ID: 902982676

View in Genome Browser
Species Human (GRCh38)
Location 1:20137231-20137253
Sequence CTTGGTAGGGGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1940
Summary {0: 1, 1: 0, 2: 8, 3: 123, 4: 1808}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902982664_902982676 13 Left 902982664 1:20137195-20137217 CCAGTTTATTATTGACTCATTAT 0: 1
1: 0
2: 2
3: 20
4: 284
Right 902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG 0: 1
1: 0
2: 8
3: 123
4: 1808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902982676 Original CRISPR CTTGGTAGGGGGAGGGTGGA GGG Intergenic
900072663 1:785574-785596 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900163605 1:1236072-1236094 CCTGGTGGGGTGGGGGTGGAGGG - Intergenic
900227450 1:1539926-1539948 CTTGGTAGGGGGAGCGCAGCGGG + Intronic
900526594 1:3132336-3132358 CCTGCTGGGTGGAGGGTGGATGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900654798 1:3751167-3751189 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
900943192 1:5814402-5814424 CTTTGCAGGGGGCGGGTGGCAGG + Intergenic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901663370 1:10812965-10812987 CTTAGAAGGGGAAGGGTGGTGGG - Intergenic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
901929210 1:12586069-12586091 ACTGGTAGGGGGAGGCAGGAAGG + Intronic
902614126 1:17614598-17614620 CTTGTTGGGGGGTGGGAGGAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903460968 1:23520882-23520904 CTTGGTTGGGGGAAGGTGTCAGG - Intronic
903692053 1:25181385-25181407 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
904129248 1:28263385-28263407 CTTGGAGTGGGCAGGGTGGAGGG - Intronic
904383528 1:30127097-30127119 TTTGGTTGGGGGAGGGTCCAAGG + Intergenic
904571074 1:31465646-31465668 CTTGGAAGATGGAGGCTGGATGG - Intergenic
904575154 1:31500794-31500816 CTCAGAAGGGGGAGGCTGGAGGG - Intergenic
904607401 1:31705270-31705292 CGGGGTAGGGGGAGGTTGTAGGG + Intergenic
904774430 1:32898081-32898103 GTTGGTGGGAGGAGGCTGGAGGG - Intronic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905137911 1:35814446-35814468 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905530082 1:38671055-38671077 TATGGTATGGGGAGGGTGGTGGG - Intergenic
905740908 1:40370706-40370728 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906210407 1:44009710-44009732 CTTGGTAGGGGTAAGTTGGCGGG + Intronic
906241959 1:44247796-44247818 ATAGGTGGGGGGATGGTGGAAGG - Intronic
906333920 1:44911848-44911870 GTGGGTTGGGGGAGGGGGGAGGG - Intronic
906569494 1:46824411-46824433 ATTGGTGGGTGGAGGGTGGGAGG + Intergenic
906967480 1:50472594-50472616 TTTGGTTGGGGGCGGGTGGCAGG + Intronic
907440577 1:54475825-54475847 CTTACTAGGGTGAGGGTGGGTGG - Intergenic
907904428 1:58771462-58771484 TGTGGTGGGGGGAGGGAGGAGGG + Intergenic
908074180 1:60495987-60496009 GGGGGTGGGGGGAGGGTGGAGGG + Intergenic
908306758 1:62826733-62826755 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
908598478 1:65712757-65712779 CTTGGTAGGCTGAGGCAGGAAGG + Intergenic
908725832 1:67175931-67175953 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
909697189 1:78480796-78480818 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
909811621 1:79938528-79938550 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
910156833 1:84229072-84229094 CGGGGTGGGGGGAGGGGGGAGGG - Intronic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910549049 1:88455275-88455297 CTTGGTAGGGTGAAGGTGTTGGG + Intergenic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
910882955 1:91938947-91938969 CTTGGAAGGCTGAGGTTGGAGGG + Intergenic
910949386 1:92629807-92629829 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
911306374 1:96237530-96237552 CTAGGTAGGGATAGGGTGGAAGG - Intergenic
911451404 1:98066501-98066523 TTGGGTAGGGGGATAGTGGAGGG + Intergenic
911812915 1:102307302-102307324 GGGGGTCGGGGGAGGGTGGAGGG - Intergenic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
911966352 1:104376523-104376545 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912391051 1:109303251-109303273 CTAGGTAGTGAGAGGGTGGTAGG - Intronic
913169110 1:116216232-116216254 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913301278 1:117371911-117371933 CTTGGGAGGGGGACGGGGGCGGG + Intronic
913433537 1:118822891-118822913 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
913481547 1:119293949-119293971 CTTGGTTGGGGTGGGGAGGAGGG - Intergenic
913596375 1:120381937-120381959 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
913710982 1:121483113-121483135 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
913719776 1:121580258-121580280 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
914049215 1:144117761-144117783 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
914090895 1:144497038-144497060 TTGGGTAGGGGGAGGGGGGAGGG - Intergenic
914129969 1:144847684-144847706 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
914307708 1:146437169-146437191 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
914594403 1:149135967-149135989 TTGGGTAGGGGGAGGGGAGAGGG - Intergenic
914832463 1:151180511-151180533 CCTGGGAGGGGGAGGTTGCAGGG - Intronic
914967539 1:152273893-152273915 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915001860 1:152601213-152601235 CTTGGCAGGGGCAGGGATGAGGG - Intergenic
915045988 1:153017707-153017729 TGTGGTTGGGGGAGGGGGGAGGG - Intergenic
915091787 1:153431432-153431454 CCTGGCTGGAGGAGGGTGGATGG - Intergenic
915153552 1:153855470-153855492 TTTGGGAGGGGGAAGGTGGGTGG - Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915497958 1:156294624-156294646 CTTGGTAGGGGGTGAGTGGGAGG - Intronic
915527596 1:156485625-156485647 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
915642747 1:157241909-157241931 TTGGGTAGGGGGAGGAAGGAGGG - Intergenic
915757531 1:158277292-158277314 GGGGGTAGGGGGAGGGGGGAGGG - Intergenic
915780564 1:158545327-158545349 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
915782446 1:158567643-158567665 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
915839074 1:159201091-159201113 TTTGGAATGGGGAGGGAGGAGGG + Exonic
915845920 1:159265040-159265062 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
915856405 1:159391427-159391449 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915858269 1:159413689-159413711 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915881865 1:159680989-159681011 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
915887327 1:159736412-159736434 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915943431 1:160133480-160133502 GTTGGGATGGGGAGGGTGGCTGG - Intronic
916097507 1:161364214-161364236 CATGGTAGTGGGTGGGTGGGGGG + Exonic
916291266 1:163169003-163169025 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
916602873 1:166311022-166311044 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
916723876 1:167505729-167505751 TCTGGTAGGGGGAGTGGGGAGGG + Intronic
916974583 1:170062013-170062035 CGTGGTGGGGAGAGGGGGGAGGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917072183 1:171163853-171163875 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
917244909 1:172989642-172989664 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
917295661 1:173516459-173516481 ATTGGAGGGTGGAGGGTGGAAGG - Intronic
917434063 1:175000578-175000600 CTTGGTAGAGGGCGGTTGGAAGG + Intronic
917453616 1:175167469-175167491 AGTGGTGGGGTGAGGGTGGATGG + Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917780247 1:178387515-178387537 TGGGGTAGGGGGAGGGGGGAAGG - Intronic
917997846 1:180460122-180460144 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918703884 1:187637774-187637796 ATTGGAAGGTGGAGGCTGGATGG - Intergenic
918812280 1:189137820-189137842 CCTGTTATGGGGTGGGTGGAGGG + Intergenic
918935805 1:190919266-190919288 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
918974453 1:191463962-191463984 TATTGTCGGGGGAGGGTGGAAGG + Intergenic
919002639 1:191853386-191853408 ATGGGTTGGGGGAGGGGGGAGGG - Intergenic
919193764 1:194257114-194257136 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
919210936 1:194484879-194484901 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919211485 1:194492765-194492787 TCTGGTGGGGGGAGGGGGGAGGG - Intergenic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919224747 1:194682373-194682395 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
919259971 1:195179443-195179465 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919321604 1:196047633-196047655 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919598719 1:199596442-199596464 CCTGGTGGGGGGTGGGAGGAGGG - Intergenic
919788578 1:201275755-201275777 CTTGGCAGGTGGATGGGGGAGGG - Intergenic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
919975557 1:202609018-202609040 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920405213 1:205703966-205703988 CTGGTTAGGTGGTGGGTGGAGGG - Intergenic
920799699 1:209174459-209174481 TTTGGTAGCAGGTGGGTGGAGGG + Intergenic
921403258 1:214749927-214749949 TTCGGTGGGGGGAGGGGGGAGGG + Intergenic
921522627 1:216175804-216175826 CTTGGTAGAGGGACTGTGGTTGG - Intronic
921620563 1:217321960-217321982 CTTGGTATAGTCAGGGTGGAAGG - Intergenic
921992539 1:221383202-221383224 TAGGGTAGGGGGAGGGGGGAGGG - Intergenic
922032868 1:221820760-221820782 GTTAGTTGGGGGAGGGAGGAAGG - Intergenic
922086726 1:222355748-222355770 TTGGGTTGGGGGAGGGGGGAGGG + Intergenic
922110161 1:222548241-222548263 ATGGGTTGGGGGAGGGGGGAAGG - Intergenic
922273052 1:224051923-224051945 CTTGGGAGGTGGAGGTTGAAGGG + Intergenic
922290029 1:224202296-224202318 CCTGGTAGGAGGAGGTTGCAGGG + Intergenic
922479550 1:225929719-225929741 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
922677124 1:227559942-227559964 CTGGGTAGGTGGAGGGTGCTTGG - Intergenic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922889753 1:229052578-229052600 CTTGGTGGGGGAAGGGTGGGAGG + Intergenic
922890330 1:229057325-229057347 CTTGGTAGGGGTGGAGAGGAGGG - Intergenic
923417555 1:233778342-233778364 ATTGGAGGTGGGAGGGTGGAAGG - Intergenic
923431150 1:233921793-233921815 CCTGTTGGGGGGAGGGGGGAGGG - Intronic
923485153 1:234422599-234422621 GGTGGTAGGGGGAGGGTGTGGGG + Intronic
923516026 1:234698669-234698691 CTAGCTAGAGGGAGGGTGGCAGG - Intergenic
923608059 1:235463220-235463242 CTTGGTGGGGACAGGGTGGGAGG + Intronic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
923791111 1:237111983-237112005 ATTGGTTGGGGGTGGGTGGTGGG + Intronic
923947512 1:238904607-238904629 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
924154882 1:241165630-241165652 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
924274827 1:242375122-242375144 CTTGGTAGGGACAGGCTGGATGG - Intronic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
924575901 1:245280745-245280767 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
924639712 1:245822397-245822419 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
924936983 1:248780331-248780353 CATGCTGGGGGGAGGGGGGAGGG - Intergenic
1062833573 10:622251-622273 GATGGTAGGGGGAGGGAGGAGGG + Intronic
1062991967 10:1827777-1827799 GATGGTGGAGGGAGGGTGGAAGG + Intergenic
1063285159 10:4678995-4679017 CTTAGTAGGGGGAGGTAGGAGGG - Intergenic
1063332448 10:5175116-5175138 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1063353166 10:5374481-5374503 CTTGCTGTGGGGAGGGAGGAAGG - Exonic
1063733860 10:8730221-8730243 TTTGGTGGGGGGGGGGGGGATGG - Intergenic
1063801620 10:9585255-9585277 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1063883699 10:10556173-10556195 TGTGGTGGGGGGAGGGAGGAGGG - Intergenic
1064104744 10:12491484-12491506 GTTGTGAGGGGGTGGGTGGATGG + Intronic
1064612852 10:17121546-17121568 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1064826090 10:19402806-19402828 TTTGGTGGGGGAAGGATGGAGGG - Intronic
1064866311 10:19884494-19884516 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1064949288 10:20829436-20829458 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1064956362 10:20915396-20915418 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1065035879 10:21638252-21638274 TTTGGTGGGGGGAGGGGGGCGGG + Intronic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065446032 10:25800529-25800551 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1065737213 10:28765045-28765067 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1065791555 10:29265027-29265049 ATTGGAAGGTGGAGGGTGGAAGG + Intergenic
1065821365 10:29528628-29528650 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
1065848784 10:29769243-29769265 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1065868628 10:29936030-29936052 GCTGGTAGGGGGAGAGGGGAGGG - Intergenic
1065910190 10:30296510-30296532 CTTGGTAGGGAGAAGGTTGGGGG - Intergenic
1066159074 10:32709320-32709342 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1066275759 10:33866682-33866704 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1066578809 10:36857182-36857204 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1066692408 10:38043347-38043369 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1066819958 10:39472681-39472703 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1066974572 10:42355035-42355057 CGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1067194706 10:44106873-44106895 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1067302666 10:45026634-45026656 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1068254662 10:54494086-54494108 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1068294642 10:55054173-55054195 ATTGGAGGGTGGAGGGTGGAAGG - Intronic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068849917 10:61725609-61725631 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1069085691 10:64137088-64137110 ATTGGGAGGGGGAGGTGGGAGGG + Intergenic
1069580045 10:69559639-69559661 AGTGCTAGGGGGAGGGTGGGGGG + Intergenic
1069782779 10:70967320-70967342 CATGGCAAGTGGAGGGTGGAGGG + Intergenic
1070390382 10:75965337-75965359 CTAGGTAGGGGCAGTGTGGCAGG + Intronic
1070411195 10:76142832-76142854 TTGGGTAGGGGGAGGGGGGAAGG - Intronic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070561494 10:77570587-77570609 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071357564 10:84813085-84813107 CTTGGTAGGGATGGGGTGGCGGG + Intergenic
1071419139 10:85472489-85472511 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1071505713 10:86230229-86230251 CTGGGTTGGGGTAGGGTGGGTGG - Intronic
1071508777 10:86248365-86248387 ATTGGGAGAGGGAGGGCGGAGGG + Intronic
1071736211 10:88303650-88303672 ATTGGTAGGGGGAGGGTGGGCGG - Intronic
1071825531 10:89322069-89322091 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
1072081955 10:92041524-92041546 CTTGGTAGGGGGTGGGAGCGGGG + Intergenic
1072315844 10:94202298-94202320 CTTGGTGGGGGTGGGGTAGAGGG - Intronic
1072383674 10:94901168-94901190 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1072631759 10:97151351-97151373 CGTGGGAGGGGGAGGGTTGATGG + Intronic
1073275694 10:102308725-102308747 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1073892754 10:108119843-108119865 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1073923712 10:108488778-108488800 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1074296842 10:112197628-112197650 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1074424382 10:113338228-113338250 CTGGGTAGGGGTGGGGAGGAGGG + Intergenic
1074850039 10:117432377-117432399 CTTGGTGGGTGCAGGGTGGGTGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1075309398 10:121400164-121400186 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1075714102 10:124546016-124546038 CTTGGCAGAGGGAGGGAGGGAGG - Intronic
1075902872 10:126057215-126057237 CGGGGTCGGGGGAGGGGGGAGGG + Intronic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076460840 10:130645504-130645526 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1076766296 10:132635720-132635742 CTTGGGAGGGTGAGGTGGGAGGG + Intronic
1076771945 10:132670561-132670583 CTTGCTGGGGGGAGAGTGGTTGG + Intronic
1076845116 10:133066027-133066049 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845193 10:133066261-133066283 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845248 10:133066431-133066453 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076845292 10:133066571-133066593 GGTGGATGGGGGAGGGTGGATGG + Intergenic
1076888167 10:133272003-133272025 CCTGGTGGGGTGAGGGTGGCAGG - Intronic
1076992458 11:282554-282576 TTTGGTTGGGGGAGTGTGAAGGG + Intronic
1077009675 11:374574-374596 CTTGGTGGGGGTAGAGTGGGGGG + Intronic
1077159474 11:1106174-1106196 TTGGGTAGGTGGATGGTGGATGG - Intergenic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077357885 11:2127094-2127116 ATGGGTAGGGGATGGGTGGAGGG + Intergenic
1077544507 11:3163513-3163535 CTGGGTAGGGGTTGGGTGGGGGG + Intronic
1077578753 11:3403679-3403701 ATTGGTTGGGGGATGGCGGAGGG + Intergenic
1077787895 11:5404139-5404161 CTGGGTCGGGGGCGGGGGGAGGG + Intronic
1077956555 11:7026811-7026833 GGGGGTAGGGGGAGGGGGGAGGG + Intronic
1078027741 11:7714192-7714214 ATTGGAGGGTGGAGGGTGGATGG - Intergenic
1078336362 11:10466345-10466367 CTTCGTAGGGGGAGGGTCGTTGG + Intronic
1078383588 11:10866632-10866654 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1078441490 11:11372291-11372313 CTTGGCTGGGGGAGGGAGCATGG - Intronic
1078531612 11:12140862-12140884 GTTGGTGGGGGAAGGGTAGAAGG - Intronic
1078555296 11:12320528-12320550 CTTGGTGGGGTGGGGGTGGCAGG + Intronic
1078718923 11:13865712-13865734 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1078803171 11:14667688-14667710 TGGGGTTGGGGGAGGGTGGAGGG + Intronic
1078829369 11:14964780-14964802 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079045692 11:17100665-17100687 GTAGGAAGGGGGATGGTGGATGG - Intronic
1079448492 11:20578756-20578778 TGAGGTAGGGGGAGGGGGGAGGG + Intergenic
1079451692 11:20604206-20604228 CTAGCGGGGGGGAGGGTGGAAGG + Intronic
1079504074 11:21133733-21133755 CTTGGTGGGGGGGTGGGGGATGG + Intronic
1079633731 11:22710012-22710034 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1079700408 11:23539706-23539728 CTTGGGAGGGTGAGGTGGGAGGG - Intergenic
1079749963 11:24184868-24184890 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1079813572 11:25026142-25026164 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1079958078 11:26888489-26888511 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1079995043 11:27286938-27286960 CTTGGGAGGTGGAGGTTGCAGGG - Intergenic
1080068325 11:28046546-28046568 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1080079938 11:28205247-28205269 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1080082094 11:28233945-28233967 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1080166855 11:29247878-29247900 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1080199322 11:29650019-29650041 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1080238878 11:30103530-30103552 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1080239649 11:30112065-30112087 CCTGGAAGGGGAAGGGAGGAGGG - Intergenic
1080558661 11:33441061-33441083 TGAGGTAGGGGGAGGGGGGAGGG - Intergenic
1080912231 11:36614059-36614081 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081012634 11:37834247-37834269 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1081149561 11:39610070-39610092 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1081326902 11:41756201-41756223 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1081620164 11:44614671-44614693 ATTGGTTGGGGGAGAGGGGATGG + Intronic
1081621266 11:44620269-44620291 CCTTGTAGGGGGAGAGGGGAGGG + Exonic
1081867492 11:46367567-46367589 CTTGGGAGAGGGCGGGTGGGCGG + Intronic
1082041274 11:47686978-47687000 AATGGTGGGGGGAGGGGGGAGGG + Intronic
1082256773 11:50040973-50040995 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1082579017 11:54843846-54843868 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1082743532 11:56937800-56937822 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1083132665 11:60640307-60640329 CTCAGAAGCGGGAGGGTGGAGGG + Intergenic
1083145223 11:60753062-60753084 CTCGGTGGGGGGAGGGAGAAGGG - Intergenic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083742315 11:64717427-64717449 GTGGGTAGGGGCAGGGTGGGAGG - Intronic
1084235781 11:67787195-67787217 TTTGGTTGGGGGATGGCGGAGGG + Intergenic
1084740976 11:71139352-71139374 AGGGGTAGGGGGAGGGGGGAGGG + Intronic
1085344001 11:75754484-75754506 GGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1085395162 11:76203482-76203504 CTGGGTAGGGGGAGGGTTTGAGG - Intronic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1085604998 11:77889396-77889418 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1085998339 11:81949755-81949777 CTCGGAAGGGGAAGGGTGGGAGG - Intergenic
1086015542 11:82161728-82161750 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1087344305 11:96951272-96951294 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1087452426 11:98342265-98342287 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1087460362 11:98437663-98437685 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1087481503 11:98706923-98706945 TTTGGTGGGGGGTGGGTGGGGGG + Intergenic
1088690688 11:112324414-112324436 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1088944154 11:114492009-114492031 TGTGGTCGGGGGAGGGGGGACGG + Intergenic
1088983421 11:114884573-114884595 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1089028892 11:115302147-115302169 ATTGGAGGGGGAAGGGTGGAAGG + Intronic
1089058357 11:115606236-115606258 AGTGGAAGGTGGAGGGTGGAGGG - Intergenic
1089069742 11:115690062-115690084 ATTGCTGGGGGTAGGGTGGAAGG + Intergenic
1089207933 11:116779895-116779917 CTATGTCGGGGGAGGGGGGAGGG + Intronic
1089209342 11:116790018-116790040 CCTGTTGGGTGGAGGGTGGAAGG - Exonic
1089380048 11:118023495-118023517 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1089436135 11:118469132-118469154 CTAGCTGGGGGGAGGGGGGAGGG - Intronic
1089787692 11:120919955-120919977 GTAGGTAGGGGGAGTGAGGAAGG + Intronic
1089814871 11:121163449-121163471 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1089935129 11:122356872-122356894 CCTGGTGGGGGGAGGGGGGAGGG - Intergenic
1089986964 11:122824004-122824026 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090562650 11:127949175-127949197 GTTGGGAGTGGGAGGTTGGAGGG - Intergenic
1090577234 11:128118522-128118544 ATTGGAGGGTGGAGGGTGGAGGG + Intergenic
1090786865 11:130056996-130057018 CTTGGTAGTCGGAGGCAGGAGGG + Intergenic
1090849514 11:130559918-130559940 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1091113889 11:132996019-132996041 GATGGCAGGGGGAGGATGGAAGG - Intronic
1091329521 11:134720294-134720316 TGTGGTTGGGGGAGGGGGGAGGG - Intergenic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091966793 12:4750339-4750361 TTTGGAGGGTGGAGGGTGGAGGG - Intronic
1092203715 12:6603176-6603198 CTTGCTGGGGGGCGGGTGTAGGG - Intronic
1092641865 12:10520360-10520382 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1092697841 12:11193163-11193185 CTTGGAGGGTGGAGGGTGGGAGG + Intergenic
1093063429 12:14631372-14631394 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1093090611 12:14916015-14916037 CTTGGGGGGTGGAGGGTGGGAGG + Intronic
1093217142 12:16377287-16377309 CGGGGTGGGGGGAGGGGGGAGGG - Intronic
1093316351 12:17656119-17656141 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1093319205 12:17691842-17691864 TGTGGTAGGGGGAGGAGGGAGGG + Intergenic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1093675131 12:21929974-21929996 TGAGGTAGGGGGAGGGGGGAGGG - Intronic
1093724489 12:22488044-22488066 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1093835755 12:23826165-23826187 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1094016629 12:25871521-25871543 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094250436 12:28353890-28353912 ATTGGAAGGTGGAGGGTGGGAGG + Intronic
1094325170 12:29230325-29230347 CTGGGTAGGGGGAGGAGTGAGGG + Intronic
1094379116 12:29823275-29823297 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1094380945 12:29841961-29841983 CTTGGTAGGGGGACGATTGGTGG + Intergenic
1094391390 12:29954311-29954333 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1094405763 12:30114828-30114850 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1094857968 12:34425621-34425643 TTGGGTGGGAGGAGGGTGGAGGG - Intergenic
1095346671 12:41158347-41158369 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1095482800 12:42653172-42653194 TGTGGTGGGGGGAAGGTGGAGGG - Intergenic
1095531046 12:43186989-43187011 TGAGGTAGGGGGAGGGGGGAGGG - Intergenic
1095807792 12:46339703-46339725 CTGGTTAGGGGAAGGGGGGAAGG - Intergenic
1096286017 12:50300944-50300966 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1096598382 12:52712508-52712530 TGTGGTAGGGGGAGGGAGGAGGG + Intergenic
1096623639 12:52879808-52879830 CATGGTGGGGGGTGGGTGGGGGG - Intergenic
1097107006 12:56631899-56631921 ATTTGTAGTGGGGGGGTGGAGGG - Intronic
1097116493 12:56701264-56701286 CTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1097243582 12:57592572-57592594 CTTGGTATGGGGAAGGCTGATGG + Intronic
1097304456 12:58053811-58053833 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1097326376 12:58282001-58282023 TGGGGTAGGGGGAGGGGGGAAGG - Intergenic
1097389474 12:58992633-58992655 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1097617560 12:61901418-61901440 ATTGGTCGGGGGAGGGGGGAGGG - Intronic
1097708907 12:62897100-62897122 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
1097758965 12:63438288-63438310 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1098130395 12:67344336-67344358 CTTGGGAGGTTGAGGGTGGAAGG - Intergenic
1098384956 12:69908910-69908932 TTTTGAAGGTGGAGGGTGGAGGG - Intronic
1098646580 12:72909138-72909160 TCTGGTGGGGGGAGGGGGGAGGG + Intergenic
1099041553 12:77659959-77659981 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1099355122 12:81624819-81624841 CTCAGAAGGGGGAGGGTGGAGGG + Intronic
1099385975 12:82014087-82014109 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1099388770 12:82051833-82051855 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1099488685 12:83260117-83260139 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1099499930 12:83401831-83401853 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1099531049 12:83781620-83781642 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1099565167 12:84233132-84233154 CTTGGGAGGTGGAGGTTGCAGGG + Intergenic
1099583815 12:84489932-84489954 TATGGTGGGGGGAGGGGGGAGGG - Intergenic
1099732776 12:86526279-86526301 GTTGGTAGGGGGAGGAGGGTTGG + Intronic
1099743987 12:86678570-86678592 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1099823897 12:87750594-87750616 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1099938037 12:89151394-89151416 CTCAGAATGGGGAGGGTGGAAGG + Intergenic
1099953752 12:89332391-89332413 TTTTGTAGGGGGAGGGGGCAGGG - Intergenic
1100026481 12:90134704-90134726 AATGGTGGGGGGAGGGCGGAGGG + Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100508981 12:95250206-95250228 TTAGGTGGGGGGAGGGGGGAGGG - Intronic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1101054716 12:100900442-100900464 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101282279 12:103270719-103270741 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101628713 12:106472003-106472025 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101659213 12:106751077-106751099 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101795591 12:107970334-107970356 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1102527086 12:113519954-113519976 CTTGGGAGGGGGAGGCTCGGAGG + Intergenic
1102625444 12:114232008-114232030 TTTGGTGGGGGTGGGGTGGATGG + Intergenic
1102685196 12:114719175-114719197 CTTGGTAGGAGGAGGGGCAAAGG - Intergenic
1103004034 12:117407620-117407642 CTTGGTACGAGGAGAGAGGAGGG - Intronic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103448926 12:121014254-121014276 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1103495243 12:121357054-121357076 CTTGGGAGGCCGAGGGTGGGAGG + Intronic
1103576231 12:121879319-121879341 CTTGGTTGGGGCGGGGTGGGGGG + Intergenic
1103951569 12:124554372-124554394 CTGGGTGGTGGGAGGCTGGAGGG - Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104107091 12:125673325-125673347 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1104114046 12:125731787-125731809 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1104236887 12:126947386-126947408 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1105232414 13:18509458-18509480 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1105337152 13:19483919-19483941 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1105339061 13:19502648-19502670 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1105510544 13:21048500-21048522 TATGGTAGGTAGAGGGTGGATGG - Intronic
1105537199 13:21278390-21278412 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1106299915 13:28454029-28454051 CTGGGTGGGGGGAGTGGGGAAGG + Intronic
1106444748 13:29817443-29817465 CTTGGTAGGGGAGGGGTACAGGG + Intronic
1106623622 13:31396109-31396131 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1106649519 13:31674959-31674981 CGGGGTCGGGGGAGGGGGGAGGG + Intergenic
1106649889 13:31679063-31679085 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
1106654063 13:31723509-31723531 TGGGGTAGGGGGAGGGCGGATGG - Intergenic
1106932000 13:34676658-34676680 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
1107197672 13:37673086-37673108 CGGGGTGGGGGGAGGGGGGAGGG - Intronic
1107206294 13:37793427-37793449 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1107365823 13:39674202-39674224 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1107470210 13:40684751-40684773 CTTGGGAGGCGGAGGTGGGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108008027 13:45972436-45972458 CTCAGAAGGGGGAGGGTGGAAGG + Intronic
1108035520 13:46286514-46286536 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1108094604 13:46887910-46887932 GTTGGTGGGGGGAGGTGGGAGGG + Intronic
1108123239 13:47212528-47212550 CTTGGTGGTGGGAGGATGGAGGG + Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108739960 13:53326328-53326350 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1108930617 13:55813425-55813447 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1109571088 13:64191317-64191339 TTTGGGAGGCTGAGGGTGGAGGG + Intergenic
1109677943 13:65705524-65705546 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1109822772 13:67680389-67680411 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1109850880 13:68061568-68061590 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1109911209 13:68913072-68913094 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1110086261 13:71384702-71384724 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1110200085 13:72839778-72839800 GTTGGTAGGGGTAGGTTGGTAGG + Intronic
1110400260 13:75081464-75081486 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110566646 13:76964012-76964034 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1110891056 13:80699360-80699382 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111136155 13:84047018-84047040 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111345866 13:86953527-86953549 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1112012927 13:95307248-95307270 GTGGGTGGGGGGAGGGGGGACGG + Intergenic
1112096978 13:96144788-96144810 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112714278 13:102165664-102165686 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112982861 13:105408428-105408450 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1113010154 13:105754992-105755014 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1114433531 14:22683788-22683810 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1114657636 14:24325626-24325648 GATGGTAGGGGGAGGAAGGAGGG - Intronic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1114801318 14:25779002-25779024 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1115010992 14:28544545-28544567 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1115122203 14:29951064-29951086 CATGGTAGCAGGAGGGTGGTGGG - Intronic
1115235319 14:31203889-31203911 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1115426333 14:33264272-33264294 TGGGGTAGGGGGAGGGGGGAAGG + Intronic
1115575223 14:34704564-34704586 CTTGGGAGGTGGAGGTTGCAGGG - Intergenic
1115724516 14:36198509-36198531 GTCGGGAGGGGGAGGGGGGAGGG + Intergenic
1115731193 14:36271717-36271739 CCTGGTAGGGGGAGTGTGTTAGG - Intergenic
1116129470 14:40836116-40836138 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1116137601 14:40949053-40949075 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1116397053 14:44459021-44459043 CGGGGTAGGGGGCTGGTGGAAGG + Intergenic
1116438412 14:44921460-44921482 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1116527605 14:45926615-45926637 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1116538548 14:46066539-46066561 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
1116648348 14:47559231-47559253 GATGGTAGAGGGAGGGAGGAGGG - Intronic
1116684144 14:48016647-48016669 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1116767910 14:49094309-49094331 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1116768726 14:49102572-49102594 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1116897014 14:50326151-50326173 CTTGGGAGGTGGAGGTTGCAGGG + Exonic
1117258469 14:54004403-54004425 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1117968339 14:61228396-61228418 CTTGCTATGAGGAGGGAGGAGGG - Intronic
1118084067 14:62395747-62395769 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1118103217 14:62628993-62629015 TTTGGTGGGGGGAGGGGGGAGGG - Intergenic
1118110308 14:62711222-62711244 CTTGGTTGGGGGTGGGTGGGGGG - Intronic
1118154125 14:63221964-63221986 TTGGGTGGGGGGAGGGGGGAGGG - Intronic
1118414649 14:65522713-65522735 CGGGGTGGGGGGAGGGGGGAGGG - Intronic
1118527874 14:66666101-66666123 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118649404 14:67873938-67873960 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118682660 14:68259301-68259323 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118793316 14:69116017-69116039 CTTGGTGTGGGGTGGGTGGAGGG - Intronic
1119139204 14:72250090-72250112 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
1119205534 14:72791120-72791142 CTAGGTCGGGGGAGTGGGGAAGG - Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119700777 14:76753097-76753119 CTTGGTGGGGGTGGGGTGAAGGG - Intergenic
1119719549 14:76881907-76881929 CTTGATAGGGGGACGGAGAAGGG + Intergenic
1119772056 14:77226235-77226257 TTGGGTAGGGGTGGGGTGGAGGG - Intronic
1119819632 14:77603993-77604015 CGTGGTGGGGGCAGAGTGGAGGG - Intronic
1120070245 14:80094519-80094541 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1120201918 14:81546614-81546636 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1120331801 14:83102690-83102712 TTTGGAGGGTGGAGGGTGGAAGG + Intergenic
1120738597 14:88082773-88082795 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121504659 14:94467727-94467749 CCTGGCAGATGGAGGGTGGATGG + Intronic
1121719545 14:96099558-96099580 CTTGTTGGGGGAAGGGGGGAGGG + Intergenic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1121799751 14:96764775-96764797 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1121959709 14:98247975-98247997 CTTGGTGGGGGGAGGGGCGGGGG + Intergenic
1122160886 14:99783133-99783155 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1122665968 14:103329793-103329815 CTTGGTGGGGGGTGGGAGGGAGG + Intergenic
1122832989 14:104412184-104412206 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1123083206 14:105705773-105705795 ATTGGTAGACGGAGGATGGATGG - Intergenic
1202871781 14_GL000225v1_random:171808-171830 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123419151 15:20117330-20117352 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
1123446710 15:20336171-20336193 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
1123489263 15:20767284-20767306 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123528372 15:21123873-21123895 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
1123545762 15:21336371-21336393 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123823764 15:24060084-24060106 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1123828097 15:24104073-24104095 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123885679 15:24725705-24725727 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1124483687 15:30098353-30098375 CTTGGTGGGGGGGGGGGGGGCGG + Intergenic
1124519892 15:30398873-30398895 CTTGGTGGGGGGGGGGGGGGCGG - Intergenic
1124646387 15:31440479-31440501 GCTGGTAGGGGGAGCGGGGAAGG - Intergenic
1124682088 15:31740426-31740448 GATGGTGGGGGGAGGGTGGGAGG + Intronic
1124700980 15:31911765-31911787 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1124815666 15:32989548-32989570 TTTGGTGGGGGGCGGGTGAAGGG - Intronic
1124865093 15:33482493-33482515 CCTGGGAGGGGGAGGTTGCAGGG - Intronic
1125219080 15:37312764-37312786 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1125332599 15:38596870-38596892 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1125376507 15:39035986-39036008 GGTGGAAGGGGGAGGGGGGAGGG - Intergenic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1126403296 15:48296335-48296357 CATGGTAGGGCAAGGGTGAAAGG + Intronic
1126442972 15:48711766-48711788 TTTGGAGGGTGGAGGGTGGAGGG - Intergenic
1126868063 15:52957652-52957674 CTTGTTAGGGGGTGGGGGCAAGG + Intergenic
1126877927 15:53064121-53064143 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1126979080 15:54220446-54220468 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1127288088 15:57547802-57547824 CTTGGCAGGGGGAGTGATGAGGG - Exonic
1127348026 15:58120761-58120783 TTTTGTGGGGGGAGGGGGGAGGG - Intronic
1127449524 15:59103270-59103292 CTCAGAAGAGGGAGGGTGGAAGG - Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1128952987 15:71907084-71907106 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1129752703 15:78077200-78077222 CTTGGAGGAAGGAGGGTGGATGG + Intronic
1129792356 15:78349835-78349857 CTGGGCTGGGGGAGGGGGGAAGG - Intergenic
1129973202 15:79798589-79798611 CTTGTTTGGGGCAGGGTGGTTGG - Intergenic
1130029941 15:80304307-80304329 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1130656070 15:85793057-85793079 CTTGGGCGGGGGCGGGGGGAAGG - Intronic
1130715085 15:86325655-86325677 CTTGCTAGGGGGATGGAAGATGG - Intronic
1130936525 15:88475563-88475585 CTTGGGAGGCTGAGGCTGGATGG + Intronic
1131054721 15:89368513-89368535 GTCGGTAGGGGGTGGGTGGAGGG + Intergenic
1131342650 15:91616981-91617003 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1131475121 15:92731820-92731842 ACTAGAAGGGGGAGGGTGGAAGG + Intronic
1131526584 15:93157751-93157773 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1132159925 15:99531231-99531253 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1132306781 15:100820788-100820810 TTAGGTGGGGGGATGGTGGAAGG - Intergenic
1132334062 15:101032420-101032442 TCGGGTAGGGGGAGGGGGGAGGG - Intronic
1132417453 15:101632315-101632337 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
1202954104 15_KI270727v1_random:63642-63664 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1132572744 16:651134-651156 CTCGGTGGTGGGAGGGTGGGTGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1133013472 16:2927933-2927955 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1133072852 16:3257928-3257950 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1133190315 16:4128979-4129001 CTTGGGAGGCTGAGGTTGGAAGG - Intergenic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1133342835 16:5048134-5048156 CTTGGTAGGCTGAGGCAGGAAGG - Intronic
1133347360 16:5079834-5079856 TTTGGTTGGGGGATGGCGGAGGG + Intronic
1133517852 16:6527355-6527377 CTTTGTTGGGGGAGGAAGGAAGG - Intronic
1133577485 16:7107636-7107658 GTTGTTTTGGGGAGGGTGGAAGG - Intronic
1133640256 16:7709744-7709766 TTTGGGAGGGGGTGGGGGGAGGG + Intronic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1134006570 16:10822225-10822247 GTGGGTAGGGGGAGGGGAGAGGG - Intergenic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134323994 16:13190221-13190243 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134440416 16:14296485-14296507 CTTGACAGGGGGCGGCTGGAAGG - Intergenic
1134632233 16:15765130-15765152 GATGGTAGGTGGAAGGTGGATGG + Intronic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1136042312 16:27589883-27589905 CTTGGGAGGGTGAGGCAGGAGGG - Intronic
1136109603 16:28056469-28056491 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
1136372528 16:29845309-29845331 CATGGAAGGGGGAGGCTAGAAGG - Intronic
1136901277 16:34040790-34040812 TGTGTTGGGGGGAGGGTGGAGGG + Intergenic
1136926860 16:34382128-34382150 TTTGGTGGGGGGTGGGGGGACGG + Intergenic
1136977714 16:35029679-35029701 TTTGGTGGGGGGTGGGGGGACGG - Intergenic
1137007690 16:35293175-35293197 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1137027459 16:35492298-35492320 GTTGGGAGGCGGAGGGTGGAGGG - Intergenic
1137345555 16:47654802-47654824 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
1137580049 16:49628087-49628109 ATGGGTAGATGGAGGGTGGATGG - Intronic
1137621356 16:49878516-49878538 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1137750658 16:50858958-50858980 CTTGGCGGGGGGGGGGGGGACGG - Intergenic
1137777121 16:51065336-51065358 CTTGGTAGGTTGAGGTTGGGAGG - Intergenic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1137978626 16:53051619-53051641 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1138223028 16:55269235-55269257 ATAGGTAGGTGGAGGATGGATGG - Intergenic
1138260882 16:55620958-55620980 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1138396103 16:56705825-56705847 CAAGGTTGGGGGAGGGAGGAAGG - Intronic
1138411313 16:56842658-56842680 CTTGGGAGGGTGAGGTGGGAGGG - Intronic
1138556325 16:57773028-57773050 CTTGGGAGGGGATGGGTGGCTGG - Intronic
1138644779 16:58416743-58416765 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1139272343 16:65695857-65695879 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1139725046 16:68890947-68890969 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1140083953 16:71777409-71777431 AATGGTAGAGTGAGGGTGGAGGG + Intronic
1140508052 16:75486825-75486847 CTTGGTGGGGTGAGGTGGGAAGG + Intronic
1140538687 16:75734973-75734995 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1140639398 16:76954363-76954385 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1140646573 16:77038085-77038107 TTTGGAAGGGGGAGGGAAGAAGG - Intergenic
1140712939 16:77695121-77695143 CTTTTTAGGGGGTGGGTGGGCGG + Intergenic
1140789536 16:78377985-78378007 TTTGGCAGGGGGAGGTAGGAAGG + Intronic
1140999996 16:80299071-80299093 TTTGGTGGGGGGATGGGGGAGGG + Intergenic
1141205579 16:81930670-81930692 CTTGGAAGGTGGAGGCTGCAGGG + Intronic
1141283846 16:82653189-82653211 GGTGGTAGGGGGTGGGTGGATGG + Intronic
1141586870 16:85039908-85039930 CCTGGGAGGCGGAGGGTGTAGGG - Intronic
1141764275 16:86048333-86048355 CCCGGAAGGGGGAGGGGGGAAGG + Intergenic
1142234494 16:88915389-88915411 CATGGAGGGGGGAGCGTGGAGGG + Intronic
1142234499 16:88915403-88915425 CGTGGAGGGGGGAGCGTGGACGG + Intronic
1142234587 16:88915657-88915679 CGTGGACGGGGGAGTGTGGAGGG + Intronic
1142234614 16:88915726-88915748 CGTGGAAGGGGGAGCGTGGGGGG + Intronic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142332980 16:89467468-89467490 CTTGGGAGGCTGAGGCTGGATGG - Intronic
1142795266 17:2302803-2302825 CTTGGTGGGGGGCGGGGGGATGG + Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143158342 17:4853002-4853024 GTTGGTGGGGGGAGTGTGGTTGG + Intronic
1143158406 17:4853186-4853208 GTTGGTGGGGGGAGTGTGGTTGG + Intronic
1143158413 17:4853204-4853226 GTTGGTGGGGGGAGTGTGGTTGG + Intronic
1143158481 17:4853438-4853460 GTTGGTGGGGGGAGTGTGGTTGG + Intronic
1144077371 17:11731540-11731562 TTGGGTGGGGGGAGGGGGGAGGG - Intronic
1144090414 17:11851184-11851206 CTTGGGAGGTGGAGGTTGCAAGG - Intronic
1144228397 17:13174322-13174344 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1144782233 17:17814017-17814039 CCTGGGAGGAGGGGGGTGGATGG - Intronic
1144965856 17:19076926-19076948 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1144982112 17:19175256-19175278 CTTGGTCAGGGGAGGATGGTCGG - Intergenic
1144986111 17:19202983-19203005 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1145004530 17:19329944-19329966 ATTGGCAGGAGGAGGGTGAATGG - Intronic
1145723801 17:27098214-27098236 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1146091952 17:29888236-29888258 CTTTCTGGGGGTAGGGTGGATGG - Intronic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146097661 17:29947408-29947430 CTCAGAAGTGGGAGGGTGGAAGG + Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146433570 17:32822374-32822396 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1146797517 17:35793521-35793543 CTAGGAAGGGGAGGGGTGGAAGG + Intronic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147508463 17:41044610-41044632 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1147595055 17:41711727-41711749 CATGGTAGGGGGAGGGTGAAAGG + Intergenic
1147623736 17:41885754-41885776 TTTAGTAGGGGGTGGGTGGCAGG - Intronic
1147914187 17:43877017-43877039 CCAGGTAGGGGCAGGATGGAGGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1148345163 17:46898241-46898263 GTTGGCTGGGGGAGGGTGGGAGG - Intergenic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148677827 17:49455390-49455412 AGTGGGAGAGGGAGGGTGGAGGG - Intronic
1148687467 17:49508836-49508858 CATGGTAGGGGAAGGCTGGGAGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149295462 17:55258331-55258353 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1149350202 17:55779008-55779030 CTAGGAAGTGGGAGGTTGGAAGG - Intronic
1149871689 17:60188086-60188108 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1149961646 17:61116091-61116113 TAGGGTAGGGGGAGGGGGGAGGG + Intronic
1150509147 17:65730763-65730785 CTTGGTTGGGGGCGGGGGGTGGG - Intronic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150661782 17:67087213-67087235 TTTGGTGGGAGTAGGGTGGAGGG - Intronic
1150889019 17:69123013-69123035 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1151101891 17:71565243-71565265 CTTGGTGGGAGGAGGAGGGAGGG + Intergenic
1151106125 17:71618882-71618904 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
1151351001 17:73532200-73532222 CTTGGTTGGGGGTGGGTGGGGGG - Intronic
1151454553 17:74218170-74218192 CTGGTTAGGGGGAGGGGGGTGGG + Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151826459 17:76526956-76526978 CTTGGTAGTGGGACAGGGGATGG + Intergenic
1151826491 17:76527041-76527063 CTTGGTAGTGGGACAGGGGATGG + Intergenic
1151826502 17:76527070-76527092 CTTGGTAGTGGGACAGGGGATGG + Intergenic
1151826524 17:76527127-76527149 CTTGGTAGTGGGACAGGGGATGG + Intergenic
1151826535 17:76527156-76527178 CTTGGTAGTGGGACAGGGGATGG + Intergenic
1152017659 17:77762180-77762202 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152234912 17:79133573-79133595 CTGGGTAGGGGTAGCCTGGAAGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152723640 17:81934831-81934853 CCTGGGAGGGCCAGGGTGGAGGG - Intronic
1152789781 17:82272976-82272998 CTGGGTAGGGGCAGGGTCGTGGG - Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153039282 18:795748-795770 CCTGTTAGGGGGTGGGGGGAAGG + Intronic
1153078860 18:1196852-1196874 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1153727564 18:7972311-7972333 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1153951495 18:10061389-10061411 CTTTCTAGGGGGAGGGAGCAGGG - Intergenic
1154378307 18:13827011-13827033 CCTGCTAGGTGGAGGGTGGATGG - Intergenic
1154520902 18:15229250-15229272 TGTGGTCGGGGGAGGGGGGAGGG - Intergenic
1154532978 18:15367116-15367138 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1155134891 18:22980820-22980842 CTTGGGAGGGTGAGGTGGGAGGG - Intronic
1155169789 18:23258993-23259015 GGTGGTGGGGGGAGGGAGGAGGG + Exonic
1155380618 18:25218332-25218354 CGTGGTAAGGGGATGGTGGGAGG + Intronic
1155597830 18:27509103-27509125 AATGGTAGTGGGAGGGTGAAGGG + Intergenic
1155987649 18:32247229-32247251 CTTGGTGTGGGGAGAGTGGGAGG - Intronic
1156075159 18:33266641-33266663 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1156118117 18:33811580-33811602 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1156343560 18:36235273-36235295 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1156591211 18:38490691-38490713 GTAGGTAGGGGAAGGGTGCATGG + Intergenic
1156699511 18:39808767-39808789 CTTGAGGGGGGGAGGGTGGGAGG - Intergenic
1156730429 18:40187781-40187803 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1157095287 18:44680827-44680849 CTCGGGAGGGGGAGGGGGTAAGG + Intronic
1157151900 18:45226666-45226688 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157395731 18:47339497-47339519 CCTGTTGGGGGGAGGGGGGAGGG - Intergenic
1157743917 18:50118142-50118164 TTTAGTTGGGGGCGGGTGGATGG - Intronic
1158017291 18:52798826-52798848 CCTGGGAGGGGGAGGTTGCAGGG - Intronic
1158221718 18:55157808-55157830 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1158343826 18:56494428-56494450 CCTGGCACGGGGAGGGTCGAAGG + Intergenic
1158367421 18:56753589-56753611 TTTGGTGGGGGGAGGGGGGTGGG - Intronic
1158640669 18:59201035-59201057 CTTAGTGTGGGGAGGTTGGATGG - Intergenic
1158752189 18:60274759-60274781 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1158833934 18:61310740-61310762 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1158909814 18:62048843-62048865 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1159129602 18:64266196-64266218 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1159131935 18:64289388-64289410 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1159235701 18:65670152-65670174 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1159251705 18:65887407-65887429 TGGGGTAGGGGGAGGGGGGAGGG - Exonic
1159523961 18:69563651-69563673 CGGGGTGGGGGGAGGGGGGAAGG + Intronic
1159569692 18:70098784-70098806 TGGGGTAGGAGGAGGGTGGAGGG - Intronic
1159629689 18:70735341-70735363 CATGGTAGGGGATGTGTGGAAGG + Intergenic
1159832391 18:73293333-73293355 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1160138762 18:76298907-76298929 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1160216780 18:76939514-76939536 GTGGGCAGGGGGAGGCTGGATGG + Intronic
1160294364 18:77623887-77623909 CGTGGAAGGGGGAAGGGGGAAGG - Intergenic
1160409831 18:78667932-78667954 GGTGGATGGGGGAGGGTGGATGG - Intergenic
1160692726 19:467199-467221 GATGGTTGGTGGAGGGTGGATGG + Intronic
1160703308 19:518235-518257 CTGGGTAGGGGCTGGGAGGAGGG + Intronic
1160703334 19:518299-518321 CTGGGTAGGGGCTGGGAGGAGGG + Intronic
1160703376 19:518400-518422 CTGGGTAGGGGCTGGGAGGAGGG + Intronic
1160865159 19:1253028-1253050 CTGGGTTGGGGGGGGCTGGAGGG + Intronic
1161046099 19:2135873-2135895 CTGGGAGGGAGGAGGGTGGAGGG - Intronic
1161091018 19:2360145-2360167 CTTGGCAGGGGGCCGGGGGAGGG + Intergenic
1161416934 19:4152590-4152612 CTTGGTAGGGGGTGGAGGGGAGG + Intergenic
1161425521 19:4200627-4200649 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1161518217 19:4708779-4708801 ATTGGAGGGTGGAGGGTGGAGGG + Intronic
1161629563 19:5345894-5345916 TTTGGGAGGGGGAGGTGGGAGGG - Intergenic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161821562 19:6533606-6533628 CTTTGGAGGGGGAGGGGGAAGGG - Intronic
1162022274 19:7873366-7873388 ATTGGAAGGGGGAGGGAAGATGG + Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162287159 19:9747430-9747452 CCTGCTGGGGGGAGGGGGGAGGG - Intergenic
1162322493 19:9978532-9978554 CTGGGTGGGGGCAGGGTGGAGGG - Intronic
1162444399 19:10713277-10713299 ATTGGGAGAGGGAGGGAGGAAGG + Exonic
1162827159 19:13260006-13260028 CTTGCTGGGGGTGGGGTGGAGGG + Intronic
1162884933 19:13689905-13689927 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163009730 19:14417485-14417507 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1163251977 19:16131493-16131515 CTTGGAAGGGGATGGATGGATGG + Intronic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1163609970 19:18295613-18295635 GATGGTAGGTGGATGGTGGATGG - Intergenic
1163618020 19:18341058-18341080 CTCGGAAGGGGCAGGGAGGAAGG - Intronic
1163671123 19:18629313-18629335 CCTGGTAGTGGGTGGGTGGGTGG + Intergenic
1164118908 19:22247887-22247909 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164376927 19:27695580-27695602 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1164861176 19:31563434-31563456 CTTGGTAGGGGGCGCCTTGAAGG + Intergenic
1165107371 19:33479566-33479588 ATTGGAAGGTGGAGGGTGGGAGG - Intronic
1165149754 19:33753686-33753708 GTTGGTAGGAGGATGGTGGGTGG - Intronic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165272235 19:34720663-34720685 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1165288720 19:34866054-34866076 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1165290249 19:34878013-34878035 ATTGGAAGGTGGAGGGTGGCAGG - Intergenic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165921663 19:39302435-39302457 CTTGGTCGTGGGAGAGTGGTGGG - Intergenic
1166411994 19:42561655-42561677 CTTGGGAGTGGGTGGGAGGAGGG - Intergenic
1166433238 19:42744100-42744122 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1166440037 19:42805591-42805613 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1166668482 19:44695788-44695810 CTTGGGAGCGGGAGGGAGGCTGG - Intergenic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167448924 19:49556035-49556057 CTTGGGAGGGAGCGTGTGGAGGG + Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167622125 19:50566405-50566427 CTGGGAAGGGGGAGGGGGAAGGG - Intronic
1168076468 19:53982990-53983012 CTTCGGAGGGGGAGGGGGGCGGG - Exonic
1168405487 19:56108272-56108294 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405514 19:56108341-56108363 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168614888 19:57829733-57829755 CTTGGTGAGGGGAGTGTGGCAGG - Intronic
1168666447 19:58208525-58208547 CTTAGGAGAGGGAGGCTGGAGGG + Intronic
1202688663 1_KI270712v1_random:70655-70677 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
925524224 2:4782001-4782023 CTTGGTATGGGGGGGGGGGGCGG + Intergenic
925605065 2:5651304-5651326 TTGGGTAGGGGGACGGGGGAGGG + Intergenic
925653768 2:6122496-6122518 TAGGGTAGGGGGAGGGGGGAGGG + Intergenic
925856827 2:8137112-8137134 CTTGGTAGTGGGTGTATGGAGGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926191052 2:10727815-10727837 CTTGAGCGGGGGAGGGGGGATGG + Intronic
926240477 2:11081153-11081175 CATGGAGGGGGGAGGGAGGAGGG - Intergenic
926503379 2:13681536-13681558 CTTGGAAGATGGAGGCTGGATGG - Intergenic
926523439 2:13946636-13946658 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
926538882 2:14150156-14150178 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
926543193 2:14206080-14206102 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
926543749 2:14212458-14212480 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
926595283 2:14783461-14783483 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
926825984 2:16905406-16905428 CGGGGTAGGGGGAGGGGGGAGGG - Intergenic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
926965385 2:18404205-18404227 CATGGTAGTGGGAGGTAGGATGG + Intergenic
927106649 2:19833365-19833387 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927479577 2:23441329-23441351 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
928247581 2:29644248-29644270 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
928649945 2:33393432-33393454 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
928754812 2:34511240-34511262 CATGGTGGGGGGATGGGGGAGGG + Intergenic
929097933 2:38281600-38281622 ATGGGTAGGGGCAGGGGGGAGGG + Intergenic
929344405 2:40863445-40863467 TTTGGAGGGTGGAGGGTGGAGGG + Intergenic
929365804 2:41155102-41155124 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
929515529 2:42603123-42603145 TTTGCTGGGGGTAGGGTGGAAGG + Intronic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930464848 2:51734999-51735021 CGGGGTAGGGGGAGTGGGGAGGG + Intergenic
930604707 2:53481959-53481981 GATGGTGGGGGGAGGGGGGAGGG - Intergenic
930615882 2:53592889-53592911 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
930829629 2:55728737-55728759 CTTGGTAGGTGGAGAGTGACTGG + Intergenic
930923930 2:56792519-56792541 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
930966914 2:57340032-57340054 CTTGGAGGGTGGAGGGTGGAGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931160870 2:59688857-59688879 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
931271255 2:60705209-60705231 CTTGGTAGGCTGAGGTGGGAGGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931558086 2:63527361-63527383 GTTGGTTGGGGGTGGGGGGAGGG - Intronic
932221135 2:69999890-69999912 CTTGGGTGGGAGAGGGAGGAAGG - Intergenic
932378640 2:71261367-71261389 CTTTAGAGGGGGAGGGTTGAAGG + Intergenic
932520790 2:72409717-72409739 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
932526073 2:72470608-72470630 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
932815727 2:74860158-74860180 CTTGGAAGGGTGAGGGTAGGAGG + Intronic
932867326 2:75357880-75357902 TTTGGAGGGTGGAGGGTGGAAGG - Intergenic
932979558 2:76648136-76648158 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
933000063 2:76910346-76910368 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
933017118 2:77141471-77141493 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
933054808 2:77648174-77648196 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
933062915 2:77759615-77759637 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
933102428 2:78276868-78276890 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
933112639 2:78423127-78423149 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
933148447 2:78885477-78885499 CTTGGAAGGGGGAGGGTGAAAGG + Intergenic
933594432 2:84268342-84268364 TGAGGTAGGGGGAGGGTGGAGGG + Intergenic
933653524 2:84868436-84868458 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
933687884 2:85157805-85157827 CTGGGTAGGGGCAGGATGGAGGG + Intronic
933702165 2:85263300-85263322 TTTGTTGGGGGTAGGGTGGAGGG + Intronic
933735829 2:85493512-85493534 CTTGGGAGGTGGAGGTTGCAGGG - Intergenic
933957765 2:87385430-87385452 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
934066800 2:88348847-88348869 ACTGGTGGGGGGAGGGAGGAGGG + Intergenic
934118698 2:88819551-88819573 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
934192202 2:89809614-89809636 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
934241886 2:90277347-90277369 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
934271286 2:91539341-91539363 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
934549836 2:95252226-95252248 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
934733386 2:96673545-96673567 ATTGGTGGGTGGAGGATGGATGG - Intergenic
935018021 2:99202443-99202465 CATGGTAGGGGTCGGATGGATGG - Intronic
935381978 2:102462201-102462223 CTTGGTAGGGTTAGGGAGAATGG - Intergenic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935622318 2:105141012-105141034 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
935852265 2:107235619-107235641 CTTGGTGGGGGGAGGGGCAATGG + Intergenic
936297489 2:111278043-111278065 CCTGGTGGGGGGAGGATGGGAGG + Intergenic
936482036 2:112893089-112893111 CGTGATTGGGGGAGGGTGGCAGG + Intergenic
936516604 2:113185219-113185241 CTGGGTGGGAGGAGGATGGAGGG + Intronic
936642679 2:114333249-114333271 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
936726817 2:115329577-115329599 TTGGGTAGGGGGAGCGGGGAGGG - Intronic
936917517 2:117655049-117655071 TAGGGTGGGGGGAGGGTGGAGGG + Intergenic
937130198 2:119505322-119505344 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
937222212 2:120348151-120348173 CTTGGGAGGGGCATGGTGGGAGG + Intronic
937540740 2:122949633-122949655 TTTGGAAGGTGGAGGGTGGGAGG - Intergenic
937802963 2:126102263-126102285 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
937977054 2:127588741-127588763 ATGGGTAGTGGGTGGGTGGATGG + Intronic
938100180 2:128493124-128493146 CTGGGCAGGAGCAGGGTGGACGG - Intergenic
938314106 2:130314705-130314727 CATGGCAGGGGGAGGGAGGGTGG - Intergenic
938520254 2:132063016-132063038 GGTGGTGGGGGGAGGGGGGAGGG - Intergenic
938885520 2:135643958-135643980 ATTGGAAGGTGGAGGGTGGGAGG + Intronic
938954184 2:136283097-136283119 CTTGGGTGGGGGAGGGTGGCTGG - Intergenic
939066009 2:137484161-137484183 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
939236642 2:139502769-139502791 CTTGGAATGGGGAGGGTAGAAGG + Intergenic
940324430 2:152410659-152410681 CTTGGTGGGGTGGGGGTGAAGGG - Intronic
940413880 2:153398063-153398085 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
940696395 2:156984705-156984727 CGTGGAGGGGGGAGGGGGGAGGG + Intergenic
940731405 2:157397289-157397311 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
940752773 2:157645929-157645951 TGTGGTCGGGGGAGGGGGGAGGG + Intergenic
941015510 2:160351176-160351198 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
941114457 2:161456116-161456138 CTTGGTTGGTGGAGTGGGGAAGG - Intronic
941337791 2:164266983-164267005 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
941494990 2:166189090-166189112 TATGGTGGGGGGAGGGGGGAGGG - Intergenic
941563745 2:167082087-167082109 GTGGGTAGAGGGAGGGGGGAGGG - Intronic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
941726980 2:168871206-168871228 GTGGGTTGGGGGAGGGGGGAGGG + Exonic
941806873 2:169718573-169718595 GTTGTTAGGGGGAGGGTGCTAGG - Intronic
942034997 2:172001986-172002008 CTTGGGAGGTGGAGGTGGGAGGG + Intronic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942628043 2:177924870-177924892 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
943120969 2:183734784-183734806 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
943213894 2:185005645-185005667 TTTGGGAGGGGTAGGGTGCAGGG - Intergenic
943599136 2:189893069-189893091 CTCAGTAGGGGGAGGGGCGACGG - Intronic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
943993532 2:194730165-194730187 GTTGGAAGGTGGAGGGAGGAAGG + Intergenic
944056648 2:195528932-195528954 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
944209260 2:197189454-197189476 GTAGTTAGGGGGAGTGTGGAAGG - Intronic
944315939 2:198285882-198285904 CTAGGTAGGGGGAGGGTGAAGGG + Intronic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944421269 2:199533457-199533479 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
944483698 2:200182002-200182024 CTTGGAAGGGGGAAGGGGCAGGG - Intergenic
944488576 2:200233490-200233512 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
944834251 2:203562650-203562672 TATGGTAGGGGGTGGGTGGTAGG - Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945354169 2:208817485-208817507 CGGGGTCGGGGGAGGGGGGAGGG + Intronic
945553759 2:211254058-211254080 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
945731187 2:213537162-213537184 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
945770669 2:214038683-214038705 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
946258689 2:218467182-218467204 CTGGGCAGGGGGAGGGGGAAGGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946310182 2:218878957-218878979 CATGGTAGGGAGAGTGGGGAGGG + Intergenic
946381299 2:219350881-219350903 CTTGGTGGGGGAAGGGGAGAGGG - Intergenic
946674917 2:222149043-222149065 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
946684223 2:222251245-222251267 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
946873771 2:224108166-224108188 CTTTGAAGGGTGAGGGTGAATGG + Intergenic
946882583 2:224191391-224191413 CACAGTAGGGTGAGGGTGGAAGG - Intergenic
947117339 2:226785884-226785906 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
947132961 2:226948417-226948439 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
947341359 2:229143196-229143218 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
947377044 2:229506660-229506682 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947973204 2:234342116-234342138 CATGGAACGGGGAGGGGGGATGG - Intergenic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948458416 2:238117935-238117957 GGTGGAAGGAGGAGGGTGGATGG + Intronic
948458612 2:238118650-238118672 AGTGGTTGGAGGAGGGTGGATGG + Intronic
948580288 2:238982721-238982743 ATTGGAGGGTGGAGGGTGGAAGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948890316 2:240904200-240904222 CCTGGTGGGGGGAGGTTGCAGGG + Intergenic
1168741820 20:198616-198638 CTTGGAGGGTGGAGGGTGGGGGG + Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168877077 20:1179417-1179439 CTTGGGGGTGGGAGGGTGGGGGG - Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169178180 20:3538098-3538120 ATAGGTGGGGGGAGGGGGGAGGG - Intronic
1169377176 20:5075479-5075501 TTTGGGAGGCTGAGGGTGGATGG + Intronic
1169499277 20:6143586-6143608 ATTGGAGGGTGGAGGGTGGAAGG - Intergenic
1169708298 20:8533004-8533026 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1169742039 20:8905183-8905205 CTTGGGAGTGGGAGGTTGCAAGG + Intronic
1169856506 20:10109331-10109353 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1169911861 20:10653572-10653594 CGTGGAGGGTGGAGGGTGGAGGG + Intronic
1170014165 20:11762664-11762686 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1170457740 20:16549181-16549203 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1170717711 20:18846551-18846573 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171033029 20:21693751-21693773 CTTGGCAGTGGGATGGAGGAAGG - Intergenic
1171480435 20:25451706-25451728 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1171907583 20:30912447-30912469 GTTGGGAGGCGGAGGGTGGGGGG - Intergenic
1171910158 20:30944253-30944275 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1172000834 20:31775449-31775471 CCTGGGAGGGGGAGGTTGCAGGG - Intronic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172180606 20:33001180-33001202 GAAGGCAGGGGGAGGGTGGATGG - Intronic
1172352642 20:34255401-34255423 CTTGGGAGGGTGAGGTGGGAGGG - Intronic
1172555923 20:35841235-35841257 CTTGGGAGGCTGAGGCTGGAGGG + Intronic
1172629018 20:36365972-36365994 ATTGGAGGGGAGAGGGTGGAGGG + Intronic
1172850547 20:37959852-37959874 TTTGGGGGGTGGAGGGTGGAGGG + Intergenic
1173011023 20:39182328-39182350 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1173656730 20:44704694-44704716 TGTGTTAGGGGGAGGGTGGGGGG - Intergenic
1174485387 20:50857857-50857879 CATGGTGGGGTGAGGGTGGGCGG + Intronic
1174516196 20:51094194-51094216 CCTGGTAGGTGGAGGTTGCAGGG + Intergenic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174595618 20:51681075-51681097 CCTGGGAGGAGGAGAGTGGAAGG - Intronic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1174968045 20:55241508-55241530 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1175011179 20:55738326-55738348 CTCGGAAGGGGGAAGATGGAGGG + Intergenic
1175028812 20:55931638-55931660 CTAGATAGGGGGAGGGAGGGAGG + Intergenic
1175349909 20:58310093-58310115 CTTGGACGTGGGAGGGGGGAAGG - Intronic
1175844583 20:62051759-62051781 CTTGGCAGGGGCAGCGTTGAGGG - Intronic
1176024999 20:62981372-62981394 GTTGCTGGGGGGAGGGGGGAAGG - Intergenic
1176192390 20:63818210-63818232 CCTGGCAGGGGCAGCGTGGATGG - Intronic
1176233965 20:64045582-64045604 CTTGGTTGGGGGTTGGGGGAGGG + Intronic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176736411 21:10551286-10551308 TTGGGTAGGGGGAGGGGGGAGGG + Intronic
1176776388 21:13137758-13137780 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1176902899 21:14465100-14465122 GTTGGAGGGTGGAGGGTGGAAGG - Intergenic
1176912812 21:14587887-14587909 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1177218537 21:18160486-18160508 TTTGGAAGGGGGAGGGTGGGAGG - Intronic
1177285041 21:19039000-19039022 TTTGGAGGGTGGAGGGTGGAGGG - Intergenic
1177369286 21:20180484-20180506 CTTGGGTGGGGGATGCTGGATGG + Intergenic
1177412657 21:20750308-20750330 TTTGGAAGGTGGAGGGTTGAAGG + Intergenic
1177482554 21:21709512-21709534 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1177852001 21:26359659-26359681 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178049406 21:28731606-28731628 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1178257389 21:31066736-31066758 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179628531 21:42662344-42662366 ACAGGTAGGGGGAGGGTGGATGG - Intronic
1180074033 21:45453691-45453713 GTGGGCAGGGGAAGGGTGGAGGG + Intronic
1180286309 22:10747634-10747656 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1180552810 22:16554263-16554285 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1181130030 22:20725786-20725808 CTTGGGAGGGGTAGCGGGGAAGG + Intronic
1181315315 22:21967325-21967347 CGTGGAAAGGGGAGAGTGGAAGG + Intronic
1181338687 22:22161594-22161616 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1181351274 22:22260096-22260118 CTAGTTAGGGGGAGAGAGGAAGG - Intergenic
1181459410 22:23077519-23077541 CTTGGAATTGGGAGGCTGGATGG + Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1182179655 22:28333992-28334014 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1182552267 22:31106827-31106849 CCTGGTTGGGGGAGGATGGGAGG + Intronic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183069778 22:35387896-35387918 TTCTGAAGGGGGAGGGTGGAAGG - Intronic
1183143357 22:35965953-35965975 CATGGCAGGGGGCGGGGGGATGG - Intronic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183854700 22:40623462-40623484 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
1183937251 22:41270214-41270236 CTTGGGAGGTGGAGGTTGCAGGG - Intronic
1184020984 22:41821461-41821483 ACTGGTGGGGGGAGGGGGGAGGG - Intronic
1184322879 22:43756514-43756536 ACTGGTAGGGTGAGGGTGGGAGG + Intronic
1184334947 22:43847600-43847622 CTTGGAAGGGGGTGGGAGGCTGG - Intronic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184469870 22:44690345-44690367 CAAGGCAGGGGGAGGGAGGAGGG + Intronic
1184605435 22:45571043-45571065 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1184777827 22:46632147-46632169 CTTGGGAGGGGAAGGTTGGAGGG + Intronic
1184784598 22:46665533-46665555 CCTGGTGGGGGGAGGCGGGAGGG + Intronic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949207624 3:1459202-1459224 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
949430879 3:3974435-3974457 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
949457956 3:4259113-4259135 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949646503 3:6101285-6101307 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
950081357 3:10224525-10224547 CTTGGTAGGTGCAGGGTGCAGGG - Intronic
950286371 3:11748484-11748506 CTTGGGAGGGTGAGGTAGGAGGG - Intergenic
950287884 3:11759392-11759414 CTTGGAAGTGGTACGGTGGAAGG + Intergenic
950364592 3:12474177-12474199 CTTGGGAGGGTGAGGTGGGAGGG - Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950797434 3:15521396-15521418 GTTGGTGGAGGGAGGTTGGAAGG - Intronic
950919786 3:16682590-16682612 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
950989459 3:17417332-17417354 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
951167837 3:19503778-19503800 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
951238297 3:20261074-20261096 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
951380878 3:21983305-21983327 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
951861454 3:27258361-27258383 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
952062532 3:29527784-29527806 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
952436962 3:33281185-33281207 AGGGGTAGGGGGAGGGCGGAGGG - Intronic
952515501 3:34100061-34100083 TTTGGTGGAGGGAGGGGGGAGGG + Intergenic
952534323 3:34294340-34294362 CTTGGTATGTGGATGGTGGATGG + Intergenic
952548051 3:34444126-34444148 TTTGGAAGGTGGAGGGTGAAAGG - Intergenic
952740316 3:36728355-36728377 ATTGGTGGGGGGTGGGGGGACGG + Intronic
952833558 3:37585422-37585444 CTTGGGAGAGGGATGGTGGTTGG - Intronic
952873024 3:37919102-37919124 CTTGGTGGGGGGTAGGGGGAAGG - Intronic
952881245 3:37987340-37987362 CCTGCTAGGGGGAGGAGGGAGGG + Intergenic
952943039 3:38457797-38457819 CTTCCTTGGGGGAGGGCGGAGGG + Intronic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953052972 3:39362353-39362375 CTTGGTGGGGGCAGGGTAGGCGG + Intergenic
953132628 3:40155132-40155154 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953271174 3:41446727-41446749 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
953301345 3:41779835-41779857 TGTGGTCGGGGGAGGGGGGAGGG + Intronic
953583537 3:44178714-44178736 TTGGGAAGGTGGAGGGTGGAAGG - Intergenic
953814103 3:46140025-46140047 CGGGGTGGGGGGAGGGGGGAAGG - Intergenic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
954384501 3:50237153-50237175 CTTGGTGCAGGAAGGGTGGAGGG - Intronic
954434445 3:50488629-50488651 CTTGCTAGGGGGGTGGTAGAGGG - Intronic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
954519617 3:51213069-51213091 CTAGGAATGGGGAGGGAGGAGGG - Intronic
955294840 3:57725468-57725490 CTGGGAAGGGGGAGGGGGAATGG - Intergenic
955526860 3:59829966-59829988 CTTGGGAGGCTGAGGTTGGAGGG + Intronic
955653248 3:61216994-61217016 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
955710693 3:61775927-61775949 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
956243277 3:67153638-67153660 CGGGGTAGGGGGAGGGGGGAGGG + Intergenic
956298606 3:67743272-67743294 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
956318127 3:67962208-67962230 CTTGGTGGGGGGAATGGGGATGG + Intergenic
956379429 3:68650175-68650197 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
956513672 3:70022273-70022295 CCGGGTGGGGGGAGGGAGGAGGG + Intergenic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
957219814 3:77367375-77367397 GTTGGGAAGGGGAGAGTGGAAGG - Intronic
957340167 3:78885254-78885276 CTTGTGGGGTGGAGGGTGGAAGG + Intronic
957485805 3:80861432-80861454 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
957649628 3:82982824-82982846 ATTGGAGGGTGGAGGGTGGAAGG + Intergenic
957696109 3:83639555-83639577 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
957886166 3:86290209-86290231 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
958066748 3:88553214-88553236 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
958069494 3:88591878-88591900 ATTGGAGGGTGGAGGGTGGAGGG + Intergenic
958089210 3:88854611-88854633 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
958511831 3:95059938-95059960 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
958512755 3:95069347-95069369 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
958717352 3:97801856-97801878 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
958725790 3:97904879-97904901 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
958828047 3:99055879-99055901 CTTGGGAGGGGGACGCTGGCAGG + Intergenic
959078673 3:101778119-101778141 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
959107624 3:102082620-102082642 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
959257811 3:104036920-104036942 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
959321902 3:104887177-104887199 CATAGCAGGAGGAGGGTGGATGG + Intergenic
959690650 3:109193770-109193792 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
959717827 3:109452733-109452755 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
959781115 3:110234288-110234310 TTTGGTGGGGGGTGGGTGGAGGG + Intergenic
959909863 3:111751688-111751710 TTTGCTGGGGGGAGGGGGGAGGG + Intronic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960128286 3:114024700-114024722 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960590892 3:119364216-119364238 CATGGTTGGGGGTGGGGGGATGG + Intronic
960731492 3:120732704-120732726 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
960826857 3:121796248-121796270 ATGGGTTGGGGGAGGCTGGAAGG - Intronic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
961302718 3:125932601-125932623 TTTGGTTGGGGGATGGTGGAGGG - Intronic
961654158 3:128432488-128432510 CTGGGCAGCGGGAGTGTGGAGGG + Intergenic
961885347 3:130093187-130093209 TTTGGTTGGGGGATGGTGGAGGG + Intronic
962058490 3:131900045-131900067 CTGGGTAGGTGGAGTGGGGAGGG + Intronic
962100658 3:132339024-132339046 CTTGGAAGGTGAAGGGTGGGAGG - Intronic
962371436 3:134823948-134823970 CTGGGCAGGGGGAGGGCTGATGG - Intronic
962634771 3:137319422-137319444 CTTGGTGGGGGGAGGGGTGTCGG - Intergenic
962677507 3:137767914-137767936 CTTCCTAGGGGGCGGGAGGAGGG - Intergenic
962806238 3:138929586-138929608 CTTCGTAGGTGGGGGGTGGGAGG - Intergenic
962848528 3:139290607-139290629 CCTGGCAGCGGCAGGGTGGAGGG - Intronic
963136767 3:141912799-141912821 CTTGGTAATGGGAGGGAAGAGGG - Intronic
963178225 3:142324237-142324259 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
964162918 3:153667634-153667656 TTTGGCGGGGGGAGGGTGCACGG - Intergenic
964416184 3:156450853-156450875 TTTGGGGGGGGGTGGGTGGATGG - Intronic
964433795 3:156631668-156631690 CCTGGTATAGGGTGGGTGGAGGG + Intergenic
964552735 3:157902680-157902702 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
965152114 3:164990747-164990769 TGTGGTAGGGGGATGGGGGAGGG + Intronic
965177981 3:165361089-165361111 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
965194685 3:165578191-165578213 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
965195667 3:165591015-165591037 TTTGGTGGGGGGAGGGGGGGAGG + Intergenic
965343264 3:167516240-167516262 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
965343409 3:167517875-167517897 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
965758685 3:172052191-172052213 CGTGGGAGGCTGAGGGTGGAAGG - Intronic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966010565 3:175070012-175070034 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
966010727 3:175072688-175072710 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966498506 3:180609248-180609270 CTTGGTAGGGGGTGGGGGTGCGG - Intronic
966500916 3:180637921-180637943 GTTGGTGGGTGGAGGGTGAAAGG + Intronic
966736016 3:183187860-183187882 CTGGGTAGGGGAAGGGAAGAAGG - Intronic
967065284 3:185909914-185909936 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967272353 3:187741960-187741982 TTTGGTGGGGGGAGGGTGCCTGG - Intronic
967680941 3:192363089-192363111 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
967840749 3:194003134-194003156 CCTGGGAGCGGGAGGGAGGAGGG - Intergenic
968152455 3:196347854-196347876 CTTGAAACGGGGAGGGTGGGGGG - Exonic
968298291 3:197593864-197593886 GTTGCTAGGGGGAGGGTGCTAGG + Intergenic
968375203 4:34380-34402 CTTGATGGGGGGAGGGTGGGAGG - Intergenic
968425886 4:523068-523090 CCTGGAAGCGGGAGCGTGGAGGG + Intronic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968614816 4:1572653-1572675 CTTGGTCGGGGGAAGGGGGCTGG + Intergenic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968722946 4:2221211-2221233 CTTGGGAGGTGGAGGTTGCAGGG - Intronic
968994545 4:3937373-3937395 TGTGGTTGGGGGATGGTGGATGG + Intergenic
969162533 4:5273841-5273863 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
969223467 4:5777979-5778001 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
969297693 4:6279439-6279461 CGTGGTTGGTGAAGGGTGGAGGG + Intronic
969302620 4:6306114-6306136 CTTGTAAGAGGGAGGCTGGAGGG + Intergenic
969665662 4:8555923-8555945 CTTGGCAAGGGGAGGCTGGCGGG + Intergenic
969819401 4:9708855-9708877 TTTGGTTGGGGGATGGCGGAGGG - Intergenic
970032707 4:11695126-11695148 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
970041180 4:11798589-11798611 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
970085443 4:12340796-12340818 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
970401508 4:15721656-15721678 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
970538974 4:17058623-17058645 CTTAGAAGGGACAGGGTGGAGGG + Intergenic
970816049 4:20157114-20157136 CATGGTAGGGGCTGGGTGGGAGG - Intergenic
970895869 4:21103725-21103747 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
970954465 4:21794123-21794145 CGGGGTAGGGGGAGGGGAGAGGG + Intronic
971012961 4:22459313-22459335 TTTGGAGGGAGGAGGGTGGAAGG + Intronic
971137566 4:23886424-23886446 GTTGGTAAGGGGAGGATGGGGGG + Intronic
971222645 4:24722710-24722732 CTTGGGAGGTGGAGGTTGCAGGG + Intergenic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
972076020 4:35087978-35088000 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
972117801 4:35659456-35659478 GGTGGTCGGGGGAGGGGGGAGGG - Intergenic
972151206 4:36093200-36093222 ATTGGAAGGCGGAGGGTGGGGGG + Intronic
972192144 4:36606960-36606982 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
972233812 4:37105490-37105512 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972686165 4:41355456-41355478 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
972845288 4:42982196-42982218 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
972869729 4:43282695-43282717 CTTGGTAGTGGCTGGCTGGAAGG + Intergenic
973060912 4:45722903-45722925 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
973064542 4:45772635-45772657 CTTGTTGTGGGGTGGGTGGAGGG - Intergenic
973087035 4:46077150-46077172 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
973297340 4:48539517-48539539 CGGGGCAGGGGGAGGGTGGGGGG - Intronic
973328106 4:48884366-48884388 CTTGGGAGGGTGAGGTGGGAGGG + Intergenic
973554635 4:52070534-52070556 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
973997720 4:56476172-56476194 CTTGGGAGGCGGAGGTGGGAGGG + Intronic
974131873 4:57766983-57767005 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
974181431 4:58388715-58388737 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
974342793 4:60636099-60636121 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
974357421 4:60831413-60831435 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
974459359 4:62167229-62167251 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
974690114 4:65288374-65288396 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
974774052 4:66457475-66457497 TGTGGTGGGGGGATGGTGGAGGG - Intergenic
974827088 4:67144907-67144929 CCTGTTAGGGGGTGGGGGGAGGG + Intergenic
974861919 4:67532747-67532769 GGGGGTAGGGGGAGGGGGGAAGG + Intronic
974920446 4:68232850-68232872 TTTGTAAGGGGGAGGGGGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975021909 4:69501241-69501263 CTGGGCCGGGGGCGGGTGGAAGG + Intronic
975215009 4:71742971-71742993 CTTGGTGTGGGCAGGGTGGGGGG + Intronic
975244360 4:72102517-72102539 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
975327846 4:73080102-73080124 TTTGGGAGGGGGAGGGGGGATGG - Intronic
975340039 4:73229133-73229155 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
975411077 4:74050519-74050541 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
975437443 4:74369300-74369322 CTCAGAAGGGGAAGGGTGGAAGG - Intronic
975803620 4:78089279-78089301 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
975955921 4:79838376-79838398 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
975962799 4:79933692-79933714 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
976352724 4:84078357-84078379 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
976357269 4:84132651-84132673 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
976400004 4:84596705-84596727 CTTGGTGGGGGGAGTGGGGAGGG + Intronic
976533403 4:86183280-86183302 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
976562855 4:86521816-86521838 GGTGGTAGGGGGATGGTGAATGG - Intronic
976767113 4:88609173-88609195 CTTGGGAGGTTGAGGTTGGAAGG + Intronic
976810610 4:89096322-89096344 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
976879535 4:89902176-89902198 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
976931882 4:90576530-90576552 GTTGTTAGGGGGTGAGTGGAGGG - Intronic
977102813 4:92839409-92839431 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
977193363 4:94028300-94028322 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
977256536 4:94747058-94747080 TTTGGAAGGTGGAAGGTGGAAGG + Intergenic
977353858 4:95920625-95920647 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
977488365 4:97678766-97678788 TAGGGTCGGGGGAGGGTGGAGGG - Intronic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977848912 4:101800131-101800153 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
977974640 4:103250407-103250429 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
978285575 4:107073407-107073429 ATTGGTAGGGGTGGGGGGGAGGG - Intronic
978364135 4:107962665-107962687 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
978728130 4:111994853-111994875 TTTGGTAGGGGGAGGTAGGTGGG - Intergenic
978781004 4:112554194-112554216 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
979948254 4:126860994-126861016 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
980054085 4:128062764-128062786 CTTTATGGGGGGAGGGGGGAGGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980390198 4:132134726-132134748 TGGGGTAGGGGGAGTGTGGAGGG + Intergenic
980398860 4:132253424-132253446 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
980399392 4:132259990-132260012 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
980542600 4:134213767-134213789 TGTGGGGGGGGGAGGGTGGAGGG + Intergenic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981038265 4:140194917-140194939 CTTGGTAGAGGGACAGTGGGAGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981344443 4:143659234-143659256 GTTGGTGGGGGTAGGGGGGAGGG - Intronic
981408350 4:144397528-144397550 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
981969878 4:150654684-150654706 TTGGGTAGGGGGAGGGGGTAGGG - Intronic
982026805 4:151259404-151259426 CATGGAGGGGTGAGGGTGGAGGG + Intronic
982383189 4:154771912-154771934 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
982760439 4:159277064-159277086 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
983040652 4:162921491-162921513 CTTGGAAGGGTGAGGGGTGACGG - Intergenic
983137854 4:164106616-164106638 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983278175 4:165644172-165644194 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
983497825 4:168463430-168463452 ATTGGAGGGCGGAGGGTGGAGGG + Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983582533 4:169323685-169323707 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
983689770 4:170454060-170454082 ATTGGAAGGTGGAGGGTGGAAGG - Intergenic
984243604 4:177248069-177248091 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
984315091 4:178118848-178118870 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
984921742 4:184770556-184770578 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
985390634 4:189488830-189488852 TAGGGTAGGGGGAGGGGGGAGGG + Intergenic
985459840 4:190094664-190094686 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
985468838 5:24295-24317 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
985632648 5:1022034-1022056 GGCGGTAGGGGGAGGGTGGGAGG - Intronic
986007876 5:3683380-3683402 TTAGGTAGTGGGAGGGTGGGAGG + Intergenic
986033038 5:3910921-3910943 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
986161482 5:5233486-5233508 GTTGGAAGGTGGAGGGTGGGAGG - Intronic
986357688 5:6944771-6944793 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
986404577 5:7412866-7412888 CCTGGTAGGGGCAGGCAGGATGG - Intronic
986471915 5:8084357-8084379 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
986848995 5:11788819-11788841 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
987134521 5:14888620-14888642 CTTGGGAGGGTGAGGTGGGAGGG - Intergenic
987475508 5:18387599-18387621 GTGGGTAGGGGGAGTGGGGATGG - Intergenic
987566869 5:19600199-19600221 CGTGGGTGGGGGAGGGGGGAGGG + Intronic
987586645 5:19864378-19864400 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
987699404 5:21376531-21376553 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
987781122 5:22436269-22436291 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
987990662 5:25207396-25207418 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
988178196 5:27754701-27754723 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
988312883 5:29584067-29584089 CCTGGTAGGCGGAGGTTGCAGGG + Intergenic
988314426 5:29604486-29604508 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
988491350 5:31708073-31708095 CTAGGTTGGGGGAGGCAGGAAGG + Intronic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
988850094 5:35172363-35172385 CTTGGTAGGAGGTTGGAGGAAGG + Intronic
989415440 5:41169682-41169704 AGTGGTAGGAGGAGGGTGAAGGG + Intronic
989558855 5:42828222-42828244 ATTGGAGGGTGGAGGGTGGAAGG - Intronic
989607536 5:43258921-43258943 CTTAGAAGGGGTAGGGTGGGAGG - Intronic
989661006 5:43797615-43797637 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
989804609 5:45587549-45587571 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
989862816 5:46402590-46402612 TGCGGTAGGGGGAGGTTGGAGGG + Intergenic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990151271 5:52820372-52820394 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
990153598 5:52848718-52848740 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
990212298 5:53493671-53493693 CTTGGGAGGCTGAGGTTGGAGGG + Intergenic
990244189 5:53847163-53847185 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
990456188 5:55990880-55990902 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
990482710 5:56227338-56227360 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
990827717 5:59920860-59920882 TGTGGTGGGGGGAGGGGGGAGGG + Intronic
990929112 5:61067300-61067322 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
990934206 5:61129642-61129664 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
991029306 5:62066232-62066254 CCTGGTAGGTGGTGGCTGGAGGG - Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991160377 5:63492083-63492105 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
991170071 5:63614615-63614637 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
991231454 5:64337647-64337669 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
991250114 5:64550721-64550743 CAGGGTTGGGGGAGGGGGGAGGG - Intronic
991306136 5:65177975-65177997 GTTGGAAGAGGGAGGCTGGATGG - Intronic
991439122 5:66627932-66627954 ATTGGTAGGGGTGGGGTGGGGGG - Intronic
991490036 5:67173718-67173740 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
991541665 5:67737041-67737063 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
991611196 5:68451132-68451154 TTTGGAGGGGGGAGGGTGGGGGG - Intergenic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
992329546 5:75701570-75701592 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
992405367 5:76452381-76452403 CTTCCTGGGGGGAGGGTAGAGGG - Intronic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992576254 5:78116816-78116838 TTTGCTGGGGGCAGGGTGGAGGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
992772634 5:80062675-80062697 TGGGGTAGGGGGAGGGGGGAAGG - Intronic
992821171 5:80497793-80497815 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
993008098 5:82449736-82449758 CTAGGTTGGGGGTGGGTGGTGGG + Intergenic
993117717 5:83737258-83737280 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
993212731 5:84975536-84975558 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
993229940 5:85221957-85221979 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
993260968 5:85657735-85657757 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
993296344 5:86146385-86146407 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
993659815 5:90619742-90619764 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
993921097 5:93803549-93803571 ATTGGAGGGTGGAGGGTGGAGGG + Intronic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994262744 5:97679406-97679428 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
994417241 5:99487426-99487448 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994566301 5:101449931-101449953 CTTGAGAGGTGGAGGGAGGAGGG + Intergenic
994620880 5:102160473-102160495 TTTGGAGGGTGGAGGGTGGAAGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
994902490 5:105793557-105793579 CTTGGTAGGCTGAGGTTGGGAGG - Intergenic
994904564 5:105821583-105821605 CTTGGGAGAGGGAGGTTGGGAGG + Intergenic
994951643 5:106471020-106471042 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
995279619 5:110318349-110318371 CGGGGTTGGGGGAGGGGGGAGGG + Intronic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995384663 5:111575650-111575672 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
995633241 5:114157146-114157168 TAGGGTAGGGGGAGGGGGGAGGG - Intergenic
995677317 5:114676738-114676760 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
996977899 5:129457219-129457241 TTTGGTTGGGGGAGGGCGGGTGG + Intergenic
997087981 5:130823600-130823622 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
997095440 5:130905436-130905458 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
997116695 5:131133068-131133090 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
997128264 5:131250571-131250593 CAGGGTAGGGGGAGGTGGGAAGG + Intronic
997805423 5:136912705-136912727 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
997966268 5:138358934-138358956 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998291980 5:140924817-140924839 CCTGGGAGGGGGAGGTTGCAGGG + Intronic
998401580 5:141851422-141851444 CTCCGTAGGGGGAGGGTATATGG - Intergenic
998487465 5:142515729-142515751 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
998600954 5:143584387-143584409 CTTGGCAGGGGAAGGATGGGAGG - Intergenic
998690653 5:144584042-144584064 CTTGTTATGGGGTGGGTGGGGGG - Intergenic
998710829 5:144823485-144823507 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
998837753 5:146219827-146219849 GTTGGAAGGAGGAGAGTGGATGG - Intronic
998846670 5:146316878-146316900 CTTGGGAGGTGGAGGTTGCAGGG + Intronic
998916248 5:147014734-147014756 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
998917915 5:147036161-147036183 GTTGGAAGGTGGAGGGTGGGAGG - Intronic
998922927 5:147089709-147089731 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999295863 5:150459072-150459094 CGTGGAGGGTGGAGGGTGGAGGG + Intergenic
999484574 5:151983115-151983137 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
999572790 5:152939644-152939666 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
999814004 5:155157735-155157757 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
999846465 5:155486469-155486491 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
999870272 5:155742644-155742666 CTTGGTATGAGGTGGGTGGGGGG - Intergenic
1000451950 5:161400430-161400452 TTTTGTAGCGGGAGGGTGGTGGG - Intronic
1000480477 5:161767738-161767760 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1000542110 5:162553130-162553152 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1001071841 5:168592688-168592710 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1001214915 5:169846848-169846870 CTCAGAAGGGGGAGGGTGGAAGG - Intronic
1001286788 5:170429614-170429636 CTTGGAAGGGTGAGGGTGTGGGG - Intronic
1001392310 5:171388587-171388609 CGTGGTTGGGGGAGGGAGGGGGG + Intronic
1001965713 5:175908615-175908637 CTTGGTCGGGGGGTGGTGCAGGG - Intergenic
1002298674 5:178245690-178245712 ATTGGTAGATGGAGGATGGATGG - Intronic
1002374753 5:178780757-178780779 CGTGGGAGGTGGAGGGTGCAGGG - Intergenic
1002466748 5:179412211-179412233 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466837 5:179412416-179412438 GTCGGTTGGGGGAGGGAGGAAGG - Intergenic
1002466898 5:179412554-179412576 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466969 5:179412717-179412739 GCCGGTAGGGGGATGGTGGAAGG - Intergenic
1002466999 5:179412786-179412808 GCCGGTAGGGGGATGGTGGAAGG - Intergenic
1002467008 5:179412808-179412830 GCCGGTAGGGGGATGGTGGAAGG - Intergenic
1002467074 5:179412964-179412986 GTCGGTGGGGGGAGGGTGGAAGG - Intergenic
1002467084 5:179412986-179413008 GTCGGTGGGGGGAGGCTGGAAGG - Intergenic
1002674812 5:180902666-180902688 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1002718546 5:181244239-181244261 CTTGGTGCGGGGAGGGTTGACGG + Intronic
1202772921 5_GL000208v1_random:30020-30042 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1002893788 6:1362107-1362129 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1003092428 6:3115279-3115301 CTTGGCAGCGGGAGGGTAAAAGG - Intergenic
1003114926 6:3277357-3277379 CCTGGAAGGGTGAGGGTGGGCGG - Intronic
1003167092 6:3689478-3689500 CATGGAAGGGGAAGGATGGAAGG - Intergenic
1003189688 6:3863319-3863341 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1003481741 6:6540616-6540638 CTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1003734587 6:8864319-8864341 GTTGGAAGGTGGAGGGTGGGAGG + Intergenic
1003885216 6:10515331-10515353 CTTGGGAGGTGGAGGCTGCAGGG + Intronic
1004058885 6:12171153-12171175 CTTGGGAGAGGGAGGGATGAGGG - Intergenic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005725778 6:28646916-28646938 CTTAGTTGGGGGTGGGTGAATGG - Intergenic
1005968147 6:30742062-30742084 GTTGGTAGGGAGAGGGAGAAGGG + Intronic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006442810 6:34062664-34062686 CTTGGTAGGAGCAGCGTGCATGG + Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006838913 6:37015718-37015740 CGTGGCAGGGGCAGGGAGGATGG - Intronic
1007528851 6:42522266-42522288 ATTGGTGGGGGGTGGGGGGAGGG + Intergenic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007702684 6:43773797-43773819 CTTGGATGGGGGAGGGTGGTTGG + Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1008026927 6:46648512-46648534 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
1008153581 6:47987250-47987272 GTGGGTGGGGGGAGGGGGGAAGG + Intronic
1008281828 6:49604519-49604541 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1008340709 6:50360537-50360559 CTTGGATGAGGGAGGGTGGAAGG + Intergenic
1008529726 6:52445440-52445462 CGGGGTAGGGGGAGGGGGGAGGG - Intronic
1008590592 6:52989950-52989972 CTTGGGAGGCTGAGGGTGGCAGG - Intronic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1008796934 6:55314042-55314064 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1009293565 6:61914509-61914531 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009384322 6:63070418-63070440 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1009429629 6:63551677-63551699 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1009486830 6:64235230-64235252 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1009556922 6:65182057-65182079 TTGGGTAGGGGTAGGGGGGAGGG + Intronic
1009874340 6:69486191-69486213 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1009945353 6:70336461-70336483 CTTGGTGGGGGGAGGGGCGTCGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010276343 6:73972409-73972431 CTTGGTACGGGGAGGGGTGTCGG + Intergenic
1010289538 6:74119575-74119597 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1010301137 6:74261691-74261713 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1010546010 6:77157524-77157546 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1010669108 6:78665787-78665809 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1010884844 6:81223462-81223484 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1011022251 6:82827623-82827645 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1011093598 6:83633951-83633973 GTGGGTGGGGGGAGGGCGGAGGG + Intronic
1011171876 6:84513797-84513819 CTTGGGAGGGGAAGCGTGGGAGG - Intergenic
1011282920 6:85694938-85694960 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1011331537 6:86212628-86212650 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1011378912 6:86721296-86721318 TCTGGTAGGGGGTGGGGGGACGG + Intergenic
1011471189 6:87709418-87709440 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1011598951 6:89042139-89042161 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1012528161 6:100202327-100202349 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1012613432 6:101246118-101246140 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1012692706 6:102334914-102334936 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1012862003 6:104571259-104571281 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1012928281 6:105289939-105289961 CATGGTGGGGGAAGGGCGGAGGG + Intronic
1013137580 6:107297456-107297478 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013486505 6:110601446-110601468 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1013610887 6:111794044-111794066 CCAGGTAGGGGCAGGCTGGAGGG - Intronic
1013696600 6:112709616-112709638 TTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1013712154 6:112914507-112914529 TTGGGTCGGGGGAGGGGGGAGGG - Intergenic
1014040800 6:116822710-116822732 GTGGGTTGGGGGAGGGGGGAGGG + Intronic
1014091539 6:117409064-117409086 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1014380112 6:120729312-120729334 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1014424845 6:121290999-121291021 TGGGGTTGGGGGAGGGTGGATGG + Intronic
1014432907 6:121390493-121390515 GTTGGTTGGGGGGGGGTAGATGG - Intergenic
1014649799 6:124022035-124022057 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1014660521 6:124165657-124165679 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1014713278 6:124834254-124834276 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1014953860 6:127592933-127592955 CTTTGAAGGGGGAGGGGGAATGG + Intergenic
1014980689 6:127943017-127943039 CTTGGAAGGGGGTTGGGGGAAGG - Intergenic
1015050636 6:128835462-128835484 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1015420665 6:133004263-133004285 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1015541056 6:134314339-134314361 CTTGGTTGGGGGAGGGGGGTAGG + Intronic
1016326854 6:142912773-142912795 CATGGTGTGGGGATGGTGGATGG - Intronic
1016866270 6:148770437-148770459 CATGGTAGGGGAAGGGAAGAGGG + Intronic
1017002800 6:150007508-150007530 CGGGGTAGGGGGAGGGGGAAGGG - Intergenic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017102620 6:150862218-150862240 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1017299851 6:152844410-152844432 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017544673 6:155438275-155438297 CTTGGGATGGGCAAGGTGGATGG - Intronic
1017640197 6:156486002-156486024 TAGGGTAGGGGGAGGGGGGAGGG - Intergenic
1017745141 6:157440005-157440027 CTTGGTGGGGTGTGGGAGGAGGG + Intronic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1017902774 6:158732620-158732642 CTTGGAAGATGGAGGCTGGATGG - Intronic
1017981410 6:159403594-159403616 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1018046579 6:159970593-159970615 TTTGGAAGGGGAAGGGTGGATGG + Intronic
1018096683 6:160393430-160393452 TGTGGTAGGGGGAGGGGGGAGGG - Intronic
1018156259 6:160988054-160988076 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1018609935 6:165638171-165638193 TTTGGTGGGGGGAGGGTGGTGGG - Intronic
1018726466 6:166616650-166616672 CCTGGCAGAGGGAGGATGGATGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018910401 6:168098292-168098314 CTCGGTGGGGGGAGTGTGGGAGG - Intergenic
1019319593 7:409544-409566 TTAGGGAGGGGGAGGCTGGAGGG - Intergenic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019496938 7:1345182-1345204 CTGGATAGGGGCACGGTGGATGG + Intergenic
1019683538 7:2366837-2366859 CTGGGTGGCGGGTGGGTGGATGG + Intronic
1019738084 7:2660253-2660275 CTGGGCAGGGGGAGCCTGGAAGG - Intronic
1019740014 7:2668086-2668108 CTGGCTAGGGGGAGGGGGGTAGG + Intergenic
1019753502 7:2749511-2749533 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1019880046 7:3850858-3850880 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1019914455 7:4123854-4123876 CATGGTAGGGGGAGAAGGGAAGG + Intronic
1020318818 7:6925737-6925759 TTTGATTGGGGGATGGTGGAGGG + Intergenic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1020708925 7:11580728-11580750 TTTGGAAGATGGAGGGTGGAAGG + Intronic
1020719512 7:11723325-11723347 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1020722977 7:11772709-11772731 CTTGCCAGGGGGAGGGTAGAAGG + Intronic
1021073505 7:16273106-16273128 TTTGATGGGGGGAGGGGGGAGGG - Intronic
1021320169 7:19199688-19199710 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1021389460 7:20073787-20073809 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1021398563 7:20182191-20182213 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1021430739 7:20555959-20555981 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1021435038 7:20604420-20604442 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1021456190 7:20831688-20831710 CTTGGTTGGGGGTGGGGGGTAGG - Intergenic
1021823747 7:24525455-24525477 CCTGGGAGGTGGAGGGTGCAGGG + Intergenic
1022119216 7:27291234-27291256 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1022307868 7:29166136-29166158 CTTGGGAGGGTGAGGCAGGAGGG - Intronic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022511505 7:30937680-30937702 CCTGTTAGGGGGAGGGGTGAGGG - Intergenic
1022847712 7:34227462-34227484 CATGTTATGGGGAGGGTGGGTGG - Intergenic
1022865323 7:34412297-34412319 TTTGGAGGGTGGAGGGTGGAGGG + Intergenic
1023050132 7:36243897-36243919 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1023054182 7:36278493-36278515 CTTGGTGGGGGGGCGGTGGGGGG + Intronic
1023193765 7:37612194-37612216 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1023346503 7:39276902-39276924 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1023385981 7:39658279-39658301 CTTTGTAGGGGGAGGTGAGAGGG - Intronic
1023419262 7:39961777-39961799 TGGGGTAGGGGGAGGGAGGAGGG - Intronic
1023421220 7:39982156-39982178 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1023445577 7:40228123-40228145 CTTGGGAGGTGGAGGCGGGATGG - Intronic
1023533115 7:41180075-41180097 TGGGGTAGGGGGAGGGGGGAAGG - Intergenic
1023718148 7:43064954-43064976 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1023822693 7:43988703-43988725 CTTGGCAGGGGTCGGGGGGATGG + Intergenic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1024168528 7:46759723-46759745 TTTGGTAGGTGGATGGTGGGCGG - Intronic
1024462716 7:49675355-49675377 ATTGGTGGGTGGAGGGTGGCAGG - Intergenic
1024545448 7:50513626-50513648 CTTGGCAGGGGCACGGTGGGAGG + Intronic
1024578889 7:50785679-50785701 CCTGGTGGAGGGAGGCTGGAAGG - Intronic
1024670938 7:51594150-51594172 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1024815405 7:53263140-53263162 ATTGGTAGGGGGAGGGAGATTGG - Intergenic
1025079293 7:55968030-55968052 TTTGGGAGGCGGAGGGTGGGAGG - Intronic
1025110847 7:56214943-56214965 CTTGGGAGGCTGAGAGTGGAAGG + Intergenic
1025183584 7:56838555-56838577 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1025202109 7:56968803-56968825 CTTGGGAGGCTGAGGGGGGAGGG + Intergenic
1025573716 7:62607645-62607667 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1025574356 7:62617036-62617058 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1025582390 7:62736937-62736959 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1025669838 7:63608125-63608147 CTTGGGAGGCTGAGGGGGGAGGG - Intergenic
1025688341 7:63738431-63738453 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1025762414 7:64406981-64407003 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1026122539 7:67550370-67550392 CTAGGGAGGGGAAGGGAGGAAGG - Intergenic
1026237572 7:68541092-68541114 TTTGGAGGGTGGAGGGTGGAGGG - Intergenic
1026489000 7:70846509-70846531 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026489257 7:70848629-70848651 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026509408 7:71015878-71015900 GGAGGTAGGGGGAGGGGGGATGG + Intergenic
1026537022 7:71246939-71246961 CTTTTTGGGGGGAGGGGGGAGGG + Intronic
1026907135 7:74069022-74069044 CTTCCTGGGGGGAGGGAGGAGGG + Intronic
1026954579 7:74368967-74368989 CTTGGGAGGGAGAGGTGGGAGGG + Intronic
1027542470 7:79485116-79485138 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1027730401 7:81864635-81864657 CGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1027884735 7:83890367-83890389 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028036710 7:85992831-85992853 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1028042778 7:86076421-86076443 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1028068185 7:86414377-86414399 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1028241563 7:88427237-88427259 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1028326077 7:89526075-89526097 CCGGGTGGGGGGAGGGGGGAGGG + Intergenic
1028420069 7:90622639-90622661 GTGGGTAGTGGGAGTGTGGAAGG + Intronic
1028618226 7:92794653-92794675 TGTGGGAGAGGGAGGGTGGAAGG - Intronic
1028736610 7:94220196-94220218 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1028821319 7:95215112-95215134 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1028840876 7:95429174-95429196 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1029057967 7:97766396-97766418 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029445075 7:100607429-100607451 CTAGGAGGGAGGAGGGTGGAGGG - Intronic
1029597375 7:101545093-101545115 CTTGGGAGGGTGAGGGGGGCAGG - Intronic
1029625642 7:101718751-101718773 GGTGGAACGGGGAGGGTGGATGG - Intergenic
1029750958 7:102542118-102542140 CTTGGCAGGGGTCGGGGGGATGG + Intronic
1029768911 7:102641229-102641251 CTTGGCAGGGGTCGGGGGGATGG + Intronic
1029827170 7:103209807-103209829 TGGGGTAGGGGGAGGGGGGACGG + Intergenic
1029903126 7:104063368-104063390 TTTGGTGGGGGCAGGGGGGAGGG - Intergenic
1029932156 7:104383790-104383812 CTTGTTAGGGGGAGTGAAGAAGG + Intronic
1029989885 7:104953364-104953386 CTTGGGAGGAGGTGGGAGGATGG - Intergenic
1030182824 7:106727963-106727985 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1030246745 7:107391090-107391112 CTTGGTGGGAGGAGGGGGGAGGG + Intronic
1030308298 7:108041740-108041762 TTTGGAAGGTGGAGGGTGGGAGG + Intronic
1030328773 7:108250600-108250622 AATGGTAGTGGGAGGGTGGTTGG + Intronic
1030397567 7:109006587-109006609 TTTGGAAGGTGGAGGGTGGGAGG + Intergenic
1030449131 7:109687274-109687296 TGGGGTAGGTGGAGGGTGGAGGG - Intergenic
1030658176 7:112191196-112191218 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1030997600 7:116377227-116377249 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1031455108 7:121969942-121969964 CGGGGTGGGGGGAGGGGGGAGGG - Intronic
1031481046 7:122279055-122279077 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031665173 7:124474695-124474717 CGGGGTCGGGGGAGGGGGGAGGG + Intergenic
1031826090 7:126567408-126567430 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1031892543 7:127311390-127311412 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1031986428 7:128167167-128167189 CTAGGTAGAGGGTGGGAGGAGGG + Intergenic
1032470112 7:132172127-132172149 CTTGGGCTGGGGAGGGTGGCAGG - Intronic
1032477515 7:132222466-132222488 TTTGGTGGGGGGAGGGGGGCAGG - Intronic
1032553615 7:132808876-132808898 TTTCGTGGGGGGAGGGGGGAGGG - Intronic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032939295 7:136770025-136770047 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1033624673 7:143097209-143097231 CTTTGTGGGGGGTGGGGGGAAGG - Intergenic
1033917984 7:146351029-146351051 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1034842371 7:154411345-154411367 CTTGGGAGGGTGAGGTGGGAGGG - Intronic
1034867076 7:154650855-154650877 CCTAGTAGAGGGAGGTTGGAAGG + Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035047265 7:155975815-155975837 TTTGGTAGTAGGATGGTGGAGGG + Intergenic
1035416886 7:158696719-158696741 CTTAGGAGGAGGAGGGTGGCAGG - Intronic
1035711628 8:1720835-1720857 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1035861339 8:3031314-3031336 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1037084119 8:14826079-14826101 ATAGGTGGGGGGAGGGGGGAGGG - Intronic
1037194999 8:16178245-16178267 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1037592454 8:20324432-20324454 TTTGGTAGGGCCAGGGTGCATGG - Intergenic
1037712391 8:21365307-21365329 CTTGGAAGGGTGGAGGTGGATGG - Intergenic
1038095331 8:24302917-24302939 CTTGTTGTGGGGAGGGGGGAGGG - Intronic
1038165956 8:25085280-25085302 TTTGGGTGGGGGAGGGGGGAAGG - Intergenic
1038517845 8:28202431-28202453 TTTGGGAGGGGCAGGGTGGCAGG - Intergenic
1038588765 8:28816294-28816316 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038786476 8:30622114-30622136 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038882753 8:31632678-31632700 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1039270447 8:35874724-35874746 CTCAGAAGGGGGAGGATGGAAGG - Intergenic
1039318991 8:36407859-36407881 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1040622039 8:49102008-49102030 CTTGGAAGATGGAGGCTGGATGG - Intergenic
1040631871 8:49223678-49223700 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1040655808 8:49506242-49506264 TTGGGTTGGGGGAGGGGGGAAGG + Intergenic
1040672764 8:49712459-49712481 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1040730056 8:50434030-50434052 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1040738785 8:50546523-50546545 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042179068 8:66066716-66066738 CTCAGAAGGGGGAGGGTAGAAGG + Intronic
1042527605 8:69780643-69780665 TTTGGAAGGGTAAGGGTGGATGG + Intronic
1042713109 8:71741657-71741679 TGGGGTAGGGGGAGGGGGGACGG - Intergenic
1042999821 8:74744466-74744488 TGGGGTAGGGGGAGGGGGGACGG - Intronic
1043111104 8:76183763-76183785 CTTGTTGGGGGGTGGGGGGAGGG - Intergenic
1043198546 8:77331899-77331921 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1043202068 8:77382846-77382868 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1043211417 8:77523566-77523588 CTTGTGTGGTGGAGGGTGGAAGG + Intergenic
1043253241 8:78102075-78102097 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1043260691 8:78192102-78192124 TGGGGTTGGGGGAGGGTGGACGG - Intergenic
1043367598 8:79553282-79553304 CTCAGAAGGGGAAGGGTGGAAGG + Intergenic
1043377678 8:79668733-79668755 CTCAGTAGGAGGAGGGTAGATGG - Intergenic
1043637500 8:82404724-82404746 CTTCGTAGTGGGAGGGGGGTGGG - Intergenic
1043725081 8:83601316-83601338 TGTGGTCGGGGGAGGGTGAAGGG + Intergenic
1043828745 8:84962142-84962164 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1043976067 8:86586477-86586499 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1044109207 8:88250918-88250940 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1044219777 8:89656535-89656557 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1044316290 8:90752697-90752719 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1044372400 8:91427843-91427865 TTTGGGAGGCCGAGGGTGGATGG + Intergenic
1044798395 8:95928032-95928054 TGTGGTAGGGGGCTGGTGGAGGG - Intergenic
1044962746 8:97546747-97546769 TCGGGTGGGGGGAGGGTGGAGGG + Intergenic
1045036175 8:98178221-98178243 ATGGGCAGGGGAAGGGTGGAAGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045159322 8:99519801-99519823 TGGGGTGGGGGGAGGGTGGATGG + Intronic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1045973876 8:108109524-108109546 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1045978793 8:108159806-108159828 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1046009364 8:108527855-108527877 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046252840 8:111655169-111655191 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1046259472 8:111747734-111747756 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1046447961 8:114347711-114347733 TTAGGAAGGTGGAGGGTGGAAGG + Intergenic
1046483465 8:114854086-114854108 CGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1046505757 8:115135922-115135944 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1046611652 8:116432490-116432512 CTTGGTAGGGGATGGGAGGTGGG - Intergenic
1046628391 8:116599331-116599353 TTTGGAAGGTGGAGGGTGGGAGG - Intergenic
1046835907 8:118800933-118800955 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
1047256463 8:123216896-123216918 CCTGGGAGGGGGAGGTTGTAGGG + Intergenic
1047317340 8:123746537-123746559 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047444902 8:124910887-124910909 CTTGGAAGATGGAGGCTGGATGG - Intergenic
1047474663 8:125215182-125215204 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1047505443 8:125475995-125476017 ACTAGTAGGGGGAGGATGGAAGG - Intergenic
1047641329 8:126824686-126824708 ATTGCTTGGGGGTGGGTGGAGGG + Intergenic
1048123181 8:131604713-131604735 ATTGGTGGGTGGAGGCTGGAAGG - Intergenic
1048400750 8:134066997-134067019 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1048699462 8:137071677-137071699 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1048767767 8:137863008-137863030 CCTGGTGGGGGGAGGGGGAAAGG - Intergenic
1049051924 8:140204473-140204495 TTGGGTGGGGGGAGGGGGGAGGG + Intronic
1049202395 8:141346689-141346711 CGTGGAGGGTGGAGGGTGGAGGG + Intergenic
1049554166 8:143274032-143274054 CTTGGTGGGGGCAGGGTGGGGGG - Intronic
1049616012 8:143576042-143576064 GTGGGTAGGCGGAGGGTGGCTGG - Intronic
1049708901 8:144054965-144054987 CGGGGTGGGGGGGGGGTGGAGGG + Intronic
1049882634 8:145077054-145077076 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1050041568 9:1500517-1500539 CTTGTTGTGGGGAGGGGGGAGGG - Intergenic
1050197357 9:3100718-3100740 CTTGGGAGGCTGAGGTTGGAGGG - Intergenic
1050218196 9:3353197-3353219 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1050392151 9:5155325-5155347 CAGGGTTGGGGGAGGGGGGAGGG + Intronic
1050477713 9:6057704-6057726 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1050523764 9:6527954-6527976 GTTGGTTGGGGAAGAGTGGAGGG + Intergenic
1050656441 9:7833621-7833643 CTTCCTAGGTGGAGGGTGGTGGG + Intronic
1050805751 9:9676267-9676289 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1050884729 9:10750257-10750279 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1051050684 9:12928699-12928721 CTTCTTAGGGGGAGGATAGAGGG + Intergenic
1051124821 9:13791955-13791977 CTTGGTAGGGGGAGGGGTGTCGG + Intergenic
1051409260 9:16771925-16771947 CATGGTGGGGGGAGGATGGCAGG + Intronic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1052123685 9:24750563-24750585 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1052604540 9:30682074-30682096 ATGGGTTGGGGGAGGGGGGAGGG + Intergenic
1052710510 9:32050024-32050046 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1052736391 9:32346752-32346774 CTTGGTAGGAGGATGGTGTAGGG - Intergenic
1052919499 9:33952975-33952997 CTTGGGAGGCTGAGGTTGGAGGG - Intronic
1053055295 9:34990132-34990154 CTCGGGCGGGGGAGGGTGGTCGG - Intronic
1053103712 9:35392642-35392664 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053423843 9:37998203-37998225 CTTGGAGGGAGGAGGGAGGAGGG + Intronic
1053754847 9:41295596-41295618 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1053789550 9:41677104-41677126 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1053834567 9:42120822-42120844 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
1054155593 9:61637648-61637670 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054177888 9:61888795-61888817 CTATGTAGGGGGAGGCTGGGAGG - Intergenic
1054260371 9:62859893-62859915 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1054331401 9:63760099-63760121 TATGGTGGGGGGAGGGGGGAGGG + Intergenic
1054475362 9:65568658-65568680 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054595974 9:67066710-67066732 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1054659641 9:67692029-67692051 CTATGTAGGGGGAGGCTGGGAGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1055307483 9:74944644-74944666 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
1055517864 9:77051307-77051329 CTTGTCAGGGGGTGGGGGGAAGG + Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056489740 9:87093815-87093837 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1056973108 9:91225692-91225714 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057347120 9:94260475-94260497 CTTGATAGTGGGGGGGGGGACGG + Intronic
1057483516 9:95463762-95463784 CTTGGAAAGGGGAGACTGGAGGG + Intronic
1057513758 9:95703441-95703463 GTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057731397 9:97612009-97612031 TTTGGAGGGTGGAGGGTGGAAGG - Intronic
1057833167 9:98422752-98422774 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1057869846 9:98709133-98709155 CTCGGCCGGGGGAGGGCGGACGG + Exonic
1057885920 9:98829600-98829622 GTTGGTTGGGGGAGTGGGGATGG - Intronic
1058008929 9:99952878-99952900 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1058186277 9:101859407-101859429 GTTGGGCGGGGGTGGGTGGATGG + Intergenic
1058229418 9:102407538-102407560 AAAGGTAGGGGGAGGGGGGAGGG + Intergenic
1058239291 9:102536281-102536303 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1058330145 9:103750470-103750492 AGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1058509706 9:105704082-105704104 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1058821526 9:108734701-108734723 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1058961987 9:110000152-110000174 TGTGGTGGGGGGAGGGGGGAGGG - Intronic
1059098956 9:111450818-111450840 CTTGGGAGGGTGAGGTAGGAGGG + Intronic
1059149859 9:111939610-111939632 TTTAGTAGGGTGAGGGTGGGGGG - Intergenic
1059495813 9:114708538-114708560 CTTGGTGGAGGGTGGGGGGAGGG - Intergenic
1059581600 9:115555521-115555543 CATGGTGGCAGGAGGGTGGAGGG + Intergenic
1059600124 9:115768226-115768248 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1059713784 9:116894250-116894272 GTAGGTAGGGACAGGGTGGATGG + Intronic
1059745821 9:117200222-117200244 TTGGGTAGGGGGAGGGGGGAGGG - Intronic
1060405080 9:123368966-123368988 CTGGGCAGGGGGAGGTTGGTGGG + Intronic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1060523242 9:124306179-124306201 CTTGGTAGTGGAAGGGATGAGGG + Intronic
1060630834 9:125157120-125157142 ACTGGTAGGGGGAGGGGGGAGGG - Intronic
1060866124 9:126999017-126999039 GTTGGGTGGGGGAGGGGGGAGGG + Intronic
1061402975 9:130378427-130378449 GCCGGGAGGGGGAGGGTGGAAGG + Intronic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1062622371 9:137428736-137428758 CTGGGTGGGGGGATGGGGGAGGG + Intronic
1062632380 9:137470132-137470154 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062649778 9:137569576-137569598 CTTGATAGACGGGGGGTGGATGG - Intronic
1203732665 Un_GL000216v2:104790-104812 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1203394202 Un_KI270512v1:9570-9592 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1203574021 Un_KI270744v1:159770-159792 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
1203650427 Un_KI270751v1:114351-114373 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1185532948 X:836258-836280 CTAGTTAGGGGGAGAGAGGAAGG + Intergenic
1185671730 X:1815397-1815419 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1185682454 X:1899679-1899701 CTTGGCAAGGGGAGTGTGGCAGG + Intergenic
1185798418 X:2986828-2986850 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1185915483 X:4029775-4029797 CTTTGCAGGAGGAGAGTGGAAGG + Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186005178 X:5062372-5062394 AATGGTGGGGGGAGGGGGGAGGG - Intergenic
1186065867 X:5764150-5764172 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1186070746 X:5816835-5816857 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1186497422 X:10022711-10022733 CTTACTAGAGGGAGGGAGGAGGG + Intronic
1186580248 X:10809772-10809794 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186743690 X:12544086-12544108 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1186856190 X:13628426-13628448 CTTTGGAGGGGAAGGGTCGAAGG + Intronic
1186869174 X:13752956-13752978 CTTGGTTGGGGGTGGGCAGATGG + Intronic
1186957545 X:14699973-14699995 TTTGGAGGGTGGAGGGTGGAAGG + Intronic
1187051952 X:15703826-15703848 CTTGGTGGGGGGGGGGAGGGGGG + Intronic
1187113712 X:16327640-16327662 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1187252588 X:17612356-17612378 CTTGGAAGTGGGAGTGTGGGAGG - Intronic
1187323911 X:18268617-18268639 CTCGGTGGGGGGAGGGAGGAGGG + Intronic
1187350818 X:18515261-18515283 CTTGATAGAGAGAGGCTGGAGGG + Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1187624517 X:21095302-21095324 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1187763689 X:22615167-22615189 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1188102717 X:26109927-26109949 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1188109123 X:26176684-26176706 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1188179989 X:27043667-27043689 ATTGGCAGGGGCAGGGGGGAGGG - Intergenic
1188229184 X:27640077-27640099 ATTGGTGGGAGGAGGGGGGAGGG - Intronic
1188390755 X:29616470-29616492 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1188482248 X:30647959-30647981 CAGGGTAGGGCGAGTGTGGAAGG + Intergenic
1188607784 X:32054334-32054356 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1188735194 X:33704314-33704336 TTTGGAGGGTGGAGGGTGGAAGG - Intergenic
1188792763 X:34424473-34424495 CGGGGTAGGGGGAGGGGGAAGGG - Intergenic
1188850305 X:35123887-35123909 ATTGGAGGGTGGAGGGTGGAAGG + Intergenic
1188989723 X:36802997-36803019 ATTGGTAGAGGGTGGGAGGAGGG - Intergenic
1189562167 X:42202305-42202327 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1189598540 X:42595649-42595671 CGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1189741687 X:44123958-44123980 GTTGGTGGGGGGAGGGGGGAGGG - Intergenic
1189978448 X:46486098-46486120 CTTGGTGAGGGGAGGGGGGTTGG - Intronic
1190037247 X:47036959-47036981 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1190050427 X:47145218-47145240 CTTAGTAGGTGGATGGTGGTCGG + Exonic
1190109341 X:47579851-47579873 GGTGGTGGGGGGAGGGTGGGGGG - Intronic
1190198927 X:48343778-48343800 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1190227257 X:48555723-48555745 CTTGGCAAGGGGAGTGTGGCAGG + Intronic
1190302278 X:49063953-49063975 CTTGGTTGGGGTGCGGTGGAGGG - Exonic
1190424721 X:50323417-50323439 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1190460999 X:50675168-50675190 TTTGGAAGGTGGAGGGTGGGAGG + Intronic
1190592595 X:52020165-52020187 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190921114 X:54853652-54853674 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1190923940 X:54884617-54884639 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190926436 X:54909757-54909779 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1191046006 X:56137602-56137624 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1191075945 X:56453266-56453288 TGTGGTTGGGGGAGGGGGGAGGG + Intergenic
1191131065 X:57011440-57011462 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1191145957 X:57165540-57165562 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1191168657 X:57418861-57418883 TTGGGTGGGGGGAGGGGGGAAGG - Intronic
1191216722 X:57940179-57940201 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1191585835 X:62825585-62825607 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1191704377 X:64079001-64079023 TGCCGTAGGGGGAGGGTGGAGGG - Intergenic
1191775114 X:64805096-64805118 TCGGGTGGGGGGAGGGTGGAGGG + Intergenic
1191924163 X:66291402-66291424 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1191928326 X:66340248-66340270 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1191958440 X:66672465-66672487 GTAGGTAGGGAGAGGGTGAAAGG + Intergenic
1191959655 X:66687132-66687154 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1191964309 X:66740515-66740537 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192058409 X:67797538-67797560 CTAAGAAGGGGGAGGGTGCAAGG + Intergenic
1192087358 X:68113814-68113836 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192133643 X:68576412-68576434 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1192148963 X:68700050-68700072 GTTGGTCAGGGGTGGGTGGAGGG + Intronic
1192296436 X:69854153-69854175 GTCGGAAGGTGGAGGGTGGAGGG - Intronic
1192438321 X:71156209-71156231 ATTTGTGGGGGGTGGGTGGAAGG - Intronic
1192541717 X:71978902-71978924 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1192603629 X:72490603-72490625 CGGGGTGGGGGGAGGGGGGAGGG + Intronic
1192684284 X:73287344-73287366 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1192884443 X:75321987-75322009 CTGAGAAGGGGTAGGGTGGAAGG - Intergenic
1192903931 X:75529474-75529496 TGAGGTAGTGGGAGGGTGGAGGG - Intergenic
1192918309 X:75677871-75677893 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1192930890 X:75804947-75804969 TTTGGTGGGGGGAGGGAGGAGGG - Intergenic
1192987919 X:76420236-76420258 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1193009481 X:76660416-76660438 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1193010302 X:76668105-76668127 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1193089264 X:77476613-77476635 TTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1193215034 X:78854114-78854136 TTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1193300392 X:79881794-79881816 CTTGGGAGGGCGAGGATGGTGGG - Intergenic
1193395271 X:80977007-80977029 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1193453786 X:81703326-81703348 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1193470941 X:81902564-81902586 CTCAGAAGGGGGAGGGTGGAAGG - Intergenic
1193488643 X:82119704-82119726 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1193510684 X:82395606-82395628 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1193580411 X:83257572-83257594 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1193877811 X:86883948-86883970 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1193956651 X:87871888-87871910 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194020240 X:88680719-88680741 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1194110570 X:89828419-89828441 TTTGGATGGTGGAGGGTGGAAGG - Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1194249172 X:91552267-91552289 CTCCATAGGGGGAGGGGGGAGGG + Intergenic
1194486237 X:94490610-94490632 CCTGTTGGGGGGTGGGTGGAAGG - Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194562518 X:95439871-95439893 TGTGGTGGGGGGAGGGAGGAGGG + Intergenic
1194633660 X:96317997-96318019 CTTGGTGGGGGCAGGTTGGGAGG - Intergenic
1194657462 X:96589939-96589961 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194946508 X:100074670-100074692 ATTGGAAGGGGGAGGGTGGAAGG + Intergenic
1195039598 X:101002084-101002106 GTTGTTAGGGGGAGGGTGTTAGG - Intergenic
1195162951 X:102188876-102188898 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1195227308 X:102811106-102811128 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1195296643 X:103484765-103484787 CCTGGGAGGGGGAGGTTGCAGGG + Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195931321 X:110079830-110079852 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1195984214 X:110611691-110611713 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1196325931 X:114402427-114402449 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1196481327 X:116153240-116153262 CTTGGCAGGGTAATGGTGGATGG + Intergenic
1196490296 X:116257357-116257379 TGAGGTAGGGGGAGGGGGGAGGG + Intergenic
1196491222 X:116269781-116269803 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1196524598 X:116717425-116717447 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1196766744 X:119252891-119252913 CTTGGCAGTGGGAGGGAGGGAGG - Intergenic
1196812533 X:119640144-119640166 CTGGATAGTGGGAGGGTGGGAGG - Intronic
1196996960 X:121394760-121394782 TTTGGTATGAGGTGGGTGGAGGG + Intergenic
1197050141 X:122047343-122047365 CTCGGTGGGGGGAGGGGGGCGGG + Intergenic
1197060222 X:122170573-122170595 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1197077556 X:122371402-122371424 CTGGGAAGGTGGAGGGTTGAGGG - Intergenic
1197196415 X:123706511-123706533 CATGGGTGGGGGAGGGGGGAGGG - Intronic
1197418802 X:126210334-126210356 ATTGATGGGGGGAGGGGGGAGGG + Intergenic
1197494563 X:127161469-127161491 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1197508033 X:127332613-127332635 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1197547415 X:127842531-127842553 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1197636335 X:128918625-128918647 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1197699939 X:129591722-129591744 CTTGGTGGGGGTGGGGGGGAAGG + Exonic
1197706293 X:129636962-129636984 CTTGGCAGGGGCCGGGTGAAGGG + Intergenic
1197907058 X:131436834-131436856 TGGGGTTGGGGGAGGGTGGAAGG - Intergenic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198134422 X:133733280-133733302 CTCAGAAGGGGGAGGGTGAAAGG + Intronic
1198471079 X:136947593-136947615 CTAGTTAGGGGGAGGGTGCAAGG + Intergenic
1198882292 X:141294754-141294776 GCTGCTAGGGGGTGGGTGGAGGG - Intergenic
1199061135 X:143356437-143356459 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1199102111 X:143814833-143814855 CGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1199159209 X:144587441-144587463 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1199242276 X:145561187-145561209 CTTAGAAGGGGAAGGGTGGAAGG + Intergenic
1199919812 X:152387147-152387169 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200215325 X:154365702-154365724 CTTGGAAGGGGGAGGGTGGGGGG - Intronic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1200463231 Y:3483161-3483183 TTTGGATGGTGGAGGGTGGAAGG - Intergenic
1200568128 Y:4793495-4793517 CTCCATAGGGGGAGGGGGGAGGG + Intergenic
1200788187 Y:7276773-7276795 CTTTTTGGGGGGTGGGTGGAGGG + Intergenic
1200829150 Y:7673446-7673468 TCTGGCAGGGGGAGGGCGGAGGG - Intergenic
1200955703 Y:8943183-8943205 TTTGGTGGGTGGAGGGGGGAGGG - Intergenic
1201188483 Y:11426833-11426855 TGTGGTGGGGGGAGGGGGGAGGG + Intergenic
1201410767 Y:13697160-13697182 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1201423910 Y:13828718-13828740 CTTTTTTGGGGGAGGGGGGAGGG + Intergenic
1201563588 Y:15343700-15343722 CTTGGTGGGGGGAGGGGCGTTGG - Intergenic
1201651294 Y:16290570-16290592 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1201679012 Y:16621819-16621841 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1201778209 Y:17689721-17689743 TGCGGTAGGGGGAGGGGGGAGGG - Intergenic
1201823347 Y:18216271-18216293 TGCGGTAGGGGGAGGGGGGAGGG + Intergenic
1201897686 Y:19010121-19010143 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1201959906 Y:19668107-19668129 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1202077125 Y:21047893-21047915 TGTGGTGGGGGGAGGGGGGAGGG - Intergenic
1202079454 Y:21069598-21069620 TTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1202109026 Y:21402745-21402767 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1202373982 Y:24217102-24217124 TGAGGTGGGGGGAGGGTGGAGGG + Intergenic
1202496799 Y:25453018-25453040 TGAGGTGGGGGGAGGGTGGAGGG - Intergenic
1202594686 Y:26524454-26524476 TTTGGTAGGGGGAGGGGGGAGGG + Intergenic