ID: 902974485

View in Genome Browser
Species Human (GRCh38)
Location 1:20079028-20079050
Sequence GGCTTGAGCCCAGGAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241413
Summary {0: 182, 1: 2379, 2: 23160, 3: 72774, 4: 142918}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902974475_902974485 23 Left 902974475 1:20078982-20079004 CCACTGTAGTCTCAGCTACTCGA 0: 3
1: 49
2: 800
3: 2267
4: 3280
Right 902974485 1:20079028-20079050 GGCTTGAGCCCAGGAGGTGGAGG 0: 182
1: 2379
2: 23160
3: 72774
4: 142918
902974474_902974485 24 Left 902974474 1:20078981-20079003 CCCACTGTAGTCTCAGCTACTCG 0: 2
1: 36
2: 574
3: 1809
4: 2757
Right 902974485 1:20079028-20079050 GGCTTGAGCCCAGGAGGTGGAGG 0: 182
1: 2379
2: 23160
3: 72774
4: 142918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902974485 Original CRISPR GGCTTGAGCCCAGGAGGTGG AGG Intronic
Too many off-targets to display for this crispr