGG - Intergenic
1130516683 15:84631219-84631241 GTCTTGCCTCCCAGGGGAGGTGG - Intergenic
1133749570 16:8713917-8713939 TATTTGCTGCCATGGGGAGGTGG + Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1136540548 16:30925611-30925633 TCCTTGTCCCCCTGAGGAAGAGG + Intronic
1136927494 16:34388552-34388574 TCCTTGCCCACCGGCGGAGGTGG + Intergenic
1136977080 16:35023254-35023276 TCCTTGCCCACCGGCGGAGGTGG - Exonic
1137055543 16:35744828-35744850 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1137496246 16:48971530-48971552 GTCTTCTCCCCCTGGGGAGGGGG - Intergenic
1138427453 16:56945558-56945580 TGCTTGCCCCAGTGGGGATGGGG - Intergenic
1139356415 16:66369427-66369449 TAGCTGCCTCCCTGGGCAGGAGG - Intronic
1139823987 16:69742570-69742592 TATTTGCCCCCTTTGGGAGTGGG + Exonic
1140506761 16:75478499-75478521 TCCTTGCCTACTTGGGGAGGGGG + Exonic
1141161871 16:81634612-81634634 TCCTGCCCTCCCTGGGGAGGCGG - Intronic
1141820150 16:86440216-86440238 TCCCTGCTCACCTGGGGAGGGGG - Intergenic
1145902526 17:28497904-28497926 TACCTTCCCCCCTGGGTGGGAGG - Intronic
1146263824 17:31438187-31438209 TAGGGGCCCCCGTGGGGAGGGGG + Intronic
1147919918 17:43909609-43909631 TTCTGGCCCACCTGGGGAGGTGG + Exonic
1149517535 17:57292038-57292060 CACTAGCCCTCCTGAGGAGGGGG - Intronic
1150860660 17:68797156-68797178 TACTTGCCACCCAGAGGAGGTGG + Intergenic
1158543558 18:58377642-58377664 TACCTGCCCCCACCGGGAGGAGG + Intronic
1160445610 18:78924989-78925011 TCCTTTCCACCCTGGGGAGGGGG + Intergenic
1162082819 19:8228938-8228960 CACTTGAACCCCTGGGGCGGAGG + Intronic
1163775397 19:19214363-19214385 CTCTGGCCGCCCTGGGGAGGAGG + Intronic
1164080630 19:21858901-21858923 TACTTGCCACCAAGGGGAGGTGG - Intergenic
1165130562 19:33629399-33629421 GACTGGCTCCCTTGGGGAGGAGG - Intronic
1165392500 19:35546544-35546566 TTCTTTCCCACCTGGGAAGGCGG + Exonic
1165435583 19:35793027-35793049 AACTTGGGCCCCTGGGGATGGGG + Intergenic
1166717284 19:44976665-44976687 TCCTTGCCTCCCAGGGAAGGGGG - Intronic
1166837892 19:45678269-45678291 TTCGTGCCCCTCTGGGGAGGAGG - Intronic
1166905965 19:46108619-46108641 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1166905973 19:46108642-46108664 TGCTTGCCACCCAGGGGAGGTGG + Intergenic
1166917041 19:46202528-46202550 TACTTGCCATCCAGGGGAGGTGG + Intergenic
1168241865 19:55092653-55092675 TACCTGCCCACAGGGGGAGGAGG - Exonic
1168504208 19:56919608-56919630 AAGTGGCACCCCTGGGGAGGCGG + Intergenic
926717408 2:15935847-15935869 TACTGGCCAGCCTGGGGAGTGGG - Intergenic
926913049 2:17869301-17869323 TACTCGCAGCCCTGGGGTGGAGG + Intergenic
928253981 2:29706188-29706210 TAATTGCCCCTTTGGGCAGGTGG + Intronic
928329346 2:30345956-30345978 CACTTGAACCCCCGGGGAGGCGG + Intergenic
929383325 2:41378720-41378742 TACTTGCTACCCAGAGGAGGTGG - Intergenic
930099291 2:47590592-47590614 TACTTGCCACCCAGGGGAGGTGG + Intergenic
930900415 2:56500160-56500182 TACTTACCTCTCTGGGGAGTGGG + Intergenic
931078813 2:58745900-58745922 AACTTGCTCCCCTTGGTAGGTGG - Intergenic
931265226 2:60654319-60654341 TATTTGCCTTCCTTGGGAGGAGG - Intergenic
931510460 2:62986391-62986413 TTTTTGCCCCCCTGGTGTGGGGG + Intronic
932369829 2:71177743-71177765 TCCTGGCTGCCCTGGGGAGGAGG + Intergenic
934104184 2:88680912-88680934 TAATGGCCCTCCTGGGCAGGAGG + Intergenic
934554669 2:95281078-95281100 GACTTGGCCTCCTGGAGAGGAGG - Intronic
934849868 2:97691335-97691357 TCCTTCCCCCGCTGGGGTGGTGG + Intergenic
935207486 2:100909084-100909106 TTCTGGTCCCCCTGGGGTGGAGG + Intronic
937999210 2:127719392-127719414 TGCATGCCACCCTGGGGTGGAGG + Exonic
938802538 2:134776192-134776214 TACTCGCCCCCTTGGCCAGGTGG - Intergenic
939273670 2:139971546-139971568 AAGTTGCCACCCTGGAGAGGAGG + Intergenic
939317119 2:140566203-140566225 TGCTTGACCCCCTGGCGAAGGGG - Intronic
941957266 2:171217486-171217508 TCCTTGCCCCCCTCTGGTGGAGG + Intronic
943188631 2:184647159-184647181 TAGTTGCACCCCTAGGAAGGAGG + Intronic
943778551 2:191795107-191795129 TCCTTGCCACCATGGGGAGAAGG - Intergenic
944836018 2:203580576-203580598 CACTTGAACCCCTGGGGCGGAGG + Intergenic
945857956 2:215090731-215090753 TACTTGTCACCCAGGGGAAGTGG - Intronic
946162036 2:217841294-217841316 TGCTGGCTCCCCTGGGGTGGGGG - Intronic
946994564 2:225376612-225376634 TACTTGCATCCCTGGGCTGGAGG + Intergenic
947662880 2:231882868-231882890 CACCTTTCCCCCTGGGGAGGCGG - Intergenic
948863947 2:240766074-240766096 TCCTTGTCCACCTGGGGAGCTGG - Intronic
948867735 2:240784036-240784058 CCCGTGCTCCCCTGGGGAGGTGG - Intronic
1168951277 20:1803601-1803623 TTCTTCCCCACCTGGGGAGCGGG + Intergenic
1168962206 20:1877279-1877301 TACTTTCTCACGTGGGGAGGTGG - Intergenic
1169142725 20:3235385-3235407 CACCTGCCCTCCTGGGGAGGCGG - Intronic
1170012488 20:11741192-11741214 TTTTTGCCCAGCTGGGGAGGAGG - Intergenic
1173174594 20:40754787-40754809 TCCTGGCCCTGCTGGGGAGGGGG - Intergenic
1175252136 20:57616220-57616242 TAACTGCCACCCCGGGGAGGCGG - Intronic
1175309753 20:58003542-58003564 TACCTGGCCCCTTCGGGAGGTGG + Intergenic
1179256047 21:39716138-39716160 TAGTTGCACCACTGCGGAGGAGG + Intergenic
1180918405 22:19505568-19505590 TGCTTTCCCTCCTGGGGATGTGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181604266 22:23970926-23970948 AGCTTGCAACCCTGGGGAGGAGG + Intronic
1181727486 22:24821514-24821536 TGAATGTCCCCCTGGGGAGGTGG + Intronic
1182430573 22:30296441-30296463 TACATGCCTCCCTGTGCAGGTGG + Intronic
1182701607 22:32244344-32244366 TACTCGCCCCTCTGTGGATGAGG - Intronic
1182782400 22:32878551-32878573 TGCTTGGCCCCCTGGGGTAGTGG - Intronic
1182828601 22:33286311-33286333 TACCTTTCCCCCTGGAGAGGTGG + Intronic
1183307669 22:37091425-37091447 TGCTGGGCCCCCAGGGGAGGGGG + Intronic
1183942391 22:41302714-41302736 TATTTTCCCCCCTGGGAAGACGG - Intronic
1183952122 22:41357842-41357864 GATTTGCCCCCAGGGGGAGGGGG - Exonic
1184519186 22:44982381-44982403 TACGTGCAACCCTGGGGAGCTGG + Intronic
1184720460 22:46309556-46309578 TACGTGCTGCCCAGGGGAGGGGG - Intronic
949560565 3:5198129-5198151 TGCTTGAACCCCTGGGAAGGTGG - Intronic
952773812 3:37025654-37025676 TGCTGGCCCCTCTGGGGAGATGG + Exonic
952791860 3:37206520-37206542 TACTTGCCCCCCTAGGAAAATGG - Intergenic
953565660 3:44029648-44029670 CACTTGGCCCCCTGAGTAGGAGG + Intergenic
954161970 3:48729310-48729332 TACTTGCCACCCAGAGGAGGTGG + Intronic
955730895 3:61985273-61985295 TAAGTTCCCTCCTGGGGAGGTGG + Intronic
961343840 3:126248197-126248219 TACTTGCCACCCAGGGGAGGTGG - Intergenic
961578409 3:127857404-127857426 GACTTGCCCCTCTGGTGGGGTGG + Intergenic
961878467 3:130042646-130042668 GACTTGGCGCCCTGGGGATGGGG + Intergenic
963043132 3:141083576-141083598 GACTTGCCCGCCGGGGGATGTGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
963128081 3:141833648-141833670 TACTTGAGCCCCTGAGGTGGAGG - Intergenic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
972265426 4:37454530-37454552 TATTTGCCCCCCAGGGGTGCTGG + Intronic
973003998 4:44987475-44987497 TAATGGCCCTCCTGGGCAGGAGG + Intergenic
974106753 4:57478178-57478200 TCCTTTCCAGCCTGGGGAGGGGG + Intergenic
980454473 4:133021197-133021219 TCCTTGCTCCCCAGGGGATGGGG - Intergenic
982318628 4:154057400-154057422 TACTTGCCACCAAGGGGAGGTGG - Intergenic
982318636 4:154057423-154057445 TACTTGCCACCCACAGGAGGTGG - Intergenic
987083591 5:14448329-14448351 TCCTTGCCTGCCTGGGGCGGGGG + Intronic
987152426 5:15056434-15056456 CACATTACCCCCTGGGGAGGTGG - Intergenic
989066866 5:37472291-37472313 TACTTGCCTCTATGGGAAGGAGG - Intronic
989659765 5:43787284-43787306 TACTTGCCCCCCAGGGAAGGTGG - Intergenic
996144657 5:119959359-119959381 TGCTTGAGCCCGTGGGGAGGAGG - Intergenic
999627308 5:153534327-153534349 TAAATGCCCCTCTGGGGAGAAGG + Intronic
1001591583 5:172869180-172869202 GATCTTCCCCCCTGGGGAGGAGG + Intronic
1007415126 6:41687215-41687237 TACTTCTCCCCATGGGGTGGGGG - Intronic
1007415826 6:41690750-41690772 AGCTCGCACCCCTGGGGAGGCGG + Exonic
1007620744 6:43213043-43213065 TACTAGTCCCTATGGGGAGGAGG - Intronic
1008520171 6:52355676-52355698 TATTTGCACCCCTGGGGACAAGG - Intergenic
1009273595 6:61646901-61646923 TACTTGAACCCCGGAGGAGGAGG - Intergenic
1010033011 6:71289212-71289234 CACTTGCCCCTCTGGGGTGTCGG - Intronic
1010940871 6:81916191-81916213 TTCCTGTTCCCCTGGGGAGGGGG - Intergenic
1011117079 6:83905744-83905766 TTCTTGGGCCCCTGGGCAGGTGG + Intronic
1013246191 6:108289690-108289712 TCCTTTCCTCCCTAGGGAGGTGG + Intergenic
1013904164 6:115195579-115195601 TACTTGCCCCCTTGAGCAGGAGG - Intergenic
1015780637 6:136862148-136862170 TACTTGAACCCCAGGGGTGGAGG - Intronic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1019226723 6:170517317-170517339 CAGTTGCACCCCTAGGGAGGGGG + Intergenic
1023742796 7:43295525-43295547 TCCAGGCCCCCCTGGGGAGTGGG - Intronic
1024524978 7:50340328-50340350 TACTTCCCCCACAGGGGATGTGG + Intronic
1024582625 7:50812432-50812454 AACTTGCCCCCTTAGGGAGATGG + Intergenic
1027238698 7:76313504-76313526 TACTTGAACCCATTGGGAGGAGG - Intergenic
1029316912 7:99723996-99724018 TACTTGTGACCCAGGGGAGGTGG - Intronic
1029316926 7:99724042-99724064 TGCTTGCCACCCAGGGAAGGTGG - Intronic
1029316933 7:99724065-99724087 TACTTGCCACCCAGGGAAGGTGG - Intronic
1033273601 7:139955097-139955119 TAGTTTCCTCCCTGGGAAGGAGG - Intronic
1034116839 7:148591003-148591025 GCCTTGCCCCACTGGGCAGGAGG - Exonic
1035519523 8:266037-266059 TCAGTGTCCCCCTGGGGAGGGGG + Intergenic
1035519549 8:266102-266124 TCCGTGCCCACCTGAGGAGGGGG + Intergenic
1035519676 8:266430-266452 TCAGTGCCCACCTGGGGAGGGGG + Intergenic
1039499165 8:38003251-38003273 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1039550482 8:38439648-38439670 TATTGGCTCCACTGGGGAGGTGG - Intronic
1039612376 8:38930084-38930106 TATTTTCCCCCCTGGGGAGCTGG + Intronic
1047833992 8:128667984-128668006 TAGATGCCACCCTGGGGAGAAGG - Intergenic
1049673649 8:143880333-143880355 GACTGGAGCCCCTGGGGAGGTGG - Intergenic
1050140307 9:2510562-2510584 TAGTTGCCACCAGGGGGAGGTGG - Intergenic
1053285748 9:36848566-36848588 TACTCCCCCACCTGAGGAGGAGG - Intronic
1056789103 9:89614052-89614074 TACTTCACCTCCAGGGGAGGTGG + Intergenic
1057391322 9:94643504-94643526 TACTTTCCCCTCTGTGGGGGCGG + Intergenic
1060722738 9:125989487-125989509 TACTTTCTCCCCTGAGGAGCGGG + Intergenic
1060920098 9:127414442-127414464 TACTTGCCACCCCGGTGGGGGGG - Intergenic
1060920108 9:127414465-127414487 CACTTGCCACCCAGGGGAGGTGG - Intergenic
1060932557 9:127498010-127498032 TGCCTGCCTCCCTGGGGAAGAGG + Intronic
1061433202 9:130544288-130544310 TGCTTTCCCCCTTGGGGAGGGGG + Intergenic
1062466149 9:136682499-136682521 TCCTTGCCTCCCCGGGGAGCAGG + Intronic
1187157692 X:16736442-16736464 TGCTGGCCCCACTGGGGAGCTGG + Intronic
1188201175 X:27294066-27294088 TACTTGCCACCCAGAGGAGGTGG + Intergenic
1189260334 X:39674090-39674112 CCCTTGCCCACCTGGGCAGGAGG + Intergenic
1191718379 X:64208592-64208614 CCCTTGCCACCCTGGGGAGAAGG - Intergenic
1192454421 X:71265346-71265368 TACTTGCCACCCAGGGGAGGTGG - Intergenic
1196541287 X:116911518-116911540 TACTCACCACCCTGGGGAGTAGG - Intergenic
1197765394 X:130056732-130056754 TTTTTCCCCCACTGGGGAGGGGG + Exonic
1198228528 X:134668855-134668877 TACTTGCTCACTGGGGGAGGTGG - Intronic
1201540836 Y:15103161-15103183 TACTTGCCATCCAGGGGAGATGG + Intergenic
1201540843 Y:15103184-15103206 TGCTTGCCACCCAGGGGAGGTGG + Intergenic