ID: 902974483

View in Genome Browser
Species Human (GRCh38)
Location 1:20079022-20079044
Sequence GAAGATGGCTTGAGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134971
Summary {0: 82, 1: 1352, 2: 8218, 3: 25236, 4: 100083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974474_902974483 18 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974483 1:20079022-20079044 GAAGATGGCTTGAGCCCAGGAGG 0: 82
1: 1352
2: 8218
3: 25236
4: 100083
902974475_902974483 17 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974483 1:20079022-20079044 GAAGATGGCTTGAGCCCAGGAGG 0: 82
1: 1352
2: 8218
3: 25236
4: 100083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974483 Original CRISPR GAAGATGGCTTGAGCCCAGG AGG Intronic
Too many off-targets to display for this crispr