ID: 902974343

View in Genome Browser
Species Human (GRCh38)
Location 1:20078165-20078187
Sequence GGTCACCTCCTCAGTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974343_902974352 6 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974352 1:20078194-20078216 CTTGGGCTATGCCAGGCTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 164
902974343_902974358 29 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974358 1:20078217-20078239 GGTCCCTGAGGGCAAGCTCAAGG 0: 1
1: 0
2: 0
3: 24
4: 229
902974343_902974357 18 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974357 1:20078206-20078228 CAGGCTTTGGGGGTCCCTGAGGG 0: 1
1: 1
2: 3
3: 28
4: 385
902974343_902974348 -1 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974348 1:20078187-20078209 CCCCAAGCTTGGGCTATGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 145
902974343_902974356 17 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974356 1:20078205-20078227 CCAGGCTTTGGGGGTCCCTGAGG 0: 1
1: 1
2: 9
3: 37
4: 366
902974343_902974353 7 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974353 1:20078195-20078217 TTGGGCTATGCCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 212
902974343_902974351 5 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974351 1:20078193-20078215 GCTTGGGCTATGCCAGGCTTTGG 0: 1
1: 0
2: 1
3: 15
4: 382
902974343_902974354 8 Left 902974343 1:20078165-20078187 CCTGAAGGACTGAGGAGGTGACC 0: 1
1: 0
2: 0
3: 19
4: 159
Right 902974354 1:20078196-20078218 TGGGCTATGCCAGGCTTTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974343 Original CRISPR GGTCACCTCCTCAGTCCTTC AGG (reversed) Intronic
900364952 1:2307559-2307581 GGTCACGCCCTCAGCCCCTCCGG + Exonic
900428696 1:2592179-2592201 GCTCACCACCTCAGTCACTCAGG + Intronic
900779629 1:4609281-4609303 CTTCACCTTGTCAGTCCTTCAGG - Intergenic
902220219 1:14959814-14959836 TGTCAGCTTCTCAGTCCTGCGGG - Intronic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
905020192 1:34805198-34805220 TGTCATCTGCTCAGTCCTTCTGG - Intronic
905484587 1:38286309-38286331 GGGCACCTCCTCAGCCTTTCTGG - Intergenic
906113129 1:43337872-43337894 GGTCACCTCCTGCCTCCTCCTGG + Exonic
906210938 1:44011791-44011813 GGCCACCAGCTCAGTCCTGCAGG - Intronic
908427388 1:64020635-64020657 GGTCAGCTCTTCATTCCCTCTGG + Intronic
909360012 1:74749178-74749200 GGCAAGCTCCTCAGTCCCTCAGG + Intronic
910015916 1:82523072-82523094 GGTCGCATCCTCAATCCTTCAGG - Intergenic
911730367 1:101286558-101286580 TGTCACCTCCTCCTTCCATCAGG - Intergenic
914428323 1:147599336-147599358 GGCCACCTCCTCACACCTTCGGG - Intronic
915660863 1:157403859-157403881 GGCCACTTCCTCAGCCCTTGAGG + Intergenic
918267530 1:182858827-182858849 GGTCACCTCCACAATCCAACTGG + Exonic
921506795 1:215981579-215981601 GGTCCTCTCCTCAGGCCTTGAGG + Intronic
922881509 1:228984795-228984817 TGGCACCTCCTCAGTGCTCCTGG - Intergenic
923200459 1:231705883-231705905 GGTCACCCTCTCATTTCTTCTGG - Intronic
924033166 1:239908030-239908052 GGTCATCTCCTTTGTCCTTTGGG + Exonic
1063529614 10:6818980-6819002 GCTCACCTCCTCTTTCATTCTGG - Intergenic
1064008524 10:11716439-11716461 GGTCACCTCCTGAGCGTTTCTGG - Intergenic
1064407401 10:15076285-15076307 GGCCCCCTACTCAGTCTTTCTGG - Intergenic
1066641196 10:37555954-37555976 GGTCACTTCTTCACTCCTCCAGG + Intergenic
1068944930 10:62720232-62720254 GGACATCTCCTCACCCCTTCAGG + Intergenic
1069037287 10:63658575-63658597 GGTCTCCTCCTCAGCCTTTTCGG - Intergenic
1069856681 10:71444841-71444863 GGGCACCTGCTCAGCCCTCCAGG - Intronic
1070030580 10:72673112-72673134 GGTCCCCTCCTCAGGCATACAGG + Intergenic
1075528208 10:123203423-123203445 GGTCGCCCCCTCTGTCCCTCAGG - Intergenic
1078737449 11:14033434-14033456 CGTCACCTCCTCACACTTTCTGG - Intronic
1084539625 11:69777629-69777651 GATCCCCTGCCCAGTCCTTCTGG + Intergenic
1084836607 11:71806679-71806701 GGTGACCTCCACAGCCCTCCAGG + Intergenic
1084901533 11:72313634-72313656 GTTGCCCTCCTCAGTCCTCCTGG - Intronic
1085030817 11:73269890-73269912 GGGCCCCTCCTCTGTCCTTGTGG - Intronic
1088228716 11:107650649-107650671 GCCCACCTCCTCAGTCTTCCTGG - Intronic
1089609136 11:119659890-119659912 GGTCACTTCCTCAGTTTTCCAGG - Intronic
1092402627 12:8189426-8189448 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1093748359 12:22769337-22769359 GGGGACCTCCTTAGTGCTTCTGG + Intergenic
1094053509 12:26245611-26245633 CATCAGATCCTCAGTCCTTCCGG + Intronic
1101980993 12:109406797-109406819 GGTCCACCCATCAGTCCTTCTGG + Exonic
1102647996 12:114416004-114416026 AGTCAACTCCCCTGTCCTTCTGG - Intergenic
1102855924 12:116293393-116293415 GGTCACCTACGCAGGCCTACTGG - Intergenic
1104549001 12:129738927-129738949 TGGCACCACCTCACTCCTTCTGG - Intronic
1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG + Intergenic
1108143281 13:47448992-47449014 GCTTACCTCCTCAGTTCTCCTGG + Intergenic
1110170879 13:72498964-72498986 GGTCCCCTCTTCAGTCCTGAAGG - Intergenic
1119802574 14:77458440-77458462 GGTCACCTTCTCAGTGTTTGAGG + Intronic
1122128968 14:99594120-99594142 TGGCACCTGGTCAGTCCTTCCGG + Intronic
1122822213 14:104353341-104353363 GGCCTCCTCCTCAGGCCTCCTGG - Intergenic
1122947432 14:105019198-105019220 GGACATGTCCTCAGTCCGTCTGG - Intronic
1125091038 15:35793061-35793083 GGGCCCATCCTCAGGCCTTCAGG + Intergenic
1126878238 15:53067099-53067121 GATCTCCTCCTCACTCCTTGAGG + Intergenic
1128387732 15:67162655-67162677 GATCCCCTCTCCAGTCCTTCTGG + Intronic
1129174763 15:73832018-73832040 GATCCCCTCCTCAATCCTTTGGG - Intergenic
1129394035 15:75234636-75234658 GGTCCACTCCTCAGTCCCCCAGG - Intergenic
1129468769 15:75738703-75738725 GGTGACCGCCTCGGGCCTTCAGG - Intergenic
1130533924 15:84769465-84769487 GCTCACTTCCTCACTTCTTCAGG - Intronic
1131228377 15:90643445-90643467 ACTCACCTGCTCAGCCCTTCCGG - Intronic
1132633937 16:933725-933747 GGTCACATCCACCGTCCTCCCGG + Intronic
1134218202 16:12332780-12332802 GGTCTCCTCGTCAGTCCTCACGG + Intronic
1135741027 16:24975347-24975369 GGCCACCTCCTCTGTTCTTATGG - Intronic
1140032729 16:71351252-71351274 GCTCACCTCCTCCCTCCTCCTGG + Intergenic
1140056728 16:71531918-71531940 AGTCACCTCTTCAGTCTTTGCGG + Intronic
1144369243 17:14574372-14574394 GGCCACCTCTTCAGCACTTCTGG + Intergenic
1146432741 17:32813408-32813430 GATCACCTTCTCGGTCCTTGAGG - Intronic
1148683821 17:49489694-49489716 AGGCAGCTCCGCAGTCCTTCAGG + Intergenic
1148726821 17:49798452-49798474 GATCACTGCCTGAGTCCTTCAGG - Exonic
1149591192 17:57831048-57831070 GGTGACCTCCTCTGCCCTCCCGG - Intergenic
1150107011 17:62469663-62469685 GGCCACCTCCTCACTCCCCCAGG - Intronic
1152018995 17:77770742-77770764 GGTGCTGTCCTCAGTCCTTCGGG - Intergenic
1152367104 17:79862591-79862613 GTTCCCCTCCTCAGTCCCTGGGG - Intergenic
1156865631 18:41885929-41885951 GCTCCCCACCTCTGTCCTTCAGG - Intergenic
1157556552 18:48616458-48616480 GGTGGCCTGCTCAGTCCCTCAGG - Intronic
1161651856 19:5490620-5490642 AGTCACCTCCTCTGACCTCCAGG + Intergenic
1162935116 19:13978319-13978341 GGTCCCCTCCACTGTCCGTCAGG - Intronic
1163084321 19:14968507-14968529 GGCCACATCATCTGTCCTTCAGG - Exonic
1164291503 19:23873146-23873168 AGTCACCTCCTCAGTTATTTAGG - Intergenic
1164301737 19:23968204-23968226 AGTCACCTCCTCAGTTATTTAGG - Intergenic
1164745936 19:30613102-30613124 TGTCACGTCCTCAGTGCATCCGG + Intronic
1165316829 19:35060859-35060881 GGTCCCCTCCTCTGTCCTCCTGG - Intronic
1165360830 19:35335985-35336007 GCTCACGTCCTCAGTCCCCCAGG + Intronic
1165866525 19:38942823-38942845 TGGCACCTCCTCAGTCCTTTGGG - Intronic
925819700 2:7787897-7787919 GTTCACTTCCTCTGTCGTTCTGG + Intergenic
926754611 2:16225154-16225176 GGTCTACTCCTCACTCCTTGAGG + Intergenic
927981092 2:27375697-27375719 GGTCACCTCCTCTGTGAGTCGGG + Exonic
929863900 2:45701616-45701638 GGTGCCCTCCTCTGTACTTCAGG - Intronic
934988062 2:98901452-98901474 GGTCATCTGCTCTGCCCTTCAGG - Intronic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
937811655 2:126206027-126206049 GTTCACCTCCTCAGTTCAGCTGG + Intergenic
938942205 2:136179144-136179166 GGTCCTCTCCTCAGAGCTTCAGG + Intergenic
939613101 2:144332872-144332894 AGTCACCTTCTCTTTCCTTCTGG + Intergenic
940154900 2:150645315-150645337 GGTCACCTGATAATTCCTTCAGG + Intergenic
944836497 2:203585415-203585437 GGTCAAGTCCTCAGTTCTTCTGG + Intergenic
946131545 2:217610644-217610666 GGTCACCTCCTCAGTGGCTCAGG - Intronic
946159883 2:217829655-217829677 GGACACCTCCTGAGTCCTGATGG - Intronic
946610807 2:221455611-221455633 GGCTAACTCCACAGTCCTTCTGG - Exonic
946853559 2:223930932-223930954 GGTCACCTAGGCAGTGCTTCTGG - Intronic
948635003 2:239329197-239329219 GGACCCCTTCTGAGTCCTTCTGG - Intronic
1170568923 20:17622047-17622069 GGGCACATCCTCAGCTCTTCAGG + Intronic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1171988232 20:31675692-31675714 GGTCAACACCTCAGTCCAGCCGG + Intronic
1172250530 20:33476040-33476062 GGTCACACCCTGAGTCTTTCTGG - Intergenic
1172609065 20:36235996-36236018 GGTCGCCACCTCAGTCCCTCTGG - Intergenic
1173251368 20:41365870-41365892 AGCCACCTCCTCAGCCCTTGTGG - Intronic
1175417623 20:58812076-58812098 GGTCACCTCCTCCCTGGTTCAGG + Intergenic
1175489391 20:59369206-59369228 GGTGACCTCCTCAGCCCTGGTGG - Intergenic
1175510318 20:59519694-59519716 GGTCCCCTGCACAGCCCTTCAGG - Intergenic
1175798117 20:61785119-61785141 GCTCACCACCTCAGTTCATCAGG + Intronic
1177848473 21:26319010-26319032 GGTAATCTACTGAGTCCTTCTGG - Intergenic
1179874140 21:44259071-44259093 GCTCCTCTCCTCGGTCCTTCTGG - Intronic
1181309631 22:21937626-21937648 GGACTCCTCCTCACTCCCTCTGG + Intronic
1181973862 22:26714372-26714394 GAGCACCTCCTCTGTGCTTCTGG - Intergenic
1183139828 22:35926744-35926766 TCTCACCTCCTAAATCCTTCAGG - Intronic
1184149294 22:42629177-42629199 CATCACCTCCTCTGTGCTTCTGG + Intronic
1185082848 22:48719198-48719220 GCTCACCTTCCCCGTCCTTCTGG + Intronic
1185222558 22:49636314-49636336 GGTCAGCTCCTCACTCCCTGGGG - Intronic
1185263687 22:49886047-49886069 GGTGACCTCCACCGGCCTTCAGG + Exonic
950423759 3:12913783-12913805 GGGCACGTCCCTAGTCCTTCAGG - Intronic
951779286 3:26345587-26345609 GGTCACTTCAGCAGTCCTACAGG + Intergenic
953087858 3:39689969-39689991 GGACACCTCTGCAGTCCTTGAGG - Intergenic
953979648 3:47407233-47407255 GGACACCCCCTCAGTCCTACCGG - Intronic
955235464 3:57135236-57135258 CTTCACCTCCTCAGTGCTCCAGG - Intronic
957480627 3:80788846-80788868 GTTCACATCATCAGTTCTTCTGG + Intergenic
959398499 3:105869875-105869897 TGTCTCCTCCTCAGTCATTTAGG - Intergenic
960918999 3:122727430-122727452 TCTCACCACCTCAGTCCTTCTGG - Intronic
962164779 3:133037991-133038013 GGTCTCCACCCCAGACCTTCTGG + Intergenic
962898645 3:139737768-139737790 GGTCAGCCCCTCTGTCCTGCAGG + Intergenic
964381679 3:156103922-156103944 GGTAACATCCTGAGTCCTTCTGG + Intronic
966167448 3:177036352-177036374 CGTCACCTTCTCATTCCATCTGG + Intronic
967649696 3:191971733-191971755 AGTCACTTCCTCAGTTCTTGGGG + Intergenic
967935770 3:194726209-194726231 TGTCACCTCCTCTGTTCCTCTGG + Intergenic
968938002 4:3623706-3623728 AGTCACCTGCTCTGTCATTCTGG - Intergenic
969778016 4:9374200-9374222 GGTGACCTCCACAGCCCTCCAGG + Intergenic
985616124 5:923026-923048 GGTCACGTCCTCAGACCTCAGGG + Intergenic
986064773 5:4224331-4224353 GGTCACCTCTTCACCTCTTCAGG + Intergenic
987098915 5:14575275-14575297 GCTGACCTCCTCAATCCCTCTGG + Intergenic
990296425 5:54406064-54406086 AGTGCCCTCCTCAGTGCTTCTGG - Intergenic
999807147 5:155092691-155092713 CCACACCTCCTCAATCCTTCAGG - Intergenic
1002212422 5:177606868-177606890 GGTCATCTCTTCAGGCCTTCAGG + Intronic
1003964876 6:11243191-11243213 GGCCTCCTGCTCAGTCCTCCAGG + Intronic
1006137288 6:31902642-31902664 AGTAACCGCCTCAGCCCTTCAGG + Intronic
1006354771 6:33548756-33548778 GCTCACCGCCACTGTCCTTCAGG - Intergenic
1014538087 6:122640668-122640690 GTTCACCACCTGAGTCCTTCTGG - Intronic
1018222275 6:161593252-161593274 GATCACCTCCTTAGTCCTTACGG + Intronic
1018309336 6:162492107-162492129 GGTCTCCTCTTCTGTACTTCTGG + Intronic
1022555385 7:31289592-31289614 TGTCACCTTCTCAGTTCTTGTGG + Intergenic
1023100877 7:36717153-36717175 GGCCACGTCCTCAGGTCTTCTGG + Intronic
1032036062 7:128522211-128522233 GGCCACCTCCTCACTCCCCCAGG - Intergenic
1032844194 7:135738738-135738760 GGTCACCTCCACAGCCCCTCTGG + Intronic
1035130903 7:156652052-156652074 GGTCTCCTCCGCACTCCTCCAGG - Intronic
1036275471 8:7348170-7348192 GGTGACCTCCACAGCCCTCCAGG + Intergenic
1036345883 8:7962188-7962210 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1036841211 8:12122941-12122963 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1036863017 8:12369193-12369215 GGTGACCTCCACAGCCCTCCAGG - Intergenic
1037025642 8:14033291-14033313 GGTCACCTTCACAGTCTTCCAGG + Intergenic
1037781352 8:21871375-21871397 TGACACCCCCTCAGTACTTCGGG - Intergenic
1038535677 8:28351522-28351544 AGTCAGCTCCTGGGTCCTTCTGG - Exonic
1038650551 8:29399249-29399271 AGTCACTTGCTCAGTCCTTTAGG + Intergenic
1040887963 8:52285657-52285679 GGTCACAGCCTGAGTCCCTCTGG - Intronic
1048335666 8:133500326-133500348 AGGCACCTCCTCCCTCCTTCTGG - Intronic
1048598859 8:135897099-135897121 GGTCTCCTTCTGACTCCTTCAGG - Intergenic
1052851475 9:33380927-33380949 GCTCACTCCCTCACTCCTTCAGG + Intergenic
1054453168 9:65414000-65414022 AGTCACCTGCTCTGTCATTCTGG + Intergenic
1056246104 9:84697067-84697089 TCTCACCTCGTCAGTCCCTCAGG - Intronic
1060937230 9:127522599-127522621 GGTCACCCCCTCCCTGCTTCAGG + Intronic
1061215364 9:129218567-129218589 GGTCACCTCCTCAGTTTTCCTGG - Intergenic
1061368520 9:130185155-130185177 GGCCTCCTCCTCAGTCCTGGTGG + Intronic
1061369944 9:130192532-130192554 GGTCAACTCCTGAGACCTCCAGG - Intronic
1188303772 X:28537397-28537419 GGTCACCTCTTAATTTCTTCAGG + Intergenic
1189676189 X:43463092-43463114 TGACAACTCCTCAGACCTTCTGG + Intergenic
1190711750 X:53076635-53076657 GCTCACCTCCTCAGGCTCTCCGG - Exonic
1190874547 X:54450286-54450308 CTTCTCCTCCTCAGTCCTTGGGG + Exonic
1191108409 X:56786872-56786894 GGTCACCAGTTTAGTCCTTCTGG + Intergenic
1191110719 X:56801534-56801556 GGTCACCAGTTCAGTCCCTCTGG + Intergenic
1193793140 X:85841073-85841095 GGGCACATCCTCAGACCTCCAGG - Intergenic
1198950800 X:142069419-142069441 GGTTACCACCTAATTCCTTCTGG + Intergenic
1200344666 X:155436121-155436143 GGTCACCACCTGAGACATTCGGG + Intergenic
1201471210 Y:14336731-14336753 GTAAACCTCCTCTGTCCTTCTGG - Intergenic
1201685996 Y:16703029-16703051 GGTGACCTGCTGAGTCTTTCAGG - Intergenic