ID: 902978585

View in Genome Browser
Species Human (GRCh38)
Location 1:20107351-20107373
Sequence TGCTGGGTCATGCAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902978576_902978585 21 Left 902978576 1:20107307-20107329 CCAATCATACCCACCTTCGTTTT No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data
902978577_902978585 12 Left 902978577 1:20107316-20107338 CCCACCTTCGTTTTTAAAAAAAA No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data
902978579_902978585 8 Left 902978579 1:20107320-20107342 CCTTCGTTTTTAAAAAAAATCAT No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data
902978578_902978585 11 Left 902978578 1:20107317-20107339 CCACCTTCGTTTTTAAAAAAAAT No data
Right 902978585 1:20107351-20107373 TGCTGGGTCATGCAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902978585 Original CRISPR TGCTGGGTCATGCAGAATGA AGG Intergenic
No off target data available for this crispr