ID: 902974481

View in Genome Browser
Species Human (GRCh38)
Location 1:20079007-20079029
Sequence GGCAGAGGCAGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2629
Summary {0: 1, 1: 0, 2: 35, 3: 334, 4: 2259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974473_902974481 18 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG 0: 1
1: 0
2: 35
3: 334
4: 2259
902974474_902974481 3 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG 0: 1
1: 0
2: 35
3: 334
4: 2259
902974475_902974481 2 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974481 1:20079007-20079029 GGCAGAGGCAGGAGGGAAGATGG 0: 1
1: 0
2: 35
3: 334
4: 2259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974481 Original CRISPR GGCAGAGGCAGGAGGGAAGA TGG Intronic
Too many off-targets to display for this crispr