ID: 902974475

View in Genome Browser
Species Human (GRCh38)
Location 1:20078982-20079004
Sequence TCGAGTAGCTGAGACTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6399
Summary {0: 3, 1: 49, 2: 800, 3: 2267, 4: 3280}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974475_902974479 -6 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974479 1:20078999-20079021 ACTCGAGAGGCAGAGGCAGGAGG 0: 3
1: 212
2: 3761
3: 18251
4: 40555
902974475_902974482 14 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974482 1:20079019-20079041 AGGGAAGATGGCTTGAGCCCAGG 0: 9
1: 288
2: 4045
3: 24431
4: 70510
902974475_902974483 17 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974483 1:20079022-20079044 GAAGATGGCTTGAGCCCAGGAGG 0: 82
1: 1352
2: 8218
3: 25236
4: 100083
902974475_902974484 20 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974484 1:20079025-20079047 GATGGCTTGAGCCCAGGAGGTGG 0: 210
1: 1385
2: 7067
3: 54053
4: 120073
902974475_902974478 -9 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974478 1:20078996-20079018 GCTACTCGAGAGGCAGAGGCAGG 0: 16
1: 3666
2: 103830
3: 252114
4: 200476
902974475_902974480 -5 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG 0: 1
1: 15
2: 157
3: 1002
4: 2899
902974475_902974481 2 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG 0: 1
1: 0
2: 35
3: 334
4: 2259
902974475_902974485 23 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974485 1:20079028-20079050 GGCTTGAGCCCAGGAGGTGGAGG 0: 182
1: 2379
2: 23160
3: 72774
4: 142918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974475 Original CRISPR TCGAGTAGCTGAGACTACAG TGG (reversed) Intronic
Too many off-targets to display for this crispr