ID: 902978580

View in Genome Browser
Species Human (GRCh38)
Location 1:20107334-20107356
Sequence AAAAATCATACCCACCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902978575_902978580 23 Left 902978575 1:20107288-20107310 CCTCATCTGTACTGTGTGGCCAA No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978573_902978580 30 Left 902978573 1:20107281-20107303 CCTGTGTCCTCATCTGTACTGTG No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978577_902978580 -5 Left 902978577 1:20107316-20107338 CCCACCTTCGTTTTTAAAAAAAA No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978578_902978580 -6 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978576_902978580 4 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data
902978579_902978580 -9 Left 902978579 1:20107320-20107342 CCTTCGTTTTTAAAAAAAATCAT No data
Right 902978580 1:20107334-20107356 AAAAATCATACCCACCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902978580 Original CRISPR AAAAATCATACCCACCTTGC TGG Intergenic
No off target data available for this crispr