ID: 902978578

View in Genome Browser
Species Human (GRCh38)
Location 1:20107317-20107339
Sequence ATTTTTTTTAAAAACGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902978578_902978586 12 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978586 1:20107352-20107374 GCTGGGTCATGCAGAATGAAGGG No data
902978578_902978581 -5 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978581 1:20107335-20107357 AAAATCATACCCACCTTGCTGGG No data
902978578_902978585 11 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data
902978578_902978580 -6 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902978578 Original CRISPR ATTTTTTTTAAAAACGAAGG TGG (reversed) Intergenic
No off target data available for this crispr