ID: 902982776

View in Genome Browser
Species Human (GRCh38)
Location 1:20137868-20137890
Sequence GGATCCACAGAGAGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902982770_902982776 9 Left 902982770 1:20137836-20137858 CCGGGATAACTTCCTGGAGAGGA 0: 1
1: 0
2: 0
3: 43
4: 476
Right 902982776 1:20137868-20137890 GGATCCACAGAGAGGCAGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 298
902982773_902982776 -3 Left 902982773 1:20137848-20137870 CCTGGAGAGGAGATGGACTTGGA 0: 1
1: 0
2: 4
3: 36
4: 302
Right 902982776 1:20137868-20137890 GGATCCACAGAGAGGCAGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902982776 Original CRISPR GGATCCACAGAGAGGCAGCT GGG Intergenic
900008890 1:88355-88377 GAATCCACAGAGAAGCGGGTAGG - Intergenic
900373143 1:2341167-2341189 AGATCCACAAAGGGGAAGCTGGG - Intronic
900428282 1:2590378-2590400 GGACCCAGAGAGCTGCAGCTGGG - Exonic
900609423 1:3538223-3538245 GTCTCCGCAGGGAGGCAGCTTGG - Intronic
902689124 1:18098731-18098753 GGAGCCTGAGAGAGGCATCTGGG + Intergenic
902982776 1:20137868-20137890 GGATCCACAGAGAGGCAGCTGGG + Intergenic
903392621 1:22975395-22975417 AGATCCCCAGAGGCGCAGCTTGG + Intergenic
903961582 1:27061086-27061108 AGCTCCACAGTCAGGCAGCTGGG + Intergenic
904469341 1:30726438-30726460 TGATCCACGGAGAGGCCCCTGGG + Intergenic
905505480 1:38476096-38476118 GGATCCACAGAGACAAACCTGGG - Intergenic
907424350 1:54369885-54369907 GGATCCCGAGAGAGGCAGCAGGG - Intronic
908808783 1:67958140-67958162 GGAGCCAAAGAGAGGAAACTGGG + Intergenic
910112906 1:83701318-83701340 GGACACACAGAGAGACAGCAGGG + Intergenic
911498723 1:98661323-98661345 GGATCCACAGCGAGGCTGGAAGG - Intergenic
914257581 1:145973248-145973270 GGAACCAGTCAGAGGCAGCTAGG - Intronic
915489869 1:156245023-156245045 GGACCCCAAGAGAGGCGGCTGGG + Intronic
916813051 1:168322630-168322652 GGAGCCAAAGAGAGGAAGCCTGG + Intergenic
917519309 1:175734826-175734848 GGCTCCAGAGCAAGGCAGCTGGG + Intronic
917536206 1:175876451-175876473 GGATCCAGAGACAGGAAGCCAGG - Intergenic
917582440 1:176392238-176392260 TGATCCACAGAGAGGAAGGAAGG - Intergenic
917605195 1:176621004-176621026 GGATCAAGAGAGAGGAAGGTAGG + Intronic
917630698 1:176888601-176888623 GGATGCACAGAGAAGCATTTGGG - Intronic
917685368 1:177410565-177410587 ACATCCACACAGAGGCATCTTGG + Intergenic
919875624 1:201865038-201865060 GGATCCACAGATAGGCTTCAAGG - Intronic
920602832 1:207346534-207346556 GCAGCCACAGAGAGGTGGCTGGG + Intronic
921354710 1:214275166-214275188 GGCTGAACAGAGAGGCAGCATGG + Intergenic
922406564 1:225320163-225320185 GGATCCCCAGCCAGGAAGCTTGG - Intronic
922613076 1:226944215-226944237 GGTGTCACAGAGGGGCAGCTTGG + Intronic
924565676 1:245196223-245196245 GTATCCACAGAGTAGCTGCTGGG - Intronic
1065002798 10:21352423-21352445 GGATACACAGAGGGACAGCAGGG - Intergenic
1065335290 10:24651167-24651189 GGATCCAAAGGGCGGCAGCTGGG - Intronic
1065662470 10:28020090-28020112 GGACTCACAGAGAGGCACCGTGG + Intergenic
1067433817 10:46263790-46263812 GGGTCCAGGGGGAGGCAGCTGGG + Intergenic
1068792458 10:61041915-61041937 GGATGCACAGAGAGACACCAGGG + Intergenic
1070774343 10:79101067-79101089 GGGTCCACAGAGGGGCTGCAGGG + Intronic
1071712162 10:88060513-88060535 GACTCCACAGAGAGGAGGCTGGG - Intergenic
1074453219 10:113576148-113576170 GGATCCAGTGAGAGGCTGCCTGG - Intronic
1074671396 10:115796154-115796176 ATCTCCACAGAGAGGCAGCCTGG - Intronic
1075096865 10:119477730-119477752 GCCTCCCCAGAGAGGGAGCTGGG + Intergenic
1075555539 10:123428813-123428835 GGATCCACACAGAGAAATCTGGG + Intergenic
1075631596 10:124003916-124003938 GGGTGCAGGGAGAGGCAGCTGGG + Intergenic
1075732952 10:124647103-124647125 GGATGCACAGCGAGGCATCGGGG + Intronic
1076894451 10:133303126-133303148 GGACCCTCTGAGAGGCTGCTGGG - Intronic
1076894470 10:133303186-133303208 GGACCCTCTGAGAGGCTGCTGGG - Intronic
1076894507 10:133303305-133303327 GGACCCTCTGAGAGGCTGCTGGG - Intronic
1077536389 11:3126781-3126803 GGACCTACAGGGAGGAAGCTGGG + Intronic
1077998625 11:7475271-7475293 GGACCCACAGGGAGGGTGCTGGG + Intergenic
1078431403 11:11291202-11291224 GTTTCCACAGAGAGGGAGGTGGG + Intronic
1078864843 11:15287824-15287846 TGTTCCACAAAGAGGCAGGTAGG + Intergenic
1079307533 11:19336665-19336687 TGATCCACACACAGGAAGCTTGG + Intergenic
1081078046 11:38700110-38700132 GGAGCCACAGAAAGGAAGCCTGG + Intergenic
1081979920 11:47259860-47259882 GCATCCTCAGAGAGGAAGCCAGG + Exonic
1084451644 11:69242604-69242626 GGGTCCACACAGAGGCCTCTGGG + Intergenic
1084609577 11:70193662-70193684 AGATCCACAGACAGGGACCTTGG - Intergenic
1085967362 11:81544038-81544060 GGACACACAGAGAGGCACCAGGG + Intergenic
1086179477 11:83933318-83933340 GCATCCACAGATAGGCCTCTTGG - Intronic
1087915925 11:103810758-103810780 GGAAGGCCAGAGAGGCAGCTGGG - Intergenic
1089426348 11:118379179-118379201 CTATCCAAAGAAAGGCAGCTTGG - Intronic
1089705401 11:120274177-120274199 GGATTCACAGCCAGGCAGCCAGG - Intronic
1090229870 11:125093949-125093971 GGATCCAAAGTCAGGCAGTTTGG - Intergenic
1090634510 11:128682350-128682372 GGAGCAAGAGAGAGGCAGCTGGG - Intergenic
1090744603 11:129696035-129696057 GGTTCCACTGAGAGGAAGCCGGG + Intergenic
1092614385 12:10203130-10203152 GGAATCACAGAGAGGCAACAGGG - Intergenic
1094313633 12:29113900-29113922 GGAGACACAGAGAAGCAACTTGG + Intergenic
1095511732 12:42958412-42958434 GCATACACACAGAGGCAGCAAGG - Intergenic
1096363831 12:51011449-51011471 GCATCTACACAGAGGCTGCTAGG + Intronic
1096839516 12:54371661-54371683 GGATCCCCAGAGAAACAGCCTGG - Exonic
1098144258 12:67483188-67483210 TGATCCACTGATAGGCAGTTTGG - Intergenic
1099204378 12:79711154-79711176 TGTCCCACAGGGAGGCAGCTAGG - Intergenic
1100390553 12:94142927-94142949 AGATCAGCAGAGAGGGAGCTGGG + Intergenic
1100735644 12:97526768-97526790 GGATCCAAAGACAAGCATCTTGG - Intergenic
1102034058 12:109760928-109760950 GGTTACAGAAAGAGGCAGCTGGG + Intronic
1102234708 12:111287085-111287107 GGCTCCCCAGAGAGGCTGGTGGG - Intronic
1102579260 12:113875844-113875866 GTGTGCACAGAGAGGCAGCTGGG - Intronic
1104144528 12:126019771-126019793 TGATGCAGAGAGAAGCAGCTGGG + Intergenic
1104222591 12:126799402-126799424 GGATACACAGAGAGCCACCAAGG + Intergenic
1104760394 12:131294693-131294715 AGATACACAGACAGGCAGATAGG + Intergenic
1105621638 13:22073132-22073154 AGATCAACAGAAGGGCAGCTAGG - Intergenic
1111864421 13:93751044-93751066 GGATCCAAAGACAGGGAGTTTGG - Intronic
1111941389 13:94611786-94611808 GGATCCCCAGAGCTCCAGCTTGG + Intronic
1114427256 14:22634302-22634324 GGAGCCACAGAAGGGCAGCTGGG + Exonic
1115712197 14:36062641-36062663 GGATCAACAAAGGGGAAGCTGGG - Intergenic
1117423037 14:55566471-55566493 GGATACACAGAGAGACACCAGGG + Intronic
1117442551 14:55773619-55773641 GGATCCTCAGAGAAGAACCTGGG - Intergenic
1117974251 14:61281530-61281552 GGAGCCACTCAGAGGCAGCCCGG - Exonic
1118356256 14:65016422-65016444 AGATCCACTGAGAGGCAGCATGG + Intronic
1118733983 14:68689462-68689484 GGGTCCACAGAGAGGAAGACAGG - Intronic
1119087001 14:71748248-71748270 GGGTCCACAGAGAGGCATGTGGG + Intergenic
1120157543 14:81110362-81110384 GGATACACAGAGAGACACCAGGG + Intronic
1121505717 14:94474997-94475019 GGGTCCTCAAAGATGCAGCTGGG - Intronic
1121649217 14:95544837-95544859 GGCTCCAGAGATAGGCAGGTGGG - Intergenic
1121847047 14:97180945-97180967 GAAGCCACAGAGCGGGAGCTTGG - Intergenic
1121879202 14:97484983-97485005 GGATCGACAGATAGGCATCATGG - Intergenic
1121935574 14:98015376-98015398 GGAAACAAAGAGAGGCAGCTGGG + Intergenic
1125601444 15:40917924-40917946 GTACCCACAGCTAGGCAGCTGGG - Intergenic
1127608902 15:60617906-60617928 GGAAAAATAGAGAGGCAGCTAGG + Intronic
1129121393 15:73399012-73399034 GGATCTGCACAGAGGAAGCTGGG + Intergenic
1129605818 15:77024481-77024503 TGCTCCACAGAGAGGCTGCAGGG + Intronic
1130411508 15:83652869-83652891 GGCTCTAGAGAGAGGCAGATAGG + Intergenic
1130693212 15:86104359-86104381 GCAGCCATAGACAGGCAGCTGGG + Intergenic
1132676247 16:1122502-1122524 GGATTCCCAGAGAGGCACCAGGG + Intergenic
1134450602 16:14361007-14361029 GGACTCACAGCCAGGCAGCTGGG + Intergenic
1135116304 16:19726477-19726499 TGATCCACAGAGAGGTATTTTGG - Intronic
1135425251 16:22329551-22329573 GGCTCCCCTAAGAGGCAGCTGGG - Intronic
1136419231 16:30122162-30122184 GGATCTCCAGAGAGAAAGCTGGG + Intronic
1138389455 16:56659433-56659455 GGAAGCACAGTGAGGCAGCCTGG - Intronic
1138521052 16:57570997-57571019 GGAGACAAAGAGAGGCAGCGAGG + Intronic
1138660760 16:58515739-58515761 CGACCCCCAGAGAGGCCGCTGGG - Intronic
1139298758 16:65925962-65925984 AGATCTACACAGAGCCAGCTTGG - Intergenic
1141171743 16:81696043-81696065 AGAACCCCAGAGAGGCAGCAGGG + Intronic
1141656994 16:85421775-85421797 GGAACCCCAGAGAGGTAGATGGG + Intergenic
1141698733 16:85632793-85632815 GCATCCACAGGGAGGAAGCCGGG + Intronic
1141712758 16:85709621-85709643 GGTATCACAGAGAGGCAGGTAGG + Intronic
1142455449 16:90218609-90218631 GAATCCACAGAGAAGCGGGTAGG + Intergenic
1145037764 17:19553134-19553156 AGAACCAAAGAGAAGCAGCTGGG + Intronic
1145993794 17:29094278-29094300 AGGCCCACAGAGAGGCAGCTGGG + Intronic
1147019201 17:37517474-37517496 GAATGCACAGAGAGGCACCGAGG - Exonic
1148825701 17:50392368-50392390 GGAGCCACTGGGAGGGAGCTTGG + Intronic
1148879525 17:50715110-50715132 GGATACACAAAGAGGCACCAAGG - Intergenic
1151351860 17:73536571-73536593 GGGGCCACACAGAGACAGCTGGG + Intronic
1151500348 17:74484232-74484254 TGACCAACAGACAGGCAGCTGGG + Exonic
1152128517 17:78461789-78461811 GGAGCCACAGAGGGGCAGAACGG + Intronic
1152588771 17:81200844-81200866 GGCTCCACAGAGAGGGTGGTCGG + Intronic
1153137389 18:1931621-1931643 GGATACAGAGATAGGCTGCTAGG + Intergenic
1155088143 18:22477413-22477435 GCAGCCACAGGCAGGCAGCTGGG - Intergenic
1159129967 18:64270272-64270294 GCACCCACAGATAAGCAGCTAGG - Intergenic
1160003833 18:75053422-75053444 GAACCCACAGTCAGGCAGCTTGG - Intronic
1160129563 18:76212793-76212815 GGAGCCGGAGAGAGGGAGCTGGG - Intergenic
1161366409 19:3882137-3882159 TACTCCACAGAGAGGCAGCCTGG + Intronic
1161451866 19:4350737-4350759 GGAGACATAGAGAGGCAGCTGGG + Intronic
1162660238 19:12163163-12163185 GGATCCGGAGGGAGGAAGCTGGG + Exonic
1162704410 19:12544632-12544654 GAATGCACAGAGAGGCTGCAGGG + Intronic
1163528658 19:17836718-17836740 GGATGGTCAGAGAGGCTGCTGGG - Intronic
1164736477 19:30545057-30545079 GGATCCACAGAGGGCCACCTGGG + Intronic
1164829584 19:31310237-31310259 TGGTCCATTGAGAGGCAGCTTGG - Intronic
1165319525 19:35076740-35076762 TGTTCCACAAAGAGGCACCTAGG - Intergenic
1166946882 19:46402882-46402904 GGAGACACAGAGAGGGAGGTGGG - Intergenic
1167198192 19:48045082-48045104 AAATCCACAGATGGGCAGCTTGG + Intergenic
1167631694 19:50629735-50629757 GTTCCCACAGAGAGGGAGCTAGG - Intronic
1167706630 19:51084798-51084820 GGAATCACAGAAAGGCACCTGGG - Intergenic
926247540 2:11132222-11132244 GGACCCACAGAGAAGCTGCGTGG + Intergenic
926261525 2:11267982-11268004 GGTTCCACAGATAAGGAGCTTGG + Intronic
927177855 2:20422765-20422787 GGGACCAGAAAGAGGCAGCTAGG - Intergenic
928100293 2:28433111-28433133 GGATCCTTAGAGAGGCAGGAGGG + Intergenic
928268338 2:29831539-29831561 GGATCAACAGAGTTGGAGCTAGG - Intronic
928823446 2:35391292-35391314 GGACCCACAGAATGGCTGCTGGG - Intergenic
929020612 2:37548651-37548673 GGGTATACAGAGAGGCAGATCGG - Intergenic
932808258 2:74801360-74801382 GGATACACAAAGAGACAGCAGGG + Intergenic
934053241 2:88227787-88227809 GGAGCCACAGGGAAGCTGCTGGG + Intergenic
934650158 2:96085961-96085983 GGATCCCCAGAGGTGGAGCTGGG - Intergenic
935141261 2:100354862-100354884 GGACCCACTGAGGGGCAGCAGGG + Intergenic
936499092 2:113051589-113051611 GGATCCACAGGGCTGCAGCTGGG - Intronic
936516626 2:113185307-113185329 GGATACACAGAGAGGTGGATGGG - Intronic
937070724 2:119061072-119061094 GGATCCCAAGAAAGGGAGCTGGG - Intergenic
937074430 2:119090724-119090746 GGATGTACAGAGAGAAAGCTGGG - Intergenic
937314765 2:120924670-120924692 GGATCCCCAGGGAGTCAGCAGGG - Intronic
941784111 2:169479488-169479510 GGAGCCAGAGAGACGCAGCTAGG + Exonic
941911740 2:170770939-170770961 GGAACCACGGAGAGGCAGGGTGG - Intergenic
942013455 2:171787921-171787943 GGGTCACCAGAGATGCAGCTGGG + Exonic
942076611 2:172362023-172362045 AGATTCGCAGAGAGGCAGCTGGG + Intergenic
942620838 2:177844064-177844086 AGATCCTCAGAGAGACAGATAGG + Intronic
943759290 2:191591165-191591187 TGATCCCCAGACAGGCAGCAGGG + Intergenic
944037743 2:195316387-195316409 GGCTCCCCAGAAAGGCAACTGGG - Intergenic
945675769 2:212853837-212853859 GTATCAACAGAGAAGAAGCTGGG - Intergenic
946193574 2:218020505-218020527 GGAACCACCGAGAAGCAGCCAGG + Intergenic
947125630 2:226865688-226865710 GGAACCCCAAAGAGGCAGCCAGG + Intronic
947838946 2:233195190-233195212 GGATCCACAGAGAGGAGAGTTGG - Intronic
948775839 2:240288368-240288390 TGAGCCACAGAGAGGCCACTTGG + Intergenic
948775868 2:240288468-240288490 GGAGCCATAGAGAGGCCACTGGG + Intergenic
949086946 2:242163406-242163428 GAATCCACAGAGAAGCGGGTAGG + Intergenic
1168831949 20:850499-850521 GGATCCAAAGCCAGGCAGCCAGG - Intronic
1169077148 20:2768273-2768295 GAACCCCCAGAGAGGCAGCAGGG - Intergenic
1169553281 20:6723376-6723398 TGATCCATTGAGAGGCAGCCTGG - Intergenic
1170695173 20:18651490-18651512 GGAGCCACAGAAAGACAGCTAGG - Intronic
1171089866 20:22274329-22274351 GGATCTACAGAGAGGAAGAAGGG + Intergenic
1171406546 20:24915663-24915685 GCAACTCCAGAGAGGCAGCTGGG + Intergenic
1171983708 20:31644913-31644935 GGAGCCTCAGGGAGACAGCTGGG - Exonic
1172706816 20:36888056-36888078 GCCTCCACTGAGGGGCAGCTTGG + Intronic
1174366483 20:50059689-50059711 GGATACACAGAGAGGCACAGAGG + Intergenic
1174723757 20:52840121-52840143 GCCTCCAAAGAGAGGCACCTGGG - Intergenic
1175328008 20:58142965-58142987 GGATCCAGAGTGAGGCATGTTGG - Intergenic
1178716386 21:34968290-34968312 GGATCATCAGAGAGGATGCTAGG + Intronic
1179795430 21:43779923-43779945 GGGTCCACACTCAGGCAGCTGGG - Intergenic
1179934857 21:44596320-44596342 GGAGCCACAGAGAGGGTGATGGG - Intronic
1180061461 21:45387280-45387302 GGCTCTGCAGAGAGCCAGCTGGG - Intergenic
1180070115 21:45431710-45431732 AGAGCCGCAGAGAGCCAGCTGGG - Intronic
1180166533 21:46033613-46033635 GGACCCACAGAGAGGCAGCACGG + Intergenic
1180166603 21:46033802-46033824 GGACCCACATGGAGGCAGCACGG + Intergenic
1180166637 21:46033901-46033923 GGACCCACATGGAGGCAGCACGG + Intergenic
1180983097 22:19888591-19888613 TGATCCAGACAGAGGCAGCCAGG + Intronic
1181808873 22:25391536-25391558 GGCTCCACTGAAAGGCTGCTTGG - Intronic
1182558820 22:31143171-31143193 AGAGCCACAGAGAGGCCCCTGGG - Intergenic
1182574375 22:31262923-31262945 TGATCCCCACAGGGGCAGCTGGG - Intronic
1183975953 22:41512494-41512516 GGCTCCACAGTAAGCCAGCTAGG - Intronic
1184249187 22:43250613-43250635 GGGGGCACAGAAAGGCAGCTGGG - Intronic
1184788221 22:46682169-46682191 GGGATCACAGAGGGGCAGCTGGG + Intergenic
1184946796 22:47809436-47809458 GGATCCTCAGAGAGGCCTCCTGG - Intergenic
949815442 3:8053173-8053195 CAATGCAAAGAGAGGCAGCTGGG - Intergenic
950382328 3:12627303-12627325 GAATCCAGAGAGAAGTAGCTTGG - Intronic
951589018 3:24243371-24243393 GGAGAGACAGAGAGGCAGATGGG - Intronic
953471441 3:43170002-43170024 GGCTTCACAGAAAGGCAGGTAGG + Intergenic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
954029907 3:47811732-47811754 GGATCCAGAGAGAGAGAGTTGGG + Intronic
954709180 3:52496502-52496524 GGTCCCTCAGAGAGGCAGCAGGG + Intronic
955107150 3:55909170-55909192 GGATCTAGAGGAAGGCAGCTTGG - Intronic
955469646 3:59273340-59273362 GGACCCAGAGGGAAGCAGCTAGG - Intergenic
955473690 3:59313525-59313547 GATACCACAGAGAGGCAGATGGG + Intergenic
957787922 3:84905318-84905340 GGAGCCCGAGAGGGGCAGCTTGG + Intergenic
958785398 3:98592817-98592839 GTACCCACAGAGAGGCCGCTTGG - Intronic
959944805 3:112115231-112115253 GGGTGCACAGAGAAGCAGTTGGG + Intronic
960525753 3:118707832-118707854 GGATCCACAGAAAGGAGACTAGG - Intergenic
961213761 3:125144309-125144331 TGAGGCACAGAGAGGCAACTGGG + Intronic
962311694 3:134331430-134331452 GGCTCCACAGAGGGGCAGCTGGG + Intergenic
963234356 3:142941877-142941899 GGGACCTCAGAGAGGCAGCAAGG - Intergenic
963900203 3:150726333-150726355 GGATACACAGAGAAGATGCTAGG + Intergenic
963914490 3:150845473-150845495 GGATTAACAGACAGGCTGCTTGG - Intergenic
964186896 3:153956754-153956776 GGATACTCAGAGATGCAGCTGGG - Intergenic
966497609 3:180599091-180599113 GTACCCACAGAGAGGCACCAGGG + Intergenic
967237198 3:187396961-187396983 TGATCCACAGGGTGTCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969636130 4:8370414-8370436 GGAGCCACAGGGAGGCGGTTGGG + Intronic
970574751 4:17416477-17416499 GGATCCAGAGAGGAGTAGCTGGG - Intergenic
971105495 4:23519793-23519815 TGATCCACACAGCAGCAGCTGGG + Intergenic
971244802 4:24917867-24917889 GGAAACGCAGAGAGGCAGCAGGG + Intronic
971785824 4:31101065-31101087 TAATCAACAGAGAAGCAGCTTGG - Intronic
972866536 4:43240093-43240115 GGATGCAAAGAGAGCCAGCCTGG - Intergenic
975704259 4:77096412-77096434 GGCCCCACAGAGAAGCAGCAGGG + Intergenic
975891640 4:79036136-79036158 GAACCCACTGAGAGGCAGCATGG - Intergenic
977423712 4:96837880-96837902 GGGTCCAGAGAGAGCTAGCTAGG + Intergenic
978158882 4:105522020-105522042 GGATTCAAAGAGAGGGAACTAGG - Intergenic
980876226 4:138665095-138665117 GCATCCACAGTGTGGCAACTGGG - Intergenic
980888260 4:138786336-138786358 TGCTCCACACAGAGGCAGCCAGG + Intergenic
980969802 4:139557252-139557274 GGAGAAACAGAGAGACAGCTGGG - Intronic
981341719 4:143629002-143629024 GTTTCCACAGAAAGGAAGCTGGG + Intronic
983398648 4:167234689-167234711 GGATCCAGCGAGAGGAAGGTGGG - Intronic
983446297 4:167857619-167857641 GGAGTCACAGTGAGACAGCTTGG - Intergenic
983561095 4:169102307-169102329 AGATTTACAGAAAGGCAGCTGGG - Intronic
984733426 4:183089187-183089209 GGCTACACAGAGGGGCAGCTGGG + Intergenic
986127200 5:4894095-4894117 GGATGCACAGGGAGTAAGCTAGG + Intergenic
987356239 5:17065659-17065681 GGGCCCAGAGGGAGGCAGCTTGG - Intronic
987903666 5:24048898-24048920 GGATACAATGAGAGGTAGCTAGG - Intronic
988644325 5:33077589-33077611 AGATCCATAGAGAGACAGTTTGG - Intergenic
989353285 5:40513473-40513495 GCATCAACAGAGAAGCTGCTGGG - Intergenic
991460688 5:66855249-66855271 GGAGCAAGAGAGAGGCAGGTGGG - Intronic
993342171 5:86738388-86738410 GTAGCCATAGACAGGCAGCTGGG + Intergenic
997391967 5:133524603-133524625 GGGTCCAAAGAGACGCAGCTTGG - Intronic
998181825 5:139951440-139951462 GGCACCCCAGAGAGGCAGCAGGG - Intronic
998332774 5:141344264-141344286 GAATCCGCAAAGCGGCAGCTTGG + Exonic
998665530 5:144292841-144292863 GAATCCACAGAGAGAGCGCTAGG + Intronic
999033163 5:148317230-148317252 GGATCTGCACAGAGGCTGCTGGG - Intergenic
999149472 5:149417191-149417213 AGATCCTCAGAGGGGGAGCTAGG - Intergenic
1000342702 5:160289717-160289739 GGAGAGACAGAGAGGCAGCAGGG + Intronic
1000913516 5:167051022-167051044 GGATCAACAGAGAGGCCACAGGG - Intergenic
1001419506 5:171575808-171575830 GGGTCAGCAGAGAGTCAGCTAGG - Intergenic
1001606729 5:172965790-172965812 TCATCCACAGAGAGGCAATTAGG - Intronic
1002522680 5:179800311-179800333 GGCTCCGCAGAGAAGCCGCTGGG + Intronic
1002775979 6:327710-327732 GGCTCCACAGAGAGCCTGGTGGG + Intronic
1003537343 6:6986972-6986994 GGGTCCTAAGAGAGGCAGCCTGG + Intergenic
1006298229 6:33179470-33179492 GGGTCCACGGAGCGCCAGCTAGG + Exonic
1006331966 6:33398093-33398115 GCTTCCTGAGAGAGGCAGCTGGG - Exonic
1006450210 6:34101577-34101599 GGATCCTCAGGGCAGCAGCTGGG + Intronic
1006812983 6:36832503-36832525 GCATCCAAAGACAGGAAGCTAGG - Intronic
1006828870 6:36956839-36956861 GGATCCAGGGTGAGGCAGGTGGG + Intronic
1007360639 6:41353013-41353035 GAATCCTCAGAGAGGGTGCTGGG - Intergenic
1008097863 6:47358465-47358487 GGAACCCAAGAGAGGCTGCTGGG - Intergenic
1010760413 6:79716171-79716193 GGAACCACAGAGTGGCTGCAGGG + Intergenic
1010838623 6:80620463-80620485 GGACACACAGAGAGGTAGGTGGG + Intergenic
1011625942 6:89283977-89283999 GGAGCCTCAGAGAGACAGATTGG + Intronic
1011637276 6:89386051-89386073 GGACCCACAGTGAGACAGGTTGG - Intronic
1012428103 6:99136310-99136332 TGGTCCACAGATAGGCATCTGGG - Intergenic
1013596615 6:111666359-111666381 GTTCCCACAGAGAGGCGGCTTGG + Intronic
1017075408 6:150613104-150613126 GGAACCACAGAGAGGCCAGTGGG - Intronic
1017486832 6:154910498-154910520 GGTTACAGAGAGAGGCAGCTTGG + Intronic
1017967854 6:159281889-159281911 GGCTGAACAGAGAGGCAGCATGG - Intergenic
1019182877 6:170202858-170202880 GGAGCCACAGAGAGGCTGGGTGG + Intergenic
1019614725 7:1954053-1954075 GGACCCACAGTGAGGCTGGTCGG - Intronic
1019624105 7:2007078-2007100 GGAGGCACAGATGGGCAGCTGGG + Intronic
1019758174 7:2788760-2788782 GGCTCCATAGAGAGGCAGTGTGG - Intronic
1022031126 7:26492630-26492652 GGTTCCAGGGAGAGGCAGCTGGG - Intergenic
1022471935 7:30687302-30687324 GCATCCCCAGAGTGGCTGCTAGG + Intronic
1023582691 7:41699711-41699733 GGTCACACAGAGAGGAAGCTCGG - Intronic
1024583512 7:50820927-50820949 GGATCCACATATAGGCAGTCTGG + Intergenic
1026463216 7:70632583-70632605 GGAGCCAGAGAGTGGCAGCAGGG - Intronic
1028968221 7:96827043-96827065 GGACCCACAAAGAGGCACCAGGG - Intergenic
1029457887 7:100680083-100680105 GGAACCAGGGAGAGGCAGGTGGG + Exonic
1031576374 7:123419902-123419924 GGATCCACAGAGTACCAGCTGGG + Intergenic
1032334238 7:131010218-131010240 GGAGCCACTCAGAAGCAGCTGGG + Intergenic
1032650791 7:133876050-133876072 GGATTCACAGATAGGTAGGTAGG + Intronic
1034033637 7:147796726-147796748 GGATGCACAGAGATGCTGCAGGG + Intronic
1034402838 7:150877073-150877095 GGATCCAGGTAGATGCAGCTGGG + Intergenic
1034551650 7:151824491-151824513 GGCTCCACACAGAGGCTACTAGG - Intronic
1035376815 7:158411817-158411839 TGAGCCACAGAGAAGCAGCCCGG - Intronic
1035497780 8:67934-67956 GAATCCACAGAGAAGCGGGTAGG - Intergenic
1035603418 8:912782-912804 GGCTCCACAGAGAGGAACGTGGG - Intergenic
1036310361 8:7680573-7680595 AGCTCCACCGAGAGGCCGCTCGG - Intergenic
1043356655 8:79421385-79421407 GGAGCCATAACGAGGCAGCTCGG - Intergenic
1044270480 8:90237056-90237078 GGAGGAACAGAGAGGCATCTTGG - Intergenic
1045979232 8:108165045-108165067 AAATCTACAGAGAGGCAGCATGG - Intergenic
1046379458 8:113433708-113433730 GGATCCACTGACAAGCAGCGTGG + Intronic
1048255749 8:132903999-132904021 GGATGCAGAGAGAGGCAACTTGG - Intronic
1048369245 8:133763406-133763428 GGATCCACAGGGAGCAATCTAGG + Intergenic
1049304430 8:141893452-141893474 GGATCCACAGGAAGGGAACTGGG - Intergenic
1049447788 8:142639352-142639374 GGATGGACAGACAGGCAGATGGG + Intergenic
1049803817 8:144530074-144530096 GGAGCCACAGGGAGGCAGCCCGG + Exonic
1052257161 9:26471298-26471320 GGCTCCAAAGAGAGTCAGCAAGG + Intergenic
1052318612 9:27143269-27143291 GGCTCAACAGAGACGGAGCTGGG + Intronic
1053438209 9:38091701-38091723 GCATCCACAGGAAGTCAGCTTGG + Intergenic
1053514308 9:38717003-38717025 GGCACCCCAGAGAGGCAGCCAGG + Intergenic
1053614637 9:39750795-39750817 AGATCCACACACATGCAGCTTGG - Intergenic
1053872664 9:42508729-42508751 CGATCCACACACATGCAGCTTGG - Intergenic
1053900084 9:42787184-42787206 AGATCCACACACATGCAGCTTGG + Intergenic
1054238881 9:62591597-62591619 AGATCCACACACATGCAGCTTGG + Intergenic
1054261552 9:62870412-62870434 AGATCCACACACATGCAGCTTGG - Intergenic
1054269664 9:62958023-62958045 CGATCCACACACATGCAGCTTGG + Intergenic
1054553010 9:66626119-66626141 AGATCCACACACATGCAGCTTGG + Intergenic
1054768285 9:69060981-69061003 GGACCCACAGAGGGGTAGCAGGG + Intronic
1056478108 9:86972744-86972766 GGCTCACCAGAGAGGAAGCTTGG - Intergenic
1056495263 9:87149261-87149283 GGAACCCCAGAAAGGCAGCCTGG - Intronic
1057140504 9:92724077-92724099 AGATACACAGGGAGGCAGCTGGG - Intronic
1058453042 9:105114600-105114622 GGACCCAAAGGGAAGCAGCTGGG + Intergenic
1061059020 9:128241217-128241239 GGATGCTCAGAGAAGAAGCTGGG + Intronic
1061398621 9:130356484-130356506 AGATGGACAGAGAGGAAGCTGGG - Intronic
1061890792 9:133618047-133618069 GGCCCCACAGAGAGGGAGCCAGG - Intergenic
1188236666 X:27739950-27739972 GAACCCACAGAGAGGCAGCCAGG - Intronic
1195680598 X:107543286-107543308 AGATGCTCAGAGAGGCAGCTGGG - Intronic
1196297191 X:114011723-114011745 GGATTCACAAAGAGACAGCAGGG + Intergenic
1197752897 X:129977735-129977757 GGACTCTCAGAGAGGCAGCTTGG - Intergenic
1198370410 X:135984123-135984145 GAATACACACAGGGGCAGCTTGG + Intergenic
1199210649 X:145206181-145206203 GGACCCACAGACAGTGAGCTGGG + Intergenic