ID: 902974482

View in Genome Browser
Species Human (GRCh38)
Location 1:20079019-20079041
Sequence AGGGAAGATGGCTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99283
Summary {0: 9, 1: 288, 2: 4045, 3: 24431, 4: 70510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974475_902974482 14 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974482 1:20079019-20079041 AGGGAAGATGGCTTGAGCCCAGG 0: 9
1: 288
2: 4045
3: 24431
4: 70510
902974473_902974482 30 Left 902974473 1:20078966-20078988 CCAGGCATGGTGGTGCCCACTGT 0: 2
1: 7
2: 76
3: 635
4: 5041
Right 902974482 1:20079019-20079041 AGGGAAGATGGCTTGAGCCCAGG 0: 9
1: 288
2: 4045
3: 24431
4: 70510
902974474_902974482 15 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974482 1:20079019-20079041 AGGGAAGATGGCTTGAGCCCAGG 0: 9
1: 288
2: 4045
3: 24431
4: 70510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974482 Original CRISPR AGGGAAGATGGCTTGAGCCC AGG Intronic
Too many off-targets to display for this crispr