ID: 902974484

View in Genome Browser
Species Human (GRCh38)
Location 1:20079025-20079047
Sequence GATGGCTTGAGCCCAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182788
Summary {0: 210, 1: 1385, 2: 7067, 3: 54053, 4: 120073}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974475_902974484 20 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974484 1:20079025-20079047 GATGGCTTGAGCCCAGGAGGTGG 0: 210
1: 1385
2: 7067
3: 54053
4: 120073
902974474_902974484 21 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974484 1:20079025-20079047 GATGGCTTGAGCCCAGGAGGTGG 0: 210
1: 1385
2: 7067
3: 54053
4: 120073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974484 Original CRISPR GATGGCTTGAGCCCAGGAGG TGG Intronic
Too many off-targets to display for this crispr