ID: 902978576

View in Genome Browser
Species Human (GRCh38)
Location 1:20107307-20107329
Sequence AAAACGAAGGTGGGTATGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902978576_902978580 4 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978576_902978585 21 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data
902978576_902978586 22 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978586 1:20107352-20107374 GCTGGGTCATGCAGAATGAAGGG No data
902978576_902978581 5 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978581 1:20107335-20107357 AAAATCATACCCACCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902978576 Original CRISPR AAAACGAAGGTGGGTATGAT TGG (reversed) Intergenic
No off target data available for this crispr