ID: 902981459

View in Genome Browser
Species Human (GRCh38)
Location 1:20126457-20126479
Sequence GTGGTCAGACAGACCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902981457_902981459 -8 Left 902981457 1:20126442-20126464 CCAGAAGGAGGCCTGGTGGTCAG No data
Right 902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG No data
902981453_902981459 2 Left 902981453 1:20126432-20126454 CCCTGGGCATCCAGAAGGAGGCC No data
Right 902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG No data
902981450_902981459 9 Left 902981450 1:20126425-20126447 CCGCAGACCCTGGGCATCCAGAA No data
Right 902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG No data
902981454_902981459 1 Left 902981454 1:20126433-20126455 CCTGGGCATCCAGAAGGAGGCCT No data
Right 902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG No data
902981447_902981459 26 Left 902981447 1:20126408-20126430 CCACATCTGGTGGGAGGCCGCAG No data
Right 902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902981459 Original CRISPR GTGGTCAGACAGACCTGACA TGG Intergenic
No off target data available for this crispr