ID: 902974473

View in Genome Browser
Species Human (GRCh38)
Location 1:20078966-20078988
Sequence ACAGTGGGCACCACCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5761
Summary {0: 2, 1: 7, 2: 76, 3: 635, 4: 5041}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974473_902974480 11 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG 0: 1
1: 15
2: 157
3: 1002
4: 2899
902974473_902974476 -3 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974476 1:20078986-20079008 TGTAGTCTCAGCTACTCGAGAGG 0: 111
1: 4278
2: 76051
3: 209587
4: 275355
902974473_902974479 10 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974479 1:20078999-20079021 ACTCGAGAGGCAGAGGCAGGAGG 0: 3
1: 212
2: 3761
3: 18251
4: 40555
902974473_902974481 18 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG 0: 1
1: 0
2: 35
3: 334
4: 2259
902974473_902974477 3 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974477 1:20078992-20079014 CTCAGCTACTCGAGAGGCAGAGG 0: 4
1: 326
2: 10522
3: 137937
4: 308700
902974473_902974478 7 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974478 1:20078996-20079018 GCTACTCGAGAGGCAGAGGCAGG 0: 16
1: 3666
2: 103830
3: 252114
4: 200476
902974473_902974482 30 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974482 1:20079019-20079041 AGGGAAGATGGCTTGAGCCCAGG 0: 9
1: 288
2: 4045
3: 24431
4: 70510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974473 Original CRISPR ACAGTGGGCACCACCATGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr