ID: 902974479

View in Genome Browser
Species Human (GRCh38)
Location 1:20078999-20079021
Sequence ACTCGAGAGGCAGAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62782
Summary {0: 3, 1: 212, 2: 3761, 3: 18251, 4: 40555}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974475_902974479 -6 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974479 1:20078999-20079021 ACTCGAGAGGCAGAGGCAGGAGG 0: 3
1: 212
2: 3761
3: 18251
4: 40555
902974474_902974479 -5 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974479 1:20078999-20079021 ACTCGAGAGGCAGAGGCAGGAGG 0: 3
1: 212
2: 3761
3: 18251
4: 40555
902974473_902974479 10 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974479 1:20078999-20079021 ACTCGAGAGGCAGAGGCAGGAGG 0: 3
1: 212
2: 3761
3: 18251
4: 40555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974479 Original CRISPR ACTCGAGAGGCAGAGGCAGG AGG Intronic
Too many off-targets to display for this crispr