ID: 902980381

View in Genome Browser
Species Human (GRCh38)
Location 1:20118466-20118488
Sequence TACCCTTGGCTGCCACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902980377_902980381 2 Left 902980377 1:20118441-20118463 CCGTTCTTGCCTGGGTAACTTTT 0: 1
1: 0
2: 1
3: 31
4: 466
Right 902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG 0: 1
1: 0
2: 1
3: 17
4: 96
902980378_902980381 -7 Left 902980378 1:20118450-20118472 CCTGGGTAACTTTTCCTACCCTT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG 0: 1
1: 0
2: 1
3: 17
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902980381 Original CRISPR TACCCTTGGCTGCCACTGAC AGG Intronic
900103958 1:974343-974365 GAACCCTGGCTGCCTCTGACAGG + Exonic
901323878 1:8355778-8355800 TGCCCTTGGGTGCCTCTGCCTGG + Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
902989291 1:20175006-20175028 TCCCCGTGGATGACACTGACAGG - Exonic
905451508 1:38060021-38060043 TACCCATGGCTGTCACTTTCAGG - Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
911285356 1:95984967-95984989 TTCCATGGGCTGCTACTGACTGG + Intergenic
923644438 1:235802411-235802433 TATGCTTGGCTGTCACAGACAGG + Intronic
1063730926 10:8696346-8696368 CATCCTTGGCTGCCATTGACTGG + Intergenic
1063936325 10:11082281-11082303 AACCGTTGGCTGCAACTGAGTGG - Intronic
1076814660 10:132908864-132908886 AGCCCTTGGCTGCCCCTGAGCGG + Intronic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1078935670 11:15947955-15947977 TACACTGGGCTACCAATGACTGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083816473 11:65135055-65135077 GTCCCGTGGCTGCCACTGATTGG + Intergenic
1085810072 11:79671972-79671994 TGCCCGAGGCTGCCACTGTCAGG + Intergenic
1088115260 11:106305362-106305384 TACCCTTAGCTTCCTCTGGCTGG - Intergenic
1088641328 11:111875979-111876001 TACCCTTTGCTGCCACAGGAAGG - Exonic
1090266788 11:125358453-125358475 TTTCCTGGGCTGTCACTGACAGG - Intronic
1101638207 12:106565108-106565130 TACCTATGGCTCCCAGTGACTGG - Intronic
1108088674 13:46822780-46822802 TACCACTGGCTGACACTGTCTGG - Intergenic
1117777109 14:59194077-59194099 TAACCTGGTCTGCCACTTACAGG - Intronic
1121273073 14:92650878-92650900 GAGCCTTGGCTTCCCCTGACTGG + Intronic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1125736559 15:41930788-41930810 TTCCCATGGTTCCCACTGACTGG - Intronic
1128265599 15:66264076-66264098 GACCCTTGGGTGTCACTGACAGG - Intergenic
1128531918 15:68459139-68459161 TACCCCTGGAGGCCAGTGACTGG + Intergenic
1133449226 16:5889694-5889716 TAGCATGGGCTGCCACGGACAGG - Intergenic
1136283641 16:29229065-29229087 TACCCATGGCTAGCAGTGACAGG + Intergenic
1140267722 16:73434859-73434881 TAGCCATGCCGGCCACTGACTGG - Intergenic
1142088673 16:88198576-88198598 TACCCATGGCTAGCAGTGACAGG + Intergenic
1144761839 17:17711459-17711481 GGCCCTTGGCTGCCTCTGAAAGG - Intronic
1144848254 17:18231186-18231208 TTCCCCTGACTGCCACTGCCTGG + Intronic
1144887684 17:18474788-18474810 TACCCTTGGGAGTCACTGACTGG - Intergenic
1145144532 17:20469512-20469534 TACCCTTGGGAGTCACTGACTGG + Intergenic
1145175983 17:20700914-20700936 TACCCTTGGGAGTCACTGACTGG + Intergenic
1145272807 17:21413663-21413685 TGCCCTAGCCTGTCACTGACAGG + Intronic
1145311015 17:21701126-21701148 TGCCCTAGCCTGTCACTGACAGG + Intronic
1145806899 17:27740801-27740823 TACCCTTGGGGGTCTCTGACTGG - Intergenic
1146401337 17:32502378-32502400 AGCCCTTGGCAGCCACTAACTGG - Intronic
1150315675 17:64166841-64166863 TACCCTGGGCTGCCACCTCCAGG - Intronic
1157220799 18:45827375-45827397 GACCCTTGGTAGGCACTGACAGG + Intronic
1157506224 18:48228553-48228575 CACCCTTGGCAGCCACTCTCAGG - Intronic
926056940 2:9779224-9779246 TTCTCTTGGCTGCCTCTCACTGG + Intergenic
927674103 2:25091806-25091828 TCCCCCTGGCTGCCACTCTCTGG + Intronic
928334988 2:30390326-30390348 TAGCCATGGCTCCCACTGACTGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
934738813 2:96704360-96704382 CCCCCATGGCTGCCACTCACCGG - Intergenic
936372356 2:111912773-111912795 CACCCTTGGCTGTCACACACTGG + Intronic
939070412 2:137533720-137533742 TAGCCTGGGCTGCCACTGACAGG + Intronic
941081338 2:161064155-161064177 CACTCTTGGCTGCCATTCACAGG - Intergenic
941541892 2:166796227-166796249 TACCATTGTCTGCCTCTGAGTGG + Intergenic
946475678 2:220004518-220004540 AGCCCTTGGCTTCCACTGAGGGG + Intergenic
1169862311 20:10165704-10165726 TCTGCTTGGCTGGCACTGACAGG - Intergenic
1172043126 20:32060111-32060133 TTTCCTTGGCTGCCGCTGAGTGG - Intronic
1175602440 20:60285966-60285988 TACCTTTGACTGCAACTGCCAGG + Intergenic
1177444282 21:21171587-21171609 CACCCTTGACTGCCACAGACTGG + Intronic
1179179074 21:39030219-39030241 GACCACTGGCTGCCACTGAGTGG - Intergenic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181864989 22:25847706-25847728 ATCCCTTGGCTGCCACTGGTGGG - Intronic
1184032532 22:41903398-41903420 CACACTTTGCTGCCACAGACAGG + Intronic
1184986756 22:48141108-48141130 TGCTCTTGGCTGCCACTGGCAGG + Intergenic
952616156 3:35276454-35276476 TACTCTGGGCTGCCACTATCAGG + Intergenic
953089828 3:39713457-39713479 TACCCTCCGCAGCCACTGGCCGG - Intergenic
953389479 3:42526155-42526177 AACCCTTGGCTCCCCCTGACAGG + Intronic
954307731 3:49738827-49738849 TCCCTTTGGCTGACACTGTCAGG - Intronic
961412191 3:126730514-126730536 GACCCTGGGGTGCCACTGACAGG + Intronic
966158911 3:176947742-176947764 TACTCTGGGGTGACACTGACCGG - Intergenic
969043796 4:4321932-4321954 GACTCCTGGCTGCCACTTACTGG + Intergenic
970354074 4:15235158-15235180 TTCCCTGGGCAGCCACTGATGGG + Intergenic
976336449 4:83893614-83893636 TGCCTTTGGCTGCAAGTGACAGG + Intergenic
977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
979219425 4:118204532-118204554 AACAGTTGGCTGCCTCTGACTGG + Intronic
981900410 4:149855545-149855567 TACCCTTGTCTACCACTCAGTGG + Intergenic
983401031 4:167266059-167266081 AACAGTTGACTGCCACTGACTGG - Intergenic
984807920 4:183768386-183768408 TACCCTGGGCAGACACTGAGAGG - Intergenic
989240637 5:39199761-39199783 AACCCTTGTCTGCCACTTTCTGG - Intronic
990545712 5:56818595-56818617 AACCCTTGGGCGCCACTTACAGG - Intronic
997195494 5:131976515-131976537 TAACCTGGGCTGCCATTCACAGG - Intronic
997429438 5:133827272-133827294 CACACCTGGCTGCCTCTGACAGG + Intergenic
998419469 5:141970279-141970301 TAACCTTGAGTGCCACTGGCAGG + Intronic
1002440441 5:179261814-179261836 TCCCCTTGCCTGCCACTGTGGGG - Intronic
1002716643 5:181232222-181232244 TACCATGAGCTCCCACTGACAGG - Intronic
1005260469 6:24053394-24053416 TGGTCTTGGCTGCCACTGAGTGG - Intergenic
1005460350 6:26063303-26063325 TTCCCTTAGCTGCCTCTGAAAGG + Intergenic
1013112076 6:107072148-107072170 GAGCCTTTGCTCCCACTGACAGG + Intronic
1014104572 6:117547835-117547857 TATCCCCGTCTGCCACTGACAGG + Intronic
1014946467 6:127504522-127504544 CACCCTTGGCTGCCTGTGAATGG - Intronic
1017605991 6:156133739-156133761 GACCCCTGGCAGCCACTGATTGG + Intergenic
1018824177 6:167397025-167397047 TGCCCTTGACTGCCTGTGACAGG - Intergenic
1021857250 7:24869474-24869496 CACCCCTGGCTGCAAATGACTGG - Intronic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1030777739 7:113555889-113555911 GAACTTTGGCTGCCACTGGCAGG + Intergenic
1031015654 7:116573686-116573708 CTCCCTTAGCTGCCACTGATTGG - Intergenic
1035047639 7:155979738-155979760 TAGCCCCGGCTGCCACTGCCTGG - Intergenic
1036140266 8:6201254-6201276 TTCCCTTGGTTGCCACAGCCAGG + Intergenic
1044992092 8:97805139-97805161 TGCACTTGGCTGCAACTGAATGG + Intronic
1045131944 8:99163618-99163640 CACCCTCGGCAGCCACTGGCCGG + Intronic
1050676000 9:8053681-8053703 TGCCCTGGACTGCCCCTGACCGG - Intergenic
1056795414 9:89655576-89655598 TGCCCTTGGCTGCCAGTGCCTGG + Intergenic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1062657737 9:137612987-137613009 TACCCTTGTCTGCCAGCGACAGG - Exonic
1203784681 EBV:120910-120932 TACCCCTGGCTTCCACTCACGGG - Intergenic
1187273668 X:17800957-17800979 TCCGGTGGGCTGCCACTGACAGG + Exonic
1188009813 X:25043667-25043689 GCCCCTTGGCTGCCCCTGAGAGG - Intergenic
1190983893 X:55483556-55483578 GACCCTTGGCTGCAAATGACAGG + Intergenic
1192552965 X:72068735-72068757 GACCCTTGGCAGCCAATGAGAGG - Intergenic
1199949396 X:152695381-152695403 CCCCCTTGGCTGCCACTGATAGG - Intergenic
1199954214 X:152730243-152730265 CCCCCTTGGCTGCCACTGATAGG - Intronic
1199960280 X:152773068-152773090 CCCCCTTGGCTGCCACTGATAGG + Intergenic
1200017029 X:153173654-153173676 CCCCCTTGGCTCCCACTGATAGG - Intergenic
1201603472 Y:15758424-15758446 AACCCTTGTATGCCACTGGCAGG + Intergenic