ID: 902973101

View in Genome Browser
Species Human (GRCh38)
Location 1:20069566-20069588
Sequence TGGGAGGATCGCTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902973097_902973101 -6 Left 902973097 1:20069549-20069571 CCTGTGGTCCCAGCTACTGGGAG 0: 25
1: 349
2: 3142
3: 22363
4: 146369
Right 902973101 1:20069566-20069588 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889
902973093_902973101 15 Left 902973093 1:20069528-20069550 CCAGGCATGGGGTGGCATGTGCC 0: 2
1: 2
2: 14
3: 65
4: 353
Right 902973101 1:20069566-20069588 TGGGAGGATCGCTGAAGCCCAGG 0: 9
1: 362
2: 5645
3: 30290
4: 65889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902973101 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG Intronic
Too many off-targets to display for this crispr