ID: 902973512

View in Genome Browser
Species Human (GRCh38)
Location 1:20072148-20072170
Sequence GTGTGTTTGGGGATGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 29, 3: 133, 4: 886}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902973512 Original CRISPR GTGTGTTTGGGGATGGGGAC GGG (reversed) Intronic
900030229 1:366118-366140 GTGTCTTTGGGGATGATGACTGG + Intergenic
900050881 1:595182-595204 GTGTCTTTGGGGATGATGACTGG + Intergenic
900141505 1:1141103-1141125 GTGGGGATGGGGTTGGGGACGGG - Intergenic
900155778 1:1202786-1202808 CTGGGCTTGGGGATGGGTACTGG - Intergenic
900162256 1:1229596-1229618 AGGTGTTGGGCGATGGGGACAGG - Intronic
900165790 1:1243837-1243859 GTGGGTTGGGGGCTGGGGGCGGG - Intronic
900204614 1:1426722-1426744 GTGTGTTTGGGGAGGGGCTGGGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901592189 1:10353800-10353822 GTATGTCTGGGGAGGGGGAGTGG + Intronic
901627076 1:10630473-10630495 GTGGGGTTGGGGCTGGGGACAGG - Exonic
901842165 1:11960623-11960645 CTGGGGTTGGGGATGGGGAAGGG - Intronic
902918922 1:19655215-19655237 GTGGGTGGGGGGATGCGGACAGG + Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903236971 1:21956545-21956567 CTGTGCTTGGGGTTGGGGAAGGG - Intergenic
903674013 1:25053191-25053213 GTGTGTGTGGGGATGGGGGTGGG - Intergenic
903677158 1:25071653-25071675 GGGTGTGTGGGGCTGGGGTCGGG - Intergenic
904440794 1:30528378-30528400 CAGTGATTGGGAATGGGGACAGG - Intergenic
905068267 1:35202586-35202608 TTGTGTTGGGGGATGGGGAGAGG + Intergenic
905267657 1:36765853-36765875 GTGTGTTTGGGAATGGGAAACGG + Intergenic
905763287 1:40578965-40578987 GCCTGTTTGGGGGTGGGGGCTGG + Intergenic
905890912 1:41517820-41517842 GTGTGTACGGGGATGGGGCTGGG + Intronic
905973956 1:42162294-42162316 GTGTGGTTTGGGATGTGGTCAGG + Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906112852 1:43336149-43336171 GTGTGGGTGGAGGTGGGGACAGG - Intergenic
906178229 1:43794966-43794988 GTATGTTGAGGGATGGGTACAGG + Intronic
906206727 1:43991180-43991202 GTCTGTTTGGGGGTGGGGGTCGG + Intergenic
906510133 1:46405974-46405996 GTGGGTGTGGGGATGGCGGCGGG + Intronic
906540506 1:46582172-46582194 GTGTGTCAGGGTATGGGGATGGG - Intronic
906573966 1:46870920-46870942 GCCTGTTGGGGGATGGGGGCTGG + Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906815177 1:48871399-48871421 GTGCGTTTGGGGTCGGGGAGAGG + Intronic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907537341 1:55176324-55176346 GTGTGTGTCGGGGTGGGGGCAGG - Intronic
907853713 1:58281041-58281063 GTGTGTTTGGGGAGAAAGACAGG + Intronic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
909995351 1:82271951-82271973 GTTTGTTTTGAGATGGGGTCTGG - Intergenic
910158061 1:84242772-84242794 GCGTGTTTGGGGAGGGAGAGTGG - Intergenic
910273004 1:85417417-85417439 GTGATATTGGGGATGGAGACTGG - Intronic
910288416 1:85578242-85578264 GTGTGTTGTGGGATGGGGGTGGG - Intronic
910366837 1:86474970-86474992 GTGTGTTTGGGGATGGGGCTTGG - Intronic
910631971 1:89364649-89364671 GTGTGTGTGGGGAGGGGGTGGGG + Intronic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
911073994 1:93855336-93855358 GTGGGTTTGGGGATGGGGGATGG + Intergenic
911133970 1:94419014-94419036 GTGTGATTGAGGATGGGGATTGG + Intronic
911199628 1:95031657-95031679 GTGTACGTGGGGATGGGGAGAGG - Intronic
911293451 1:96084764-96084786 ATTTGTCTGGGGATGGGGACAGG - Intergenic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912574563 1:110655352-110655374 CTGGGTTTGGGGGTGGGGATGGG - Intergenic
913686741 1:121239375-121239397 GAGTGTTTGGGCATTGGGATGGG + Intronic
914038595 1:144026961-144026983 GAGTGTTTGGGCATTGGGATGGG + Intergenic
914150860 1:145040968-145040990 GAGTGTTTGGGCATTGGGATGGG - Intronic
915310672 1:155004437-155004459 GTGAGTGTGGGGATGAGGCCTGG + Intronic
915429718 1:155856992-155857014 GTCTAGTTGGGAATGGGGACTGG - Intronic
915530089 1:156498353-156498375 TTGTGTTGGGGGATGGGCATGGG - Intronic
915913211 1:159927146-159927168 GTGAGTCTGGGGATTGGAACAGG - Exonic
916313995 1:163427387-163427409 GTGTGGGAGGGGCTGGGGACAGG + Intergenic
916741441 1:167650301-167650323 GTGTGTGTTGGGGTGGGGGCAGG + Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917443152 1:175084358-175084380 TTGTGTTGGGGGATGTGGAGGGG + Intronic
917451588 1:175151803-175151825 GTGTGTGAGGAGATGTGGACAGG + Intergenic
917452189 1:175156406-175156428 GAGTGTGTGGTGATGGGGAAGGG + Intergenic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
918339441 1:183555911-183555933 GTGGGTGAGGAGATGGGGACAGG - Exonic
918401413 1:184165958-184165980 GTTTGTTTGTGGAGGGGGAAGGG + Intergenic
918899907 1:190401358-190401380 TTTTGTTTTGAGATGGGGACTGG - Intronic
919695388 1:200569472-200569494 GGGAGCTTGGGGATGGAGACAGG - Intronic
919946191 1:202320506-202320528 GTGTGTTTGGGGCTGGGTGAGGG - Intergenic
920047105 1:203140426-203140448 CTGTTTCTGGGGATGGGGAAGGG + Intronic
920125465 1:203690885-203690907 CTGTGGTGGGGGATGGGGAGGGG - Intronic
920176887 1:204107644-204107666 CTGTGCTTGGGGAGGGGGAGAGG + Intronic
920474066 1:206257842-206257864 GAGTGTTTGGGCATTGGGATGGG + Intronic
920572122 1:207025068-207025090 TTGGGTTTGGGGTTGGGGGCGGG + Intronic
920607061 1:207399058-207399080 GTGGGGTTGGGGGTGGGGGCTGG + Intergenic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
920820834 1:209379191-209379213 GTGTGGTTGGGGATGTGGAGGGG + Intergenic
921058146 1:211560095-211560117 GAGTGTATGTGGATGGGGATGGG - Intergenic
921249228 1:213281023-213281045 GTGTGTGTGTGGGTGGGGAGGGG - Intergenic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
923910745 1:238440504-238440526 GTGTGTGTGGCGTTGGGGGCTGG + Intergenic
1062810384 10:459193-459215 GTCTGTTTGGGGGTGGGGGAGGG - Intronic
1063251039 10:4275035-4275057 GTCTGTTGGGGGATGGGGGGAGG + Intergenic
1063987125 10:11516669-11516691 TTTTATTTGGGGGTGGGGACAGG - Intronic
1064147301 10:12835740-12835762 GTGCCTTTGGGGTTGGGGACAGG + Intergenic
1064232453 10:13541202-13541224 CAGTGTTTGCGGATGGGGAGAGG + Intergenic
1065000608 10:21334631-21334653 GTGTCTCTGGGGCTGGGGGCTGG - Intergenic
1065164999 10:22966986-22967008 GTGTGTTTGGGGGCGGGGGTGGG + Intronic
1065367849 10:24952654-24952676 GTGGGGATGGGGACGGGGACGGG + Intergenic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067477761 10:46578002-46578024 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
1067974703 10:51011199-51011221 GTGTGTGTGTGGGTGGGGAGGGG + Intronic
1068197154 10:53731675-53731697 GCCTGTTGGGGGATGGGGGCGGG + Intergenic
1068981348 10:63065826-63065848 TTGAGTTTGGGGATGGGGGGAGG - Intergenic
1069232531 10:66029336-66029358 ATGTGATTGGGGCTGGGGATTGG - Intronic
1069238026 10:66102731-66102753 GTGTGTTTGGGGGCAGGCACAGG + Intronic
1069542816 10:69308228-69308250 GTGTGTGTGGGGATGGTTTCGGG + Intronic
1069720178 10:70544774-70544796 TTGGGATTGGGGATGTGGACTGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069915204 10:71782933-71782955 GAGTGTTAGGAGCTGGGGACAGG + Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070342089 10:75507000-75507022 GCGTGTTTGGGGATGTGGGTGGG + Intronic
1070456071 10:76618892-76618914 GTAGGTTAGGGGATGGGGAGAGG + Intergenic
1070695812 10:78562269-78562291 GTGTGTTTGCTGAGGGGGATGGG - Intergenic
1070810051 10:79293138-79293160 GGGTGTTAGGGGATGGGGTGGGG - Intronic
1071104631 10:82080147-82080169 GGATGTATGAGGATGGGGACTGG - Intronic
1071220331 10:83458482-83458504 GTGTGTTTGTGGGTGTGGACAGG - Intergenic
1071479780 10:86056533-86056555 AAGGGTTTGGGAATGGGGACAGG - Intronic
1071517731 10:86310190-86310212 CTGGGCTTGGGGATGGGGCCAGG - Intronic
1071559266 10:86632533-86632555 GTGTGTGGGGGGATGGGGAATGG - Intergenic
1072671777 10:97435421-97435443 GTAAGTTTGGGGATGAGGAAGGG - Intergenic
1073144818 10:101273594-101273616 GTGTGTGTGTGGTTGGGGAGTGG - Intergenic
1073207603 10:101776841-101776863 GTGTGTGTGGTGAGGGGCACAGG - Intronic
1073434468 10:103507889-103507911 GTGTGTGTGTGGCTGGGAACTGG - Intronic
1073539146 10:104304149-104304171 GTGTGGTGGGGGATGGGAACTGG - Intronic
1073694785 10:105852483-105852505 GTCTGTTGGGGGGTGGGGACTGG + Intergenic
1073750095 10:106515564-106515586 GTTTGTTCTGGAATGGGGACGGG - Intergenic
1074107414 10:110398828-110398850 GTGTGTTGGGGGGTGGGGTAAGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1074768275 10:116716440-116716462 GTGTGTTGGGGGGTGGGGTGGGG + Intronic
1075223603 10:120605126-120605148 GGGTGTTTGGGGATGGAGGGTGG + Intergenic
1075382958 10:122033740-122033762 GTGTGTTTAGGGGTGTGGTCAGG + Intronic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1075945406 10:126428691-126428713 GTGGCTTTGGGTTTGGGGACTGG + Intronic
1076117172 10:127908428-127908450 GTGTGTATGTGGGTGGGGAGGGG + Intronic
1076405186 10:130207125-130207147 GTGTGTGTGTGGGGGGGGACAGG - Intergenic
1076450286 10:130552381-130552403 GGGTCTTTTGGGATGGTGACAGG - Intergenic
1076864963 10:133161978-133162000 GTGTGCGTGGGGGTGGGGAGCGG - Intronic
1077534174 11:3111670-3111692 TTGTGTGTGGGGGTGGGGAGGGG - Intronic
1077555905 11:3225939-3225961 GTCTGCGTGGGGATGGGGCCAGG + Intergenic
1077957959 11:7041332-7041354 GTAGGATTGGGGATGGGGAGTGG - Intronic
1078090021 11:8259314-8259336 GTGTGTGTGGGGTTGGGGGGCGG + Intronic
1078147183 11:8730112-8730134 GTGCGCTTGGGTTTGGGGACAGG + Exonic
1078653882 11:13220439-13220461 CTATGTTTGGGGGTGGGGAAAGG - Intergenic
1078955733 11:16192644-16192666 GTGGCTTTGGGCCTGGGGACAGG - Intronic
1079016111 11:16870288-16870310 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079027593 11:16961198-16961220 CTGGGACTGGGGATGGGGACAGG - Intronic
1079036425 11:17024232-17024254 GTGTTTTGGGGTATGGGGAGAGG - Intergenic
1079430904 11:20387701-20387723 GCGTGTCTGGGGGCGGGGACCGG - Exonic
1079598587 11:22284539-22284561 GTGTTTTGGGGGATGGGGGTGGG + Intergenic
1081047425 11:38294328-38294350 GTTTGTATGGAGATGGGGAGAGG - Intergenic
1081600223 11:44487792-44487814 GTGTGGATGGAGATGGGGACTGG - Intergenic
1081614554 11:44582959-44582981 GTATGTTGGGGGATAGGGAGGGG - Intronic
1081673352 11:44954182-44954204 GTGGGGTTGGGGATGGAGCCAGG + Intergenic
1081700646 11:45150480-45150502 GTGTGCTGAGGGCTGGGGACAGG + Intronic
1082020144 11:47525906-47525928 GTTTGTTTGTGGATAGAGACGGG - Intronic
1082059388 11:47847635-47847657 GTGTGTGTGGGGGTGGGGGGGGG + Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082279637 11:50257923-50257945 GTGTGATGTGGGGTGGGGACAGG - Intergenic
1082852321 11:57776309-57776331 GAGTGTTTGGGGGTGGGGGTTGG + Intronic
1083007212 11:59357949-59357971 GTTTATTTGGGGGTGGGGAGAGG - Intergenic
1083161333 11:60856003-60856025 GTGTGTTTAGGGGTGGGGTTGGG + Intergenic
1083614337 11:64018909-64018931 GTGAGGTGGGGGATGGGCACTGG + Intronic
1083627938 11:64081533-64081555 GTGTGGTTTGCGATGGGGTCGGG - Intronic
1083749539 11:64753732-64753754 GGGGGTGTGGGGCTGGGGACTGG - Intronic
1084021252 11:66419692-66419714 GTGTGTGGGGGGGTGGGGATAGG + Intergenic
1084603679 11:70160792-70160814 CTGTGCTTGGGGATGGTGCCTGG + Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1084943965 11:72629049-72629071 ATGAGTGTGGGGATGGGGTCAGG + Intronic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085662370 11:78380766-78380788 GGGGGTTTGGGGGTGGGGAATGG - Intronic
1085881431 11:80471667-80471689 GTGTGTGTGGAGATGGGGGGGGG + Intergenic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1087183390 11:95160822-95160844 GTGTGTTGGGGGCGGGGGATGGG - Intergenic
1087308219 11:96508322-96508344 GTGTGTTTGGGGGTGGGGGTGGG + Intergenic
1088238018 11:107745707-107745729 GTGGGTATGGGGGTGGGGAATGG + Intergenic
1088251300 11:107863142-107863164 GAGTGGTTGGGGATGGGGCGGGG + Intronic
1088884276 11:113994763-113994785 GTGTGTGATGGGGTGGGGACTGG - Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089307585 11:117536294-117536316 CGCTGTTTGGGGATGGAGACGGG + Intronic
1089478903 11:118790247-118790269 GTGTGTTTGGGGCGTGGGGCGGG - Intronic
1089490494 11:118880433-118880455 GTGTGCCTGGAGAGGGGGACAGG - Intergenic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089743344 11:120600124-120600146 GTGTGTTTGGGGAAAGGGAAAGG + Intronic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1090717421 11:129442587-129442609 GAATGTTTCAGGATGGGGACTGG + Intronic
1090719418 11:129458390-129458412 GTGAATTTGGGGGTGGGGCCAGG + Intergenic
1090946465 11:131433939-131433961 GTGGGGTTGGGGATAGGGAGAGG - Intronic
1091266074 11:134271986-134272008 TTGTTTGTGGGGATGGGGAGGGG - Intergenic
1091941153 12:4483709-4483731 ATGTGTGTGGTGATGGGGATGGG - Intergenic
1092004985 12:5061571-5061593 GTGTGTATGGGCATGGGGAGAGG + Intergenic
1092071753 12:5636997-5637019 GTGTGTGTGGGTGTGGGGAGAGG + Intronic
1092282807 12:7110179-7110201 TTGTGTTTGGGGTTGGGGTGTGG - Intergenic
1092292987 12:7175358-7175380 GGAAGTCTGGGGATGGGGACAGG - Intergenic
1092666272 12:10802669-10802691 GTCTGTTTTGTGATGGAGACTGG + Intergenic
1092965095 12:13633828-13633850 GTGGGTTTGGGGGTGGGTGCTGG - Intronic
1092994312 12:13933811-13933833 GCCTGGTTTGGGATGGGGACAGG + Intronic
1093081903 12:14821996-14822018 GTGTGTGTGGGGGTGGGGTGGGG + Intronic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093980454 12:25469827-25469849 GGGTGTTTGTGGTTGGGGATAGG + Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094432841 12:30388824-30388846 GTGTGTGTGGGTGTGGGGGCAGG + Intergenic
1095085797 12:38056531-38056553 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1095591861 12:43912346-43912368 GTGGGGTGGGGGAAGGGGACAGG + Intronic
1095965392 12:47863973-47863995 GAGTGGTTGGGGATGGGGAGAGG - Intronic
1096059140 12:48681835-48681857 GTGTGGTTCGGGGTGGGGCCGGG - Intronic
1096770909 12:53935448-53935470 GTGAGTTTAGGGATGGGTGCAGG - Intergenic
1097012502 12:55963251-55963273 CAGAGATTGGGGATGGGGACAGG + Intronic
1097107119 12:56632480-56632502 GTGTGTGTGGGTGTGGGGAGGGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1097322363 12:58240402-58240424 GTGTGTGTGGGGATAGGGGTTGG + Intergenic
1097334815 12:58370272-58370294 GTGAGTAAGGGGATGGAGACAGG + Intergenic
1098302529 12:69068896-69068918 GAGTGTTGGGGGGTGGGGAGGGG - Intergenic
1098396945 12:70029048-70029070 ATGTGTTTGGGGATGGGGTTAGG + Intergenic
1098434784 12:70457123-70457145 GTGTGTTTGGGGGTGGGAGTAGG + Intergenic
1098819266 12:75208369-75208391 GTGTGTTTGGGGAGGCAGAGAGG - Intronic
1098985030 12:77002865-77002887 ATGTGTTTGAGGCTGGGGATGGG - Intergenic
1099259791 12:80363518-80363540 ATGTGTTGGGGGTTGGGGAGTGG + Intronic
1099338641 12:81398103-81398125 GTGTGGTTGGGGATGGTTTCAGG - Intronic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1100352737 12:93800194-93800216 GTGTGTGTCGGGGTAGGGACTGG + Intronic
1100465608 12:94842121-94842143 GTGTGTGTGTGTAGGGGGACTGG - Intergenic
1100615258 12:96226429-96226451 GTGTGTGTGTGCATGTGGACAGG - Intronic
1100618125 12:96247461-96247483 GTGAGTTGGGGGACAGGGACGGG - Exonic
1101639772 12:106579546-106579568 GTGTGTTTGGGACTGGAGCCTGG - Intronic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1101757839 12:107635336-107635358 GTGAGCTTGGGGATGGGGTAGGG - Exonic
1103289437 12:119832635-119832657 CAGTGTATGGGGGTGGGGACAGG - Intronic
1103424717 12:120823202-120823224 GTGTGTGTGGGGGTGGGGGGTGG + Intronic
1103804417 12:123561232-123561254 GTGTCCTTGGGGATGGGGTCTGG - Intergenic
1103875630 12:124125035-124125057 GTGCTTTTGGGGAGGGAGACAGG + Intronic
1104282352 12:127389631-127389653 GTGTGTTTGGAGGTGGGGGCAGG + Intergenic
1104315844 12:127700204-127700226 CTGTGTTTGGTGATGGGGTGCGG - Intergenic
1104337908 12:127918054-127918076 GTGTGTTTGCGCAGGGGGAAAGG - Intergenic
1104793234 12:131497380-131497402 GTGTGCTTGGGGATGTGGATGGG - Intergenic
1104821292 12:131679030-131679052 GTGTGATCGGGGATTGGGTCTGG - Intergenic
1105279904 13:18957482-18957504 GGGTGTTCAGGGATGAGGACAGG - Intergenic
1105404162 13:20119556-20119578 GTGTGTTTGGGGGTCGGGGCAGG - Intergenic
1106100482 13:26691430-26691452 GTGTGCTGGGTGATGGGGGCAGG - Intergenic
1106240506 13:27908616-27908638 GTGTTTTGGGGGAGTGGGACGGG + Intergenic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1107118833 13:36776607-36776629 GTGTTTTTGGGGCTGGGGGCGGG - Intergenic
1109589000 13:64451452-64451474 GTGTGTTTGGGGCAGGGGGGTGG - Intergenic
1111333743 13:86793479-86793501 AAGTGTTTGGGTATGGGGTCAGG - Intergenic
1111640083 13:90957603-90957625 GTGTGTGTGGGGGTGGGGGGGGG - Intergenic
1111880077 13:93944903-93944925 GTGTGTGTTGGGGTGGGGAGGGG + Intronic
1111916976 13:94371342-94371364 GTGTGTGTTGGGTTGGTGACAGG - Intronic
1112393772 13:99009666-99009688 GTGGGTTTGGGGGTGGGGACAGG - Intronic
1112528458 13:100176207-100176229 GTGTTGTTGGGGATAGAGACAGG + Intronic
1113109102 13:106802843-106802865 GTGTGTTGGGGGGTGGAGGCGGG + Intergenic
1113263999 13:108596094-108596116 GTGTGTTGAGAGGTGGGGACGGG + Intergenic
1113323131 13:109256756-109256778 GTGTGTTTGGGGGTGAGGCTGGG + Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113700966 13:112388119-112388141 GTGTGTTTGTGTATGTGGAAGGG - Intronic
1114613451 14:24056413-24056435 GTCTGCATTGGGATGGGGACAGG - Intronic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1114927233 14:27419319-27419341 GTGTGTTGGGGAATGGTGACAGG + Intergenic
1115607928 14:35023777-35023799 GTGTGTGTGTGTTTGGGGACCGG - Intronic
1116687487 14:48058875-48058897 GTGTGTTTGGGGGAGGGGTGAGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117252654 14:53952224-53952246 GTGTCTCTGGGGAGGGGGAGGGG + Exonic
1118323369 14:64766110-64766132 GTGTGTATGGGGATGTGGTGTGG + Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118925500 14:70187653-70187675 GTGTGTTGGGGGATCGGGGGAGG + Intronic
1119093010 14:71801794-71801816 GTATGTATGGGGGTGGGGGCAGG + Intergenic
1119603025 14:75990103-75990125 GTGAGTTAGGGCAGGGGGACTGG + Intronic
1119603868 14:75997745-75997767 GTTTGTTTGGGGGTGGGGGTTGG + Intronic
1119663489 14:76467582-76467604 TTGTGTTTGGGGAGGCAGACTGG + Intronic
1119684082 14:76616426-76616448 CTGTGTTGGAGGATGAGGACTGG - Intergenic
1119967535 14:78933917-78933939 GGGTGGTTGGGGGTGGGGAGTGG - Intronic
1121080433 14:91103489-91103511 GTGTATTTGGTGATGGGGAGAGG - Intronic
1121255068 14:92525129-92525151 GTGTGTATGGGGGTGGGGTGGGG + Intronic
1121284749 14:92726495-92726517 GAGTGTGTGGGGGTGGGGAAGGG + Intronic
1121311097 14:92935536-92935558 GTGTGGCTGGGGACGGGGAGAGG - Intergenic
1121331967 14:93055433-93055455 GTGAGGTGGGGGAGGGGGACTGG - Intronic
1121399924 14:93666077-93666099 GTGTGTGTGTGGTTGGAGACTGG + Intronic
1122274128 14:100582594-100582616 CTGTGTTGGGTGCTGGGGACTGG - Intronic
1122767235 14:104081073-104081095 GTTTGTGTGGAGCTGGGGACTGG + Intergenic
1123804816 15:23860247-23860269 GTCCATCTGGGGATGGGGACAGG + Intergenic
1124373479 15:29116285-29116307 GTGTGCTGGGGGCTGGGAACAGG - Intronic
1124406859 15:29400880-29400902 GTTTATTCTGGGATGGGGACGGG - Intronic
1124911305 15:33923791-33923813 GTGAGAATGGGGATGGGGAGTGG - Intronic
1125183983 15:36909842-36909864 GTGTGTGTGGGGGTGGGGGTGGG + Intronic
1125440435 15:39696920-39696942 GTGTGTGTTGGGATGGGGGAAGG + Intronic
1125485319 15:40107564-40107586 GTGTGTGTGTGTATGGGGAGGGG + Intronic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126560380 15:50036446-50036468 GGGTGATTGGGGATGAGCACAGG + Intronic
1126685556 15:51246252-51246274 GTGTGTTTGGGGGTGAGGGGAGG - Intronic
1126837038 15:52678652-52678674 GTTCGTTTGGGGCTGGGGGCTGG - Intronic
1126860562 15:52878642-52878664 GTGTGTTTGTGTGTGGTGACAGG + Intergenic
1126986975 15:54322881-54322903 GTATGTTTGGGGACATGGACAGG + Intronic
1127296653 15:57614606-57614628 GTGGGGTTGGGGATGGGCAGGGG + Intronic
1127318462 15:57819045-57819067 GTGTGTGTGTGGGTGGGGGCAGG + Intergenic
1127453775 15:59140082-59140104 GTGTGTATGGGGGTGGGTGCGGG + Intronic
1127673771 15:61220930-61220952 GCCTGTTTGGGGCTGGGGAGTGG - Intronic
1127850155 15:62905011-62905033 GAGGCTTTGGGGATGGGGAAGGG - Intergenic
1128187409 15:65654500-65654522 GTGTGTTTGGGGCAGAGGTCAGG - Exonic
1128203534 15:65830494-65830516 GTCTGTTTGGGCATGGGCAAAGG - Intronic
1128207846 15:65869179-65869201 GTGGGTTTGTGGATGGGGGCGGG - Intronic
1128228450 15:66018715-66018737 GTGTGTGTGGGGTTGTGGAATGG + Intronic
1128351622 15:66894648-66894670 GTGTGTTTGTGTATGTGGAAGGG - Intergenic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1129252325 15:74315842-74315864 GTGTGGAGGGGGAGGGGGACAGG + Intronic
1129707428 15:77802761-77802783 GTGAGTGTGGAGGTGGGGACAGG - Intronic
1130539571 15:84812451-84812473 GTGTGTATGGGGATGAGGTGGGG + Intergenic
1131424150 15:92331866-92331888 GTGTATTGGGGGATTGGGTCTGG - Intergenic
1131856858 15:96606267-96606289 GGGAGTTTGGGGAAGGGGTCAGG + Intergenic
1132715600 16:1288621-1288643 GTGGGAGTGGGGGTGGGGACGGG - Intergenic
1132854772 16:2039808-2039830 GTGTGTTTGCAGATGGGATCTGG - Exonic
1133086273 16:3366041-3366063 GAGTTCTTGGGGATGGGGAGTGG - Intronic
1133589284 16:7227281-7227303 GTGTGTGTGGGGGTGGGGTGGGG - Intronic
1133973312 16:10582007-10582029 GTGTGTTTGGAGCTGGAGAGGGG + Intergenic
1134219017 16:12338781-12338803 GTGGGTCTGGGGGTGGGGATGGG - Intronic
1134422190 16:14104156-14104178 GTGTGTTTAGGTATGAGGCCAGG + Intronic
1135315167 16:21438832-21438854 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135368093 16:21871100-21871122 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135443724 16:22500049-22500071 GTGTGGTGGGGGAGGGGGAAGGG - Intronic
1135751953 16:25065382-25065404 GTATCTCTGGGGGTGGGGACAGG + Intergenic
1135849173 16:25947071-25947093 GTGTGTGTGGTGATGGGGAGTGG + Intronic
1135896680 16:26411558-26411580 GTGGGTTTAGGGGTGGGGATGGG + Intergenic
1136239867 16:28937246-28937268 GGGGGTTTGGGGATGGGGATGGG - Intronic
1136311832 16:29417493-29417515 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136325274 16:29519289-29519311 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136412818 16:30086690-30086712 GTGTGTCTGGGGAGAGGGAAGGG + Exonic
1136439961 16:30259271-30259293 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136665317 16:31806280-31806302 GTGTGTATGTGGATGGAGACAGG - Intergenic
1137312392 16:47277337-47277359 GTGGATTTGGGTATGGGTACTGG - Intronic
1137592332 16:49701260-49701282 GTGTGTGTAGGGTGGGGGACAGG + Intronic
1138271096 16:55696381-55696403 GTGTGTTGGGGAAGGGGGTCAGG - Intronic
1138328330 16:56192821-56192843 GTGTTTTTTGGGAGGGGGAAGGG + Intronic
1138584246 16:57960193-57960215 GTCTGTTTGAGGATTGGGATGGG - Intronic
1138610110 16:58116538-58116560 GTGTGTGTTGGGGTGGGGAGTGG - Intronic
1138614663 16:58155793-58155815 GTGTGTGTGTGGCTGGGGGCTGG + Intergenic
1139839655 16:69868179-69868201 GTGTGTTGGGGGGTGGTGGCTGG + Intronic
1140865065 16:79052958-79052980 GTGTATTTGGGGGTTGGGATGGG + Intronic
1141158638 16:81614063-81614085 GTTTGGTTGGGGATGGGGAGGGG + Intronic
1141418360 16:83894851-83894873 GTGGGGTCGGGGATGGGGAGAGG - Intergenic
1141431955 16:83974912-83974934 GTGGGTGCGGGGATGGGAACAGG + Intronic
1141432039 16:83975268-83975290 GTGGGTGCGGGGATGGGAACAGG + Intronic
1141432053 16:83975324-83975346 GTGGGTGCGGGGATGGGAACAGG + Intronic
1141493812 16:84393112-84393134 GTGTGTTTGGGGTTGGGTAGAGG + Intronic
1142205573 16:88781411-88781433 GCGTGTTTGGGGAAGGGGCCAGG - Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142787617 17:2236375-2236397 GTGTGTTCGGGGGTGGGGTGGGG + Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143141186 17:4742636-4742658 GGGTGTTTGGGGCTGGAGACAGG + Intronic
1143155963 17:4836177-4836199 TTGTGTTGGGGGCTGGGGAGAGG + Intronic
1143465016 17:7130936-7130958 TTGTGATTGGGGGTGGGGAGGGG - Intergenic
1143507594 17:7377124-7377146 GTGTGTGTGTGGGTGGGGGCGGG + Intergenic
1143739541 17:8942292-8942314 GTGTATTTCTGGATGGGGTCAGG - Intronic
1143746956 17:9002155-9002177 GTGTGTGTGGGGGTGGGGGGCGG - Intergenic
1143872340 17:9965961-9965983 GGGTGTCGGGGGATGGGGAAAGG - Intronic
1144262997 17:13541502-13541524 ATGTGTTTGGGAAGGTGGACAGG - Intronic
1144509827 17:15866486-15866508 GTTTGTTTGGTGGTGGGGAGCGG + Intergenic
1144753067 17:17663402-17663424 GTGTGTTTGTGTAGGGGGATGGG - Intergenic
1144782695 17:17815912-17815934 GTTTCTTCGTGGATGGGGACTGG - Exonic
1144874502 17:18390362-18390384 GTGGGTTTGGGGGTGGGAATGGG + Intergenic
1144945542 17:18967867-18967889 GTGTGGTGGGGGGTGGGGGCGGG - Intronic
1144966212 17:19078414-19078436 GGGGATTTGTGGATGGGGACTGG + Intergenic
1144981706 17:19173643-19173665 GGGGATTTGTGGATGGGGACTGG - Intergenic
1144986518 17:19204596-19204618 GGGGATTTGTGGATGGGGACTGG + Intergenic
1145173937 17:20684129-20684151 GTTTGTTTGGTGGTGGGGAGCGG + Intergenic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1145897134 17:28465698-28465720 GTGTGTATGGGGTGGGGGAAGGG + Intronic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146186649 17:30728738-30728760 GTTACTTTGGGGATGGGGAGTGG - Intergenic
1146249670 17:31327736-31327758 GTGTGTTGGGGGATAGAGTCGGG - Exonic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146608761 17:34286130-34286152 CAGTGTTTGGGAATGGGGAATGG + Intronic
1146845506 17:36179365-36179387 GTGGGCTTGGGGGTGGGGATGGG - Intronic
1146873722 17:36391206-36391228 GTGGGCTTGGGGGTGGGGATGGG - Intronic
1146881080 17:36442296-36442318 GTGGGCTTGGGGGTGGGGATGGG - Intergenic
1146936114 17:36813622-36813644 GTGGGGCTGGGGATGGGCACAGG - Intergenic
1146996797 17:37327894-37327916 GTGTGTTGGGGGGTTGTGACTGG - Intronic
1147065667 17:37921665-37921687 GTGGGCTTGGGGGTGGGGATGGG + Intergenic
1147732459 17:42612513-42612535 TTGTGTTTGGGGATTAGGAAAGG + Intronic
1147953828 17:44121653-44121675 GTGTGTTTAGAAATGGGGCCTGG - Intronic
1148151476 17:45398865-45398887 GTGTGTATGGGGAGGGGCAAGGG - Intronic
1148346309 17:46905816-46905838 GTTTGTTGGGGGATGGGGTAAGG + Intergenic
1148403777 17:47392450-47392472 GTGTGTTGGGGGGTGGGGGTTGG + Intronic
1148686213 17:49502577-49502599 GTGTGTTTGGGGGAAGGGAGAGG + Intronic
1148851262 17:50556566-50556588 TTGGGTTGAGGGATGGGGACTGG + Intergenic
1148866200 17:50629950-50629972 GTCTGTGTGGGGGTGGGGACTGG + Intergenic
1149011848 17:51865029-51865051 GGGAGAGTGGGGATGGGGACAGG + Intronic
1149100243 17:52897392-52897414 GTGTGTTTGGACAAGGGGAAAGG - Intronic
1149397489 17:56259893-56259915 GTGTGTTTGGAGGTGGGGTGGGG - Intronic
1149456078 17:56789648-56789670 GAGTGTTTGTGGATGGGGGGAGG + Intergenic
1149496773 17:57123375-57123397 ATTTATTTGGGGATGTGGACTGG - Intergenic
1149542308 17:57476879-57476901 ATGGGTTGGGGCATGGGGACTGG - Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149951834 17:60996529-60996551 GCAGGTTTTGGGATGGGGACAGG + Intronic
1150294313 17:63999524-63999546 TAGGGTTGGGGGATGGGGACAGG + Intronic
1150817096 17:68400935-68400957 GTGTGTTTGGGCACAGGGATAGG + Intronic
1151533714 17:74725185-74725207 GTGGGTGGGGGGCTGGGGACAGG - Intronic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152520556 17:80853432-80853454 GTGTGTTTAGGCATGGTGATGGG + Intronic
1152931171 17:83110816-83110838 GGGTGCTGGGGGAGGGGGACTGG - Intergenic
1152949529 17:83220439-83220461 GTGTCTTTGGGGATGATGACCGG - Intergenic
1153390443 18:4551905-4551927 AAGTGTTTTGGGATGGGGGCTGG + Intergenic
1153601101 18:6781967-6781989 ATGGGTTTAGGGATGGGGACAGG + Intronic
1153835918 18:8963657-8963679 CTGTGTGTGTGGGTGGGGACGGG - Intergenic
1153953996 18:10080708-10080730 CTGTGTTTGGAGGTGGGGACTGG + Intergenic
1155229466 18:23758512-23758534 GTGGGTGTGGGGATGGGGTGGGG + Intronic
1155329459 18:24699868-24699890 GTGGGAATGGGGATGGGGATGGG + Intergenic
1155333143 18:24738137-24738159 GTGTGTGTGGGGGTGGGGGCTGG + Intergenic
1155426542 18:25713259-25713281 GTGTGTTTGGGGTTGGGTGGGGG + Intergenic
1155572210 18:27207511-27207533 GTGTGTGGGGGGGTGGGGATGGG - Intergenic
1156231180 18:35155399-35155421 GTGTGTGTGCGGATGGGGGTGGG + Intergenic
1156450187 18:37262387-37262409 GTGTGTGTGGGGTGGGGGAGGGG + Intronic
1156840841 18:41607963-41607985 GTGTGTGTGGGGGTGGGGTGGGG + Intergenic
1156876643 18:42022281-42022303 ATGGGGTTGGGGATGGGGGCAGG - Intronic
1156945925 18:42831545-42831567 GTGTGTGTGGGGTTGGACACGGG + Intronic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1158109169 18:53920793-53920815 GTGTGTGTGTGCATGGGGGCGGG + Intergenic
1158477434 18:57792791-57792813 ATGTGTATGGAGATGGGGAGTGG + Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1160337013 18:78051181-78051203 GGGTGGTTGGGGAAGGAGACTGG + Intergenic
1160589299 18:79933741-79933763 GTGTGTGGGGAGATGGGGGCGGG - Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160933565 19:1582445-1582467 GTGGGGTTGGGGATGGGTAAGGG - Intronic
1161195332 19:2983322-2983344 GAGTGTTAGGGGATGAGGGCTGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161246457 19:3255137-3255159 GGGTCTAGGGGGATGGGGACTGG - Intronic
1161256585 19:3313321-3313343 GTGTCATTGGGGCTGAGGACGGG - Intergenic
1161434032 19:4251194-4251216 GTGTGCTGGGGGAGAGGGACCGG - Intronic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161483674 19:4523618-4523640 GTGGGAATGGGGATGGGGACAGG - Exonic
1161734802 19:5985116-5985138 GCGTGTGTGGAGATGGGGTCTGG + Intergenic
1162065639 19:8123761-8123783 GTGCGGTTGGGGAAGGGGTCAGG - Intronic
1162109169 19:8390805-8390827 GCGTGATTCGGGATGGGGGCGGG + Intronic
1162109206 19:8390931-8390953 GCGTGTTTGGGGGTGGGGCCCGG + Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1162612566 19:11767593-11767615 GGGTGTTTAGGGGTGTGGACAGG + Intronic
1163118418 19:15201220-15201242 GTGTACTGGGGGATGGGGATGGG - Intergenic
1163270370 19:16249485-16249507 GAGTGATTGCTGATGGGGACGGG - Intergenic
1163293556 19:16396944-16396966 GTGGGTGGGGGGATGGGGAGTGG + Intronic
1163319416 19:16564697-16564719 GTTTGTTTGGGGGTAGGGAAGGG - Intronic
1163323292 19:16587111-16587133 GTGTGTTGGGGGTTGGGGGGTGG - Intronic
1163611929 19:18306134-18306156 TTGTGTGTGGGGTGGGGGACAGG - Intergenic
1163736914 19:18987413-18987435 GTGTGTTGGGGGTTGGCGGCAGG + Intergenic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1164872604 19:31658705-31658727 GGATGTGTGGGGATGGTGACAGG - Intergenic
1164950845 19:32335730-32335752 GTGTGTGTGTGGGTGGGGAAGGG - Intergenic
1165108087 19:33486298-33486320 GTGGGTGTGGGCATGGGGTCGGG - Intronic
1165123378 19:33577814-33577836 GTGTGTGTGGTGGTGGGGGCGGG - Intergenic
1165164310 19:33840669-33840691 GAGGCTTAGGGGATGGGGACTGG - Intergenic
1165354532 19:35295534-35295556 ATGTGGTTGGGGATGGGAGCCGG + Intronic
1165941794 19:39418106-39418128 GTGAGTTTGGGGATGGGGTGGGG + Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166317113 19:41995353-41995375 GTGTGTTTGGGCATGAGCAACGG + Intronic
1166706343 19:44909981-44910003 GTGTGTGTGGAGATGGGGTCTGG + Intergenic
1166776815 19:45318064-45318086 ATGTGTGTCGGGATGGGGGCGGG + Intronic
1166999345 19:46736796-46736818 GTGTGCTCGGGGAGGGGGGCTGG - Intronic
1167044278 19:47040731-47040753 GTGTGTGTGGGGGGGGGGTCTGG + Intronic
1167339101 19:48904289-48904311 GTGAGGGTGGGGATGGGGATGGG + Intronic
1167569303 19:50276902-50276924 GTGGGTTGGGGCAGGGGGACAGG + Intronic
1167663480 19:50810267-50810289 TTGTGGTTGGGGATGAGGATGGG + Intergenic
1167667047 19:50828365-50828387 CTGTGGTTGGGGGTGGAGACAGG + Intronic
1167676033 19:50886556-50886578 CTGTGATTGGAGATGGAGACAGG - Intergenic
1167726330 19:51215656-51215678 GTGGGTTTGGGGATGGACATGGG - Intergenic
1168181136 19:54663750-54663772 GTGGGTTTGGGGAGGGGCCCTGG - Exonic
1168278651 19:55291665-55291687 GTGTTTTTGGAGATGGGGTGGGG + Intronic
1168284766 19:55325412-55325434 TTGTGGTTGGTGGTGGGGACTGG + Intronic
925277751 2:2662454-2662476 GTGTGTGTGCTGGTGGGGACTGG - Intergenic
925734963 2:6955913-6955935 GTGTGGTTGGAGAGGTGGACAGG - Intronic
927712811 2:25336237-25336259 GTGTGTTGGGGGACAGGGTCAGG + Intronic
927858249 2:26540729-26540751 GTGTGTTTTGGGGCGGGGGCAGG + Intronic
928020441 2:27700510-27700532 GTGTGTGGGGGGTGGGGGACAGG - Intergenic
928278071 2:29920583-29920605 GTGGGCTCCGGGATGGGGACCGG - Exonic
928404648 2:31005266-31005288 GTGTGTGTGGGGGTGGGGAGTGG + Intronic
928409930 2:31047216-31047238 GTCTGATTGGGAATGGGGGCAGG - Intronic
928425445 2:31174169-31174191 AGCTGTTTGGGGATGGGGTCAGG - Intronic
928894063 2:36240760-36240782 TTGTGTTTGGGGGTGGGGTTGGG - Intergenic
928963682 2:36955711-36955733 GTGTGTTGGAGGTAGGGGACAGG - Intronic
929686471 2:44039496-44039518 GTGGGTGTGGGGATGGCGATAGG + Intergenic
930088978 2:47518234-47518256 CTGGATTGGGGGATGGGGACAGG + Exonic
931232182 2:60384208-60384230 GTGTGTTTTGGGGGGGGGACAGG - Intergenic
931447236 2:62336758-62336780 GTGGGTTGGGGGATGGAGCCCGG - Intergenic
931572975 2:63689178-63689200 GTCTGTTTTGGGATGGGGAGGGG + Intronic
931927009 2:67084649-67084671 GTGTGTTGGGGGCTGGGGAATGG + Intergenic
932055278 2:68437124-68437146 AAGTGTTGGGGGAGGGGGACAGG - Intergenic
932326692 2:70867412-70867434 GTGTCTTAGGGGCTGGGGATGGG - Intergenic
932385946 2:71332399-71332421 TTGTGTTTGGGGTTGGGGAGGGG + Intronic
932429306 2:71664435-71664457 GTGTGTACGTGGATGGGGGCTGG + Exonic
932752247 2:74378826-74378848 GTGGGTTTGTGGATGGGGGTGGG - Intronic
933311681 2:80668610-80668632 GAGTGTTTGGGACTTGGGACTGG + Intergenic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934474624 2:94586184-94586206 GTGTGTGTAGGGGTGGGGACTGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
935122203 2:100192809-100192831 GTGTGGTGGGGGCTGGGGATAGG - Intergenic
935200896 2:100855751-100855773 GTGAGTTTGGGGAATGGGCCTGG - Intronic
936959947 2:118062459-118062481 GTATATTTGGGCATGGGGAGTGG + Intergenic
937102553 2:119282991-119283013 CTGTCTTTGAGGATGGGCACAGG + Intergenic
937230539 2:120395976-120395998 GTGTGTGGGGGGGTGGGGATTGG - Intergenic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937818232 2:126276683-126276705 GTGTGTGTTGGGATGGGAGCAGG + Intergenic
937866225 2:126753418-126753440 GTGAGTGTGGGGCTGGGGATGGG + Intergenic
938275927 2:130022197-130022219 GTCTGTTGGGGGATGGGGTGAGG + Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938439447 2:131315160-131315182 GTCTGTTGGGGGATGGGGTGAGG - Intronic
939231568 2:139432789-139432811 GTGTGTTAGGGGGTGGGGGTTGG - Intergenic
939712614 2:145541765-145541787 GGGTGGTTGGGGATGGGGGATGG + Intergenic
940497641 2:154453614-154453636 GCATGTTTGGGGCTGGGGAGGGG - Exonic
940650815 2:156438492-156438514 GAGTGTGTTGGGATGGGGAGAGG + Intronic
940663976 2:156584106-156584128 GTGTGTGTCGGGATGGGGGTTGG - Exonic
940951734 2:159682905-159682927 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
941053889 2:160765882-160765904 GTGTGTGTGTGAATGGGGAAGGG - Intergenic
941225112 2:162838754-162838776 GAGGGTTTGGGGGTGGGGAACGG + Intergenic
941277999 2:163515136-163515158 GTGTGTTTAGGGCTGGGCAGAGG - Intergenic
941487182 2:166097031-166097053 GTGTTTTTGGAGACGGGGTCAGG + Intronic
942135096 2:172917487-172917509 GTGTTTGTGGGGTTGGGGAGGGG + Intronic
942462562 2:176178344-176178366 GTGTGTCTAGGGTTGGGGGCAGG + Intergenic
943338269 2:186645475-186645497 GTGGGGGTGGGGATGGGGAGAGG + Intronic
943743442 2:191436227-191436249 GGGTGGGTGGGGATGGGGAGGGG + Intergenic
944454072 2:199875598-199875620 ATGGGTTTGGGAATGGGGATTGG - Intergenic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
944977250 2:205068160-205068182 CTCTGTTTGGGGATGGGGCAGGG + Intronic
945581514 2:211601385-211601407 ATGGGATTGGGGGTGGGGACGGG + Intronic
946226254 2:218265558-218265580 GTGTGAGTGAGGATGGGGAAAGG - Exonic
946569625 2:221009472-221009494 GTGTGTATGGGGATGGATGCGGG - Intergenic
946708542 2:222483646-222483668 GTGTGTTTTGGGATGTGGGCAGG + Intronic
946738262 2:222776086-222776108 GTGTGTGTGTGTATGGGGAAGGG - Intergenic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947246843 2:228057999-228058021 GGGTTGTTGGGGATGGGGACAGG - Intronic
947625489 2:231615701-231615723 GGATGGTTGGGGATGGGGACTGG - Intergenic
947724293 2:232387743-232387765 GTGTGTGCAGGGAGGGGGACAGG - Intergenic
947944142 2:234085365-234085387 TTTTGGTTGGGGATGGGGAGTGG - Intergenic
947982650 2:234423636-234423658 TTTTGGTGGGGGATGGGGACAGG - Intergenic
947993626 2:234508291-234508313 TTTTGTTTGGATATGGGGACAGG - Intergenic
948017064 2:234699604-234699626 GGGTGCTTGGGTATGGGGGCTGG - Intergenic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948371538 2:237492757-237492779 GTGTGTTTGGGGGTGGTTCCAGG - Intronic
948690412 2:239699016-239699038 GGGTGTTAGGGGCTGGGGGCTGG - Intergenic
1169065102 20:2690750-2690772 GTGTGTGTGGGGTTGGGGGGTGG + Intergenic
1169152660 20:3302505-3302527 GTATTTTAGGGGATGGGGAGGGG - Intronic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1170183792 20:13564185-13564207 GTGTGTTTGTGTTGGGGGACGGG - Intronic
1170428533 20:16258249-16258271 GTGTGTTTGGAATTGGGGATGGG - Intergenic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1170428706 20:16258948-16258970 GTGTGTTTGGAATTGGGGAAGGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170825035 20:19786471-19786493 GAGTGTGTGGGGGTGGGGAACGG - Intergenic
1170863550 20:20131223-20131245 GTTTTTTTGTGGATGGGGAGGGG + Intronic
1170970008 20:21106537-21106559 GTGTGTCTGGGTTTGGGGGCTGG + Intergenic
1171769403 20:29310965-29310987 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1171934290 20:31258937-31258959 GTGTGTTGGGGGGTGGGTGCAGG - Intronic
1171986386 20:31664417-31664439 GTGTGCTCCGGGATGGGGAAAGG - Intergenic
1172580872 20:36046849-36046871 GGGTGTTTGGGGTGGGGGAAGGG - Intergenic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173126676 20:40342546-40342568 GAGTGTATGGGGATCGGGCCTGG - Intergenic
1173195018 20:40906992-40907014 GTGTGTGTGTGTATGGGGAGGGG - Intergenic
1173274121 20:41564499-41564521 CAGTGGTTGGGGTTGGGGACAGG + Intronic
1173282519 20:41642260-41642282 GTGTGTTTGGGGTTGAGTCCTGG + Intergenic
1173404488 20:42752967-42752989 GTGTGTTTGGGGTCGGGGCAGGG + Intronic
1173485558 20:43438553-43438575 GTGTGTGGGGGGATGGGGATGGG - Intergenic
1173846400 20:46191413-46191435 GTGGGCGTGGGGATGGGGATGGG + Intronic
1173938488 20:46889857-46889879 GTGTATGTGGGGATGGGCAGGGG - Intergenic
1174447128 20:50597807-50597829 GTGGGATTGGGGCTTGGGACCGG - Intronic
1174689854 20:52493120-52493142 GTGTGTTTGGGGACGGGTAGGGG + Intergenic
1174710647 20:52701346-52701368 GTGGGTCTGGGGATGGGGCCTGG + Intergenic
1174725947 20:52862265-52862287 GTCTGTTTGGGGGTGGGGATGGG - Intergenic
1174924500 20:54742762-54742784 GTGTGTGTGGGGAGGGGGTGGGG + Intergenic
1175885732 20:62289442-62289464 GTTTGTTTAGGGAGAGGGACGGG - Intronic
1175950735 20:62581768-62581790 GGCTATTTGGGGGTGGGGACAGG + Intergenic
1176383031 21:6122875-6122897 CTGGGTTTGGGGGCGGGGACTGG - Exonic
1176551852 21:8226565-8226587 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176570761 21:8409564-8409586 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176578670 21:8453711-8453733 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1177320135 21:19510355-19510377 GTGTGTTTGGTAACGGGGGCAGG + Intergenic
1177615048 21:23506071-23506093 GAGTGATTAGGGATGGTGACTGG - Intergenic
1177621352 21:23598927-23598949 GTGTGTATGAGGTGGGGGACAGG + Intergenic
1178258146 21:31074210-31074232 GTGTGTTTGTGGTGGGGGAGTGG - Intergenic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179740438 21:43415364-43415386 CTGGGTTTGGGGGCGGGGACTGG + Exonic
1180074919 21:45457435-45457457 GTGTGCTTCAGGATGGGGAGGGG - Intronic
1180351239 22:11805954-11805976 GCGTGTTGGGGGTTGGGGGCGGG + Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180569596 22:16702736-16702758 GCGTGTTTTGGGATGAGGAAGGG - Intergenic
1180835759 22:18928717-18928739 GAGGGCTTGGGGATGGGGAAGGG - Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181961100 22:26622376-26622398 GTGAGTTTTGAGATGGGGATAGG + Intronic
1181997158 22:26892046-26892068 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1182221223 22:28760519-28760541 GTGTGTTGGGGGTGGCGGACAGG - Intergenic
1182418366 22:30236018-30236040 GAGTGTCTGGGGCTGGGGGCGGG - Intergenic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1183575196 22:38683615-38683637 GTGTGGGTGGGGATTGGGATCGG + Intronic
1184065143 22:42114318-42114340 GAGTCTTTAGGCATGGGGACTGG + Intergenic
1184400083 22:44268663-44268685 GTGTTTTAGAGGATGGGGAGAGG + Intronic
1184453356 22:44595841-44595863 GGGGCTTTGGGGATGGGGAACGG - Intergenic
1184641261 22:45871646-45871668 TTGTGTCTGGGGTTGGGGAGGGG + Intergenic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1185295001 22:50048902-50048924 GTGTGTTGCAGGATGGGGCCTGG - Intronic
1185359580 22:50397597-50397619 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359596 22:50397668-50397690 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359613 22:50397741-50397763 GTGTGACTTGGGATGGGGGCGGG + Intronic
1185359629 22:50397812-50397834 GTGTGACTTGGGATGGGGGCAGG + Intronic
1185359645 22:50397882-50397904 GTGTGACTTGGGATGGGGGCGGG + Intronic
1185359661 22:50397953-50397975 GTGTGACTTGGGATGGGGGCAGG + Intronic
1203256873 22_KI270733v1_random:143487-143509 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1203285848 22_KI270734v1_random:154016-154038 GAGGGCTTGGGGATGGGGAAGGG - Intergenic
949966815 3:9363615-9363637 GTGTGCTTGGGGTGGGGGCCGGG - Intronic
950798227 3:15528596-15528618 GTGTGGTTGGGGACTGGGATTGG - Intergenic
950891755 3:16410382-16410404 ATGTGGATGGGGATGGGGATGGG + Intronic
951359775 3:21711613-21711635 GTGTTTTTGGGGATGGGAGATGG - Intronic
951454193 3:22872219-22872241 TTGTGTTTTGTGCTGGGGACAGG - Intergenic
951557371 3:23934269-23934291 GTTTGTTTGGGGGTGAGGAAAGG - Intronic
951978007 3:28535415-28535437 GTTTTTTTGGGGATGGAGTCTGG - Intronic
952211811 3:31235590-31235612 GTGTGTTGGGTGATGGGGGCTGG + Intergenic
952687026 3:36161933-36161955 GTGGGCTTGGGGTTAGGGACTGG + Intergenic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953688212 3:45094712-45094734 GGGTGTGGGGGGATGGGGATGGG + Intronic
953850524 3:46463002-46463024 GTGTTTGGGGGGCTGGGGACTGG - Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954392189 3:50273659-50273681 GTGGGTATGGGGTTGGGGAGGGG + Intronic
955225995 3:57060807-57060829 GTGTGTTTCGGGGTGGGGGTGGG - Intronic
956062015 3:65357184-65357206 GTGTGGGTGGGAACGGGGACAGG - Intronic
956427937 3:69155803-69155825 GTGGGTGTGGGGAAGGGGTCAGG + Intergenic
956542624 3:70359031-70359053 GTGTGTTGGGGGCTGGGGGTGGG - Intergenic
956608223 3:71094760-71094782 GTTGGTTTGGGGACGGGGAATGG + Intronic
956726192 3:72158504-72158526 GTGTGCTTGGGGCTAGTGACTGG - Intergenic
956872526 3:73431856-73431878 GTGTGTTTGGGGGTGGGGCTGGG + Intronic
957243812 3:77692901-77692923 GTGTGTGTTGGGAAGGGGAGTGG - Intergenic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958573236 3:95913382-95913404 GTGTGTTTGGGGTAGTTGACAGG - Intergenic
958661207 3:97069916-97069938 GTGTGTTTAAGGAGTGGGACTGG + Intronic
958675437 3:97264300-97264322 GTGTGTGTGAGCATGGGGTCCGG + Intronic
958902873 3:99908448-99908470 GTATGTTTGGGGTTGGGCCCAGG + Intronic
960246485 3:115405540-115405562 GTGTGTTTGTGGTGGGGGAAGGG + Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960942190 3:122942421-122942443 GTGGGTGTGGGGTTGGGGAGAGG - Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
962348763 3:134641722-134641744 GTGTGTGCGGGTATGGGGTCTGG - Intronic
962642881 3:137406717-137406739 GTGTGTTTTGGGTTGGGGGAGGG + Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964569771 3:158098387-158098409 TTGTGTTTGGGCACGGGGAGAGG + Intronic
964707682 3:159637360-159637382 GTGTGTGTGTGGCTGGGGCCGGG - Intronic
964891387 3:161540307-161540329 GTGTATATGGGGATGGAGCCAGG + Intergenic
965008329 3:163054922-163054944 GAGGGTTTGGGGAAGGGGAAAGG + Intergenic
965690890 3:171355883-171355905 GTGTGTTTGGGGTTGAGGGTGGG - Intronic
965697847 3:171427983-171428005 GTGTGTTTGGTGCTGGGGGCTGG + Intronic
965899837 3:173625333-173625355 GTGTGCTGGGGGGAGGGGACAGG - Intronic
965948188 3:174268422-174268444 ATGTGGTTGGTGATGGGGACTGG + Intronic
966301632 3:178485598-178485620 GTGTGCTTGGAGTTGGGGGCAGG - Intronic
966318074 3:178671099-178671121 GTGTGTTTTGGGGTGGGGGGTGG - Intronic
966716558 3:183018588-183018610 GTGGTTTTGTGGGTGGGGACAGG - Intronic
966878120 3:184335159-184335181 GTGTGTCTTGGGGTGGGGAGGGG + Exonic
967006757 3:185391225-185391247 GGGTGTGTGGGGAGGGGGAATGG - Intronic
967101308 3:186218126-186218148 GTGTGTTTGATAATGGGGTCTGG - Intronic
967129291 3:186455871-186455893 GTGTCTTTGGGGTGGGGGAGTGG - Intergenic
967143555 3:186585884-186585906 GTGTAATTGGGCATGGGGACTGG - Intronic
968009039 3:195260963-195260985 GTGGGTGTGGGGATGAGGGCAGG - Intronic
968460373 4:721732-721754 CTGTGTATGGGCATGGGGAGGGG + Intronic
968460391 4:721784-721806 CTGTGTATGGGCATGGGGAGGGG + Intronic
968544775 4:1193308-1193330 GGGTGTGTGGGGCAGGGGACAGG - Intronic
968645771 4:1739877-1739899 GTGGGGATGGGGACGGGGACAGG - Intronic
968684886 4:1951296-1951318 GTGAGATTGGGGAAGGGGTCTGG - Intronic
969028543 4:4193338-4193360 GTGGGTGTGGTGATGGGGAAGGG - Intronic
969085728 4:4655076-4655098 GTATGTTTGGGTATGGTAACTGG + Intergenic
969542656 4:7803440-7803462 GTGGTTTTGGGGATCGGGACTGG - Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
970195721 4:13548116-13548138 GTGTGTTTGGGGTGGGGGCGGGG + Intergenic
970316686 4:14834746-14834768 GTGAGTTTGGGGGTGGTGCCTGG - Intergenic
970317654 4:14845059-14845081 GTGGGGATGGGGATGGGGATGGG + Intergenic
970317665 4:14845083-14845105 GTGGGGATGGGGATGGGGATGGG + Intergenic
970638166 4:18032959-18032981 TTGTTTTGGGGGGTGGGGACAGG - Intergenic
971166392 4:24188317-24188339 GAGTCCTTGGGGATGGGAACAGG - Intergenic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972330688 4:38062071-38062093 GTGAGTGTGGGGATGGGGTCTGG + Intronic
972488222 4:39562369-39562391 GTTTGTTTGGGGGTTGAGACAGG - Intronic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
972745503 4:41928279-41928301 GTGTGTGTGGGGATGGGGGTGGG + Intergenic
972893948 4:43595674-43595696 ATGTGTTTGGGGGTGGGGGGTGG - Intergenic
973259715 4:48150448-48150470 GCGGGTTTGGGGATGGGGGATGG - Intronic
973538253 4:51906530-51906552 GTGTGTTTGAGGTTGGGGGTGGG - Intronic
974145789 4:57945765-57945787 GTGTGTTTGGGGTTGGTGTGGGG - Intergenic
974360019 4:60865469-60865491 ATGAGGATGGGGATGGGGACTGG + Intergenic
975312456 4:72917941-72917963 GTGTGTTGGGGGATGTGGCATGG - Intergenic
975698934 4:77043178-77043200 GTGTGTTTGAGGGTGGGGAACGG + Intergenic
976051731 4:81017874-81017896 GTGTGTTTGGGGGCTGGGGCGGG + Intergenic
976275546 4:83273821-83273843 GTTTGTTTAGAGATGGGGATGGG - Intronic
976627634 4:87204214-87204236 GTGTGTATGGGGATGTGGCAGGG - Intronic
976659298 4:87522624-87522646 GTGTGTTTGGTGGTGGTGGCTGG - Intronic
976846827 4:89498331-89498353 GTGTGTGTGTGTATGGAGACGGG + Intergenic
977150254 4:93502703-93502725 GTGTGTGTGGGGGGGGGGAGTGG - Intronic
977518892 4:98056280-98056302 GTTGGCTTGGGGATGGGTACTGG - Intronic
978618182 4:110615825-110615847 GGGGATTTGGGGATGGGGGCTGG - Intergenic
978667384 4:111200585-111200607 GTGGGTGTGGGGATGGGGGTTGG - Intergenic
978759717 4:112343664-112343686 TTGTGTTTGGAGATGGGATCAGG - Intronic
978882279 4:113720182-113720204 GTCTATTTGGGGATGGCCACAGG + Intronic
979558094 4:122073779-122073801 GTGACTTTAGGCATGGGGACAGG - Intergenic
980973384 4:139587776-139587798 GTGTTTGTGGGGAGGGGGACAGG + Intronic
981450012 4:144886021-144886043 ATGTGTTTGGGGTTGGGGCGTGG - Intergenic
981905233 4:149915218-149915240 GGGTGTTTGGGGATGAGGGCAGG - Intergenic
982150410 4:152449027-152449049 GTGTGTGTGGAGACGGGGAGGGG - Intronic
982657131 4:158163806-158163828 TTGTGTTTGGGGGTGTGGACGGG - Intronic
983501654 4:168506395-168506417 GTGTGTTGGGGCATGGGGGGCGG - Intronic
983559147 4:169083929-169083951 GAGTGTTGGGGGCTGGGGAGCGG + Intergenic
983861708 4:172715264-172715286 GTGTGTGTGGGGATGTGCATGGG + Intronic
984528226 4:180882689-180882711 GTGTGTGGGGGGTTGGGGGCAGG - Intergenic
985646040 5:1085182-1085204 GTGGGTGTGGGGCTGGGGCCAGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985907268 5:2849603-2849625 GTGTGCTTTGGGGTGGGGAAGGG + Intergenic
986147113 5:5088770-5088792 GTGTGTTCCTGGATGGGGGCTGG + Intergenic
986243032 5:5978687-5978709 GTGGGCTTTGGGATGGGGAAGGG - Intergenic
986645906 5:9915725-9915747 CTGTGGTTGGGGGTGAGGACAGG - Intergenic
987264952 5:16243675-16243697 GTGTGTGTGGGGGTGGGGGCAGG - Intergenic
987314576 5:16712115-16712137 GTGGGGGTGGGGATGGGGAAGGG + Intronic
987521264 5:18986832-18986854 GTTTGTTTGGGGGTGGGGGAGGG - Intergenic
987911363 5:24150563-24150585 GTGTGTGGGGGGATGGGGCATGG + Intronic
987949265 5:24654864-24654886 GTGGGGTGGGGGATGGGGAAGGG - Intergenic
990161908 5:52950336-52950358 GGGTGGGTGTGGATGGGGACTGG + Intronic
990416422 5:55591336-55591358 GTGTGTGTCGGGGTGGGGAGAGG + Intergenic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
991402962 5:66273433-66273455 GTGGGTTTGGGGATAAGGAGAGG - Intergenic
991518965 5:67473110-67473132 GTGAGGTTGGGGTTGGGGCCTGG - Intergenic
991633457 5:68680012-68680034 AGGGGTTTGGGGATGGGGAAAGG + Intergenic
991957353 5:72008259-72008281 GTATGTTTGGGGTCGGGGAAGGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993063230 5:83066740-83066762 AGGTGTTTGGGTTTGGGGACGGG + Intronic
993349391 5:86829404-86829426 GTGTGTTGGGGGGTGAGGAGAGG - Intergenic
993711095 5:91226135-91226157 GTGTGTTGGGGTAGGGGGAGGGG + Intergenic
993920181 5:93792017-93792039 ATGTGGTTGGGGGTGGGGAGGGG + Intronic
994335720 5:98563477-98563499 CTGTGTTTGGGGATGGAGAAAGG - Intergenic
994639515 5:102389443-102389465 GTGTGTGTGGGGGTGGGGGGCGG - Intronic
994903149 5:105802210-105802232 GTGTGTTTGGTAGTGGGGAGGGG + Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995039361 5:107570643-107570665 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
995507853 5:112879318-112879340 ATGTGTTTGGGGGGGGGGGCTGG + Intronic
995518754 5:112979894-112979916 GTGTGTGTGTGGGTGGGGAAGGG + Intronic
995841329 5:116446278-116446300 GTGTGTGTGGGGGTGGGGGATGG + Exonic
995871763 5:116750575-116750597 GTGTGTTTTGGGGTGGGGGGAGG - Intergenic
995896819 5:117022744-117022766 GTGTGTTTAGGGGTGGGTAGTGG + Intergenic
996111288 5:119569694-119569716 GTCTGTGTGGGGATGGGGGTGGG + Intronic
996764191 5:127019327-127019349 GTATGTTGGGGGATGGGGTAGGG - Intronic
997639741 5:135441438-135441460 GTGTGTTGGGGAATGGAGAGGGG + Intergenic
997659692 5:135579606-135579628 GTGTATGCGGGGGTGGGGACGGG + Intergenic
997665669 5:135627908-135627930 GCATGGTTGGGGGTGGGGACTGG + Intergenic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998005100 5:138651525-138651547 GTGTGTGTGGGGGTGGGGGCAGG - Intronic
998098437 5:139411877-139411899 CAGTGGTTGGGGATGGGGAGAGG + Exonic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998402027 5:141853166-141853188 GGGTGGGTGGGGGTGGGGACGGG - Exonic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999090646 5:148933108-148933130 GTGTGGCTGGGGATGGCTACTGG - Intronic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999293075 5:150440325-150440347 CTTTGTTTGGGGTTGGGGATGGG + Intergenic
999320851 5:150614276-150614298 GTGTGGTGGGGGAAGGGCACTGG - Intronic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
999939264 5:156522755-156522777 GTGTGTCGGGGGGTGGGGATGGG - Intronic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000026497 5:157363446-157363468 GTGTGGTTGCAGATGGGGAGGGG + Intronic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000182889 5:158829578-158829600 GGGGGTTAGGGGATGGGGATGGG + Intronic
1000346136 5:160315302-160315324 GTGTGTTGGGGGGCGGGGGCGGG - Intronic
1000393823 5:160751819-160751841 GCGTGTTTGTGGTGGGGGACAGG + Intronic
1000490424 5:161905898-161905920 GCCTGTTGGGGGATGGGGGCTGG + Intergenic
1000829814 5:166088760-166088782 GTGGGGATGGGGATGGGGATGGG - Intergenic
1000829817 5:166088766-166088788 GTGGGAGTGGGGATGGGGATGGG - Intergenic
1001022535 5:168195604-168195626 GTGTGTGTTGGGGTGGGGGCAGG + Intronic
1001119909 5:168971518-168971540 GTCTGTTTCGGGATTGGGAGTGG - Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001308717 5:170595165-170595187 GCTTGTCTGGGGTTGGGGACTGG + Intronic
1001474717 5:172042370-172042392 GTGCTTTTCTGGATGGGGACTGG - Exonic
1001712083 5:173787049-173787071 TTGTGCTTGGGGATGGGGAAGGG - Intergenic
1001933910 5:175691377-175691399 ATGGGTCTGGGGATGGTGACTGG + Intergenic
1002016327 5:176326185-176326207 GGGAGTTTAGGGATGGGGATGGG - Intronic
1002301452 5:178259622-178259644 ATGGGGATGGGGATGGGGACGGG - Intronic
1002332542 5:178454650-178454672 GTGTGTTGGGAGATAGGGAAGGG - Intronic
1002743760 5:181454254-181454276 GTGTCTTTGGGGATGATGACTGG - Intergenic
1003357421 6:5386750-5386772 ATGTGTTTTGGGGTAGGGACAGG + Intronic
1003476025 6:6483838-6483860 GTGTGTGTGGGGGTGGGGGGAGG - Intergenic
1003864688 6:10352058-10352080 GTGTGTATGGGAAAGGGAACAGG + Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1003951624 6:11121562-11121584 GTGTGTGTTGGGAGGGGGAGAGG - Intronic
1004422143 6:15480178-15480200 GTTTGTTTTGGGGTGTGGACAGG + Intronic
1004505635 6:16244589-16244611 GTGTGTTTGTGGGTGGGGGAGGG + Intronic
1004511314 6:16286285-16286307 GTGGGATTGGGGATGGGGAGCGG + Intronic
1005480419 6:26250057-26250079 GAGGGTTAGGGGATGGGGGCAGG - Intergenic
1005493589 6:26369468-26369490 TTGTGTTAGGGGATTGGGGCCGG + Intronic
1005795651 6:29359236-29359258 GTGTGTGTGGGCATGTGAACTGG - Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006475245 6:34248864-34248886 GGGTGTTGGGGGATGCGGATGGG + Intronic
1006515087 6:34541275-34541297 GTGCTCTTGGGGATGGGGATAGG + Intronic
1006636301 6:35463632-35463654 TTGTGGTTGGGAATTGGGACGGG + Intronic
1006668938 6:35717713-35717735 GGGTGTTTGTGAATGAGGACTGG + Intronic
1006799100 6:36748198-36748220 GTGAGTTGGGGGATGGGTAGAGG - Intronic
1006980126 6:38140974-38140996 GTGTGGGTGGGGGTGGGGGCGGG - Intronic
1006999733 6:38298998-38299020 GTGGGGTGGGGGATGGGGAGAGG - Intronic
1007514485 6:42400529-42400551 GGGTGATTGGGGTTGGGGAAAGG - Intronic
1007960199 6:45951872-45951894 GTGTGTTTGGGGAGGGACATGGG - Intronic
1008936493 6:56997961-56997983 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1011698039 6:89930740-89930762 GTGTGATTCGGGAAGGGGACAGG + Exonic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012623648 6:101379353-101379375 GTGTGTGTGTTGTTGGGGACAGG - Intergenic
1012736461 6:102951694-102951716 GTGTGTTAGGGTATGAAGACAGG - Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1012941550 6:105420991-105421013 GTGGGGTTGGGGGTGGGGAGAGG + Intergenic
1012970902 6:105729276-105729298 GTGTGCCTGGGGATTGGGGCTGG + Intergenic
1013346555 6:109266015-109266037 GTGTGTGTGGGGTGGGGTACTGG - Intergenic
1013359507 6:109381836-109381858 GTGGGGTTGAGGATGGGGCCGGG - Intronic
1013547628 6:111174360-111174382 GTGTGTTGGGGGGTGGGGGGCGG - Intronic
1014296259 6:119621217-119621239 GTGTGTTTGGGGCTGGGGTAGGG - Intergenic
1015054142 6:128878913-128878935 CAGTGTTTGGAGGTGGGGACAGG + Intergenic
1015885935 6:137918805-137918827 GAGTGGGTGGGGATGGGGAGTGG - Intergenic
1016202969 6:141435025-141435047 GCCTGTTGGGGGATGGGGAGTGG + Intergenic
1016386579 6:143536364-143536386 GTGTGGGTGCGGATGGGGAAGGG + Intergenic
1016514029 6:144873860-144873882 TGGTGGTTGGGGGTGGGGACAGG - Intergenic
1016922206 6:149306815-149306837 TTGTGGGTGGGGATGGGGAGAGG + Intronic
1017048912 6:150372372-150372394 GTGTGTGTGGGGGTGGGGTGGGG + Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017371605 6:153716011-153716033 GTGTAGTTGGAGGTGGGGACAGG - Intergenic
1017680670 6:156861171-156861193 GTGTGTTTGGTGGTGGGGAGGGG + Intronic
1018035391 6:159877202-159877224 GTATGTTGAGGGATGGTGACTGG - Intergenic
1018108192 6:160509046-160509068 GTGTGTGTGTAGATGGGGGCAGG - Intergenic
1018135650 6:160776210-160776232 GTGTGTGTGTGGATGTGGGCAGG + Intergenic
1018399617 6:163409769-163409791 GTGTGTGTTGGGATGGGGAGTGG - Intergenic
1018715513 6:166529798-166529820 GTGTGTTTGGGGGCGGGGAGAGG - Intronic
1018953029 6:168391404-168391426 GTGTGGTGGGGGATGAGGTCAGG - Intergenic
1018953037 6:168391431-168391453 GTGTGTTGGGGCATGAGGACAGG - Intergenic
1018953048 6:168391485-168391507 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953081 6:168391621-168391643 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953139 6:168391837-168391859 GTGTGCTGGGGGATGAGGACAGG - Intergenic
1018953146 6:168391864-168391886 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953155 6:168391891-168391913 GTGTGCTGGGGGATGAGGACAGG - Intergenic
1018953162 6:168391918-168391940 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953181 6:168392000-168392022 GTATGCTGGGGGATGGGGACAGG - Intergenic
1018953190 6:168392027-168392049 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1018953196 6:168392054-168392076 GTATGCTGGGGGATGGGGACAGG - Intergenic
1018953211 6:168392107-168392129 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1018953217 6:168392134-168392156 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953241 6:168392214-168392236 GTGTGCTGAGGGATGAGGACAGG - Intergenic
1018953246 6:168392241-168392263 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953267 6:168392324-168392346 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953293 6:168392406-168392428 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1018953302 6:168392433-168392455 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953312 6:168392460-168392482 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953322 6:168392487-168392509 GTGTGCTGGGGGATGGGGACAGG - Intergenic
1018953332 6:168392514-168392536 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1018953341 6:168392541-168392563 GTGTGCTGGGGGATGGGCACAGG - Intergenic
1018953350 6:168392568-168392590 GTGTGCTGGGGGATGAGGACAGG - Intergenic
1018990546 6:168670466-168670488 GTGTGCTTCAGGATGGGCACGGG + Intronic
1019248619 6:170727483-170727505 GTGTCTTTGGGGATGATGACTGG - Intergenic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1019811337 7:3167368-3167390 GTGGGGATGGGGATGGGGATGGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1019828005 7:3300477-3300499 GTGGGGCTGGGGGTGGGGACGGG - Intergenic
1020046842 7:5046510-5046532 GTGTGTTTGGGTTTGAGGGCAGG + Intronic
1020218239 7:6212430-6212452 GGGTGCCTGGGGATGGGGAAAGG - Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1021279504 7:18700224-18700246 TTGTGTATGGCGATGGGGAGAGG + Intronic
1021463151 7:20911735-20911757 GTTTGTTTGGTTATGGAGACAGG - Intergenic
1021865393 7:24951594-24951616 GTGTGTGTGGGTAGGGGGAAGGG - Intronic
1022100377 7:27165800-27165822 GTGTGTATGGGGGGGGAGACGGG - Intronic
1022224062 7:28345469-28345491 TTGTGATGGGGGATGGGGATGGG + Intronic
1022470176 7:30677147-30677169 GTGGGTTTGGAGATGGAGTCGGG + Intronic
1022518714 7:30992128-30992150 GTGTGTTGGGGGGCGGGGCCGGG - Intronic
1022942224 7:35251960-35251982 GTGTGTGTGGGCATGGGGGTAGG + Intronic
1023109746 7:36797248-36797270 GTGTGCTTGGTGAAGGGGGCAGG - Intergenic
1023140207 7:37094482-37094504 TTGTGCTTGGGGATGGGGTGGGG - Intronic
1023340756 7:39216923-39216945 GTGTGTGTGTGGGTGGGGAGGGG - Intronic
1023658302 7:42448379-42448401 GTGTGTCTGGGGAGGTGGGCTGG + Intergenic
1024039826 7:45543651-45543673 GTGTGTGTGTGGATTGGGTCAGG + Intergenic
1024427490 7:49244175-49244197 GTGTGTTGGTGGCTGGGGAAGGG - Intergenic
1024514274 7:50231583-50231605 GTGGGGTGGGGGATGGGGAAGGG - Intergenic
1024572230 7:50732775-50732797 GTGTGTGTGTGTTTGGGGACAGG + Intronic
1024599726 7:50969929-50969951 GAAAGTTTGGGGATGGGGCCAGG + Intergenic
1024866698 7:53911542-53911564 GTGTGCATGTGGATGGGGGCGGG - Intergenic
1026159518 7:67856320-67856342 GTGTGTGTGGGGGTGGGCATTGG + Intergenic
1026390695 7:69898644-69898666 GTGTGGTTGGGGATGAGGGGAGG - Intronic
1026549673 7:71357407-71357429 GGGTGTGGGGGGATGGGGAATGG - Intronic
1026848037 7:73708564-73708586 GAGTGTGTGGGGCGGGGGACGGG - Intronic
1027112995 7:75455650-75455672 ATATGTTTGGGGCTGAGGACAGG - Intronic
1027285242 7:76640261-76640283 ATATGTTTGGGGCTGAGGACAGG - Intergenic
1028405430 7:90468957-90468979 GTGTGGTTGGGGAGGGGTAGAGG - Intronic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1029240065 7:99154008-99154030 GTGTTTTTTGGGAGGGGGAGGGG - Intergenic
1029423571 7:100483839-100483861 GTGGGTTTGGGGCCGGGGGCGGG + Intergenic
1029443839 7:100602319-100602341 GGGTGTGTGGGCGTGGGGACTGG - Exonic
1029491116 7:100870598-100870620 ATGTGGTTGGGGATGGGGCTGGG + Exonic
1029714985 7:102320761-102320783 GGGTGTATGGGGGTGGGGACAGG + Intronic
1029729386 7:102429513-102429535 TTGAGTTTGTGGAAGGGGACAGG + Intergenic
1030083420 7:105797332-105797354 GGGTGGTTGGGGTTGGGGTCCGG - Intronic
1030310265 7:108061774-108061796 GTGTGTTGGTGGATGAGGATTGG + Intronic
1030335363 7:108319653-108319675 GAGTGTGTGGTGATGGGAACCGG + Intronic
1030589699 7:111465452-111465474 AATTGTTTGGGGATGGGGAGGGG + Intronic
1030670148 7:112326363-112326385 GTGTGTTTTGGGGTGGGGGAAGG - Intronic
1030987465 7:116259376-116259398 GTGTGTGTGGTGGTGGGGAGTGG - Intergenic
1031143311 7:117969549-117969571 GTGGGGTTGGGGAAGGGGGCAGG + Intergenic
1031602049 7:123721995-123722017 GTGGCTTTGGGGGTGGGGGCAGG + Intronic
1031943482 7:127814284-127814306 CTGTGTTTGGGGGTAGGGAGAGG + Intronic
1032158735 7:129493220-129493242 GTGTGTGTGGTGGTGGGGATGGG + Intergenic
1032268256 7:130383221-130383243 GTGGGTTTGGGGCTGGGGGCTGG - Intronic
1032388492 7:131540569-131540591 GTGTGTGTGTGCCTGGGGACAGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033369666 7:140696843-140696865 GTGAGTGTGGGGCTGGGGATGGG + Intronic
1033761056 7:144437184-144437206 GTTTATTTGGGGAAGGGGAGAGG + Intergenic
1033882588 7:145903283-145903305 GTGTGCTTGGGGAGGGGGATGGG + Intergenic
1034055047 7:148025412-148025434 GTGGGTAGGGGGATGGGGAATGG - Intronic
1034400785 7:150860289-150860311 GTGCATTTGGGGAGGGGGGCGGG + Intronic
1034827759 7:154282104-154282126 GTGTGTTGAGGGGTGGGGACAGG + Intronic
1034830003 7:154300661-154300683 GTGTGTGTGGGGTTGGGGCAAGG + Intronic
1035205126 7:157289979-157290001 GTGTGTTTGGGGGTGGGGGGGGG + Intergenic
1035499427 8:79852-79874 GTGTCTTTGGGGATGATGACTGG + Intergenic
1035720236 8:1785901-1785923 GTGTGAGTGGGGCTGGGGTCTGG - Exonic
1035735396 8:1883655-1883677 GTTTATTTGGTGATGGAGACGGG + Intronic
1036709218 8:11067699-11067721 GGGAGTTTGGGGAGGGGGCCCGG - Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037275863 8:17177778-17177800 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1037401640 8:18500053-18500075 GGGTGGTATGGGATGGGGACAGG + Intergenic
1038014146 8:23498964-23498986 GTTTGTTTTGAGATGGGGTCTGG - Intergenic
1038704507 8:29880964-29880986 GTGGGAGTGGGGATGGGGATGGG + Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1039472475 8:37821949-37821971 GTGTTGTTGGGGACGGGGAGGGG - Intronic
1039748563 8:40455816-40455838 GTGTGTTTGGTGAGGGAGCCAGG - Intergenic
1040601780 8:48891930-48891952 ATGGGGATGGGGATGGGGACTGG - Intergenic
1040601788 8:48891948-48891970 ATGGGTTTGGGGATGAGGATGGG - Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041645050 8:60243152-60243174 GTGTATGTGGGGATGCTGACTGG - Intronic
1041696053 8:60737600-60737622 ATGTGTTTGGGGGTGAGGAGGGG - Intronic
1042155437 8:65840972-65840994 GTGTGTATGGGAAGGGGGACAGG + Intronic
1042401602 8:68355231-68355253 GTGTGTTTGGTGGTGGGGCAGGG - Intronic
1042667214 8:71220417-71220439 CTGTGTTTGGGGATCTGGCCTGG + Intronic
1042841064 8:73124347-73124369 TTGTGTTAGTGGATGGGGAAAGG - Intergenic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043208295 8:77475800-77475822 GCGTGTTGGGGGATGGGGCCTGG - Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1043958151 8:86386478-86386500 GTGTGTTTGGGTGGGGGGGCGGG + Intronic
1043998184 8:86844700-86844722 GCCTGTTAGGGGGTGGGGACTGG - Intergenic
1044112886 8:88298244-88298266 GGGTGTTTGGGGAAGGGAAGTGG - Intronic
1044381774 8:91542170-91542192 GTGTGTTTGAGGAAGAGCACGGG + Intergenic
1046195992 8:110863083-110863105 GTGTGTATGTGGATGGGGAGGGG - Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1047005918 8:120620649-120620671 GTGTGTGTGGGGGTGGGGGTGGG - Intronic
1047024392 8:120811127-120811149 GTGTGTTGGGGGGGGGGGAAGGG - Intronic
1047117398 8:121859254-121859276 ATGTGTCTCGGGATGGGGGCTGG - Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047885297 8:129243678-129243700 GTGTGTGTGGGGGCGGGGGCAGG + Intergenic
1047894859 8:129355376-129355398 GTGAGTTTGGTGATGGAGATAGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048377651 8:133836714-133836736 GTGTGGTGGGGGATGTGGAAAGG + Intergenic
1048832134 8:138487627-138487649 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
1049310626 8:141931919-141931941 GTGAGGTTGGGGAGAGGGACAGG - Intergenic
1049469538 8:142769218-142769240 GAGGGTTGGGGGATGGGGAGGGG + Intronic
1049645619 8:143734365-143734387 GTGTGGTGGGGGTTGGGGTCTGG - Intergenic
1050070973 9:1813834-1813856 GTGTTTTAGGGGATGGGTAAGGG - Intergenic
1050105896 9:2166418-2166440 GTGTGTTCTGGGGTGGGGAGTGG - Intronic
1050515050 9:6434834-6434856 ATGTTTTGGGGGGTGGGGACCGG + Intronic
1051176900 9:14370061-14370083 GGGTGTTTGGAGATGGCGAATGG - Intronic
1051179550 9:14395894-14395916 GTGTGGGTGGGGGTGGGGATCGG + Intronic
1051410695 9:16786854-16786876 GTGAGTTTTGGGATGGGGGAAGG - Intronic
1051502246 9:17790577-17790599 ATGAATTTGGGGATGGGGAGGGG - Intronic
1052041050 9:23739542-23739564 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1052206608 9:25848714-25848736 GTGTGTGTGGGGTTGGGGGGTGG - Intergenic
1052287722 9:26805839-26805861 GTGTGTCAGGGGACGAGGACTGG - Intergenic
1052855429 9:33403574-33403596 GTGTGTGCAGGGGTGGGGACTGG - Intergenic
1052860334 9:33434273-33434295 GTGTGTGTGGAGGTGGGCACAGG - Intergenic
1053229761 9:36397958-36397980 GTGTGTTTGGAGAGAGGGAGAGG - Intronic
1053683443 9:40499917-40499939 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1053933422 9:43128232-43128254 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054280272 9:63125011-63125033 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054296546 9:63335415-63335437 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054394564 9:64639920-64639942 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054429213 9:65145119-65145141 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054501171 9:65876416-65876438 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055769226 9:79699319-79699341 TTGTTTTTGGTGATGGGGACAGG - Intronic
1056483661 9:87032283-87032305 CTGTGATTGTGGATGAGGACCGG + Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056689471 9:88794400-88794422 GTGTGCTTGGGGTTGCGGAGGGG - Intergenic
1057031171 9:91776263-91776285 GTGGGTCTGGGGATGGGGAGGGG - Intronic
1057229057 9:93308014-93308036 GTGAGTCTGGGGATGGGCAGCGG + Intronic
1057380510 9:94563219-94563241 GTCTGTGTGGGGATGGGCAGGGG - Intronic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1057804671 9:98211657-98211679 AAGTGTTTGGAGATGGCGACCGG - Intronic
1059165404 9:112072511-112072533 GTGTGTTGGGAGAGGGGGAGGGG - Intronic
1059332087 9:113542106-113542128 CTGTGTGTGGGGGTGGGGATGGG + Intronic
1059621540 9:116011181-116011203 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1059982240 9:119785624-119785646 GTGTGTTTGGGAGAGGGCACTGG + Intergenic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060401388 9:123351503-123351525 GTGAGTTAGTGGATGGGGCCTGG + Intergenic
1061327950 9:129875437-129875459 GTCTGGTTGGTGATGGGGCCTGG - Exonic
1061519769 9:131111296-131111318 GTGTCTTGGGGGAGGGGCACGGG + Intronic
1061610591 9:131742839-131742861 GTGTGTTTTGGGGTTGGGCCTGG - Intergenic
1061825376 9:133255520-133255542 GTGTGATTTGAGGTGGGGACGGG + Intronic
1061932724 9:133841586-133841608 GGGTGTTTGGGGACGGAGCCTGG - Intronic
1062362859 9:136195748-136195770 GGGGGTTGGGGGGTGGGGACGGG + Intergenic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1203688726 Un_GL000214v1:21888-21910 GCGTGTTGGGGGGTGGGGGCGGG + Intergenic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203473031 Un_GL000220v1:125169-125191 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1203609578 Un_KI270748v1:84747-84769 GTGTCTTTGGGGATGATGACTGG - Intergenic
1203647549 Un_KI270751v1:82165-82187 GCGTGTTGGGGGGTGGGGGCGGG - Intergenic
1203655958 Un_KI270752v1:25050-25072 GTGTGTTGGGGGGAGGGGTCGGG - Intergenic
1185461079 X:333040-333062 GTGTGTTGGGGGGTGGTGTCCGG + Intergenic
1185884822 X:3773153-3773175 GAGTGTTAGAGGTTGGGGACAGG - Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187128956 X:16482229-16482251 GGGTGTGGGGGGAGGGGGACTGG + Intergenic
1187192219 X:17045953-17045975 GTGTGTGTGGGTGTGGGGAATGG + Intronic
1187792837 X:22969756-22969778 GAGGGTTTGGTGATGGGGAAAGG - Intergenic
1187832639 X:23398460-23398482 TTGCTTTTGGGGATGGGGAAGGG + Exonic
1187951649 X:24476589-24476611 CTGTGTTTGGGGGTGGGGAGGGG - Intronic
1188726077 X:33583816-33583838 CTGTGTGTGGGGGTGGGGAGGGG - Intergenic
1189252782 X:39614027-39614049 GTGTGTTTGGCGGGGGGGAGCGG - Intergenic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1190274862 X:48893138-48893160 GTGTGGGGGGGGATGGGGTCAGG + Intergenic
1190334694 X:49255294-49255316 GCATGTTTGGAGCTGGGGACAGG + Intronic
1191221858 X:57998159-57998181 GTGGATTTGGTGATGGGGTCGGG + Intergenic
1191717471 X:64203730-64203752 GTGGGTTTGGGTGTGGGGAAGGG + Intronic
1191836670 X:65470473-65470495 GTGTGTGTGAGGATGGGTTCTGG + Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192159745 X:68775624-68775646 GTGGGTTTGGGGAGGAGCACAGG - Intergenic
1192301059 X:69903566-69903588 GTGTGTGTGCGGAGGGGGCCTGG - Intronic
1192411080 X:70932928-70932950 GAGTGTCTGGGAATGGGTACAGG - Intergenic
1192828936 X:74729922-74729944 GTGTGTTTGGGGTGGGGGGGAGG + Intergenic
1193834809 X:86329054-86329076 GTGTATGTGCGGATGGGGAGGGG + Intronic
1193896739 X:87123418-87123440 ATGTGTGTGGGGGTGGGGAGAGG + Intergenic
1193926318 X:87489721-87489743 GTGTGTCTGGGGGTGGGGTGGGG + Intergenic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1194290331 X:92064133-92064155 GTGTGGTGGGGGTGGGGGACTGG + Intronic
1195239406 X:102936195-102936217 GTGTGTCTGTGTATGGGGGCAGG - Intergenic
1195298301 X:103501866-103501888 GTGTGTCTGTGTATGGGGGCAGG + Exonic
1195339055 X:103887198-103887220 ATGTGTTGGGGGATAGGGATGGG + Intergenic
1195397353 X:104425768-104425790 GGGGGTTTGGTGATGGTGACTGG - Intergenic
1195992115 X:110693149-110693171 GTGTGTGTGGGGGTGGGGGCAGG + Intronic
1196016730 X:110947517-110947539 GTGTGTGTGTGGATGGGGAGAGG - Intronic
1197013836 X:121599945-121599967 GTGTGCTTGAGGATGGGGGATGG - Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198531365 X:137551683-137551705 GTGTGTTTGGGGCAGGGGGTGGG + Intergenic
1198585071 X:138111286-138111308 GTGTGGTGGGGGATGGGGTAGGG + Intergenic
1198703364 X:139420479-139420501 GTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1198795720 X:140391731-140391753 GTGTGTTGAGGGGTGGGGATTGG + Intergenic
1199255271 X:145712337-145712359 CTGGGGTTGGGGATGGGAACAGG - Intergenic
1199521733 X:148743557-148743579 GTGTGTATCGTGATGGGGAGTGG + Intronic
1199533263 X:148873085-148873107 GTTTTATTGGGAATGGGGACAGG + Intronic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1200391497 X:155950880-155950902 GTGTAGTTGTGGTTGGGGACAGG + Intergenic
1200391539 X:155951094-155951116 TTGGGTTTGGGGTTGGGGGCAGG + Intergenic
1200607845 Y:5288737-5288759 GTGTGGTGGGGGTGGGGGACTGG + Intronic