ID: 902974478

View in Genome Browser
Species Human (GRCh38)
Location 1:20078996-20079018
Sequence GCTACTCGAGAGGCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560102
Summary {0: 16, 1: 3666, 2: 103830, 3: 252114, 4: 200476}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974473_902974478 7 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974478 1:20078996-20079018 GCTACTCGAGAGGCAGAGGCAGG 0: 16
1: 3666
2: 103830
3: 252114
4: 200476
902974474_902974478 -8 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974478 1:20078996-20079018 GCTACTCGAGAGGCAGAGGCAGG 0: 16
1: 3666
2: 103830
3: 252114
4: 200476
902974475_902974478 -9 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974478 1:20078996-20079018 GCTACTCGAGAGGCAGAGGCAGG 0: 16
1: 3666
2: 103830
3: 252114
4: 200476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974478 Original CRISPR GCTACTCGAGAGGCAGAGGC AGG Intronic
Too many off-targets to display for this crispr