ID: 902982963

View in Genome Browser
Species Human (GRCh38)
Location 1:20138827-20138849
Sequence GCCTTCAGCAGGAATCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 8, 3: 35, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902982952_902982963 15 Left 902982952 1:20138789-20138811 CCTCCGTGGCCCCCAGGTGATGT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193
902982955_902982963 5 Left 902982955 1:20138799-20138821 CCCCAGGTGATGTCTGAGCAACC 0: 1
1: 3
2: 35
3: 97
4: 296
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193
902982957_902982963 3 Left 902982957 1:20138801-20138823 CCAGGTGATGTCTGAGCAACCCA 0: 1
1: 0
2: 3
3: 16
4: 188
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193
902982954_902982963 6 Left 902982954 1:20138798-20138820 CCCCCAGGTGATGTCTGAGCAAC 0: 1
1: 1
2: 32
3: 76
4: 267
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193
902982953_902982963 12 Left 902982953 1:20138792-20138814 CCGTGGCCCCCAGGTGATGTCTG 0: 1
1: 0
2: 2
3: 37
4: 328
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193
902982956_902982963 4 Left 902982956 1:20138800-20138822 CCCAGGTGATGTCTGAGCAACCC 0: 1
1: 0
2: 5
3: 59
4: 233
Right 902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG 0: 1
1: 1
2: 8
3: 35
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902982963 Original CRISPR GCCTTCAGCAGGAATCCTGG TGG Intergenic
900474658 1:2870427-2870449 GCCTTGACCAGGAATGATGGTGG - Intergenic
900920789 1:5668912-5668934 GCCTTCAGAACGTGTCCTGGAGG + Intergenic
901293187 1:8140489-8140511 GCCAGGAGCAGCAATCCTGGGGG - Intergenic
901718757 1:11178112-11178134 GCCATCAGCAGCACTCCTGGTGG - Intronic
902627333 1:17684238-17684260 GCCTGTAGGAGGAATCCAGGAGG - Intronic
902685385 1:18073389-18073411 GTCTTCACCAGGAAGGCTGGGGG - Intergenic
902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG + Intergenic
904680954 1:32228828-32228850 GGCTTCAGCAGGAAGGCAGGTGG - Intronic
904987136 1:34561266-34561288 GCATTCAGGAGGAACCATGGAGG - Intergenic
907464040 1:54623452-54623474 CCCTGCAGCTGGAATCCTGTGGG + Exonic
907667611 1:56447134-56447156 GGCTGCAGAAGGAATCCCGGAGG + Intergenic
907858964 1:58332345-58332367 GCCTGAAGAAGGAAACCTGGGGG - Intronic
908737053 1:67287971-67287993 GCATTCAGCGGGGATCCTGAAGG - Intergenic
909884596 1:80925182-80925204 GACTTCAGCATGAATGTTGGTGG - Intergenic
912480412 1:109978406-109978428 GCCCCCAGCAGGCATCCTGAAGG + Intergenic
912949673 1:114111961-114111983 GGCTTCAGCAAGAATGCTGGGGG + Intronic
913112774 1:115671232-115671254 GCCTGCAGCAAGAATCCTCCAGG - Intronic
915040422 1:152963635-152963657 ATCTTCAGCAAGAATCCTGTTGG + Intergenic
915510506 1:156384520-156384542 AGCTTCAGCAGGAGCCCTGGTGG - Exonic
918983113 1:191588970-191588992 GCCTTCAGCAGGAATCCTGTTGG - Intergenic
919089387 1:192960263-192960285 GCCAACAGCAGGAATCCAGGTGG + Intergenic
919615503 1:199803514-199803536 GCCTTCTGCAGGCATCCAAGGGG - Intergenic
919882148 1:201907786-201907808 GCCCGCAGCAGGATTCTTGGTGG - Intronic
919911751 1:202115388-202115410 GCCTTCATCAGAATCCCTGGAGG + Intergenic
919929061 1:202209295-202209317 GCCATCCCCAGGGATCCTGGAGG + Intronic
922238086 1:223736458-223736480 GCCTTTCACAGGGATCCTGGAGG + Intronic
922478620 1:225923760-225923782 GTCTTCTGCAGGCATCCTGTCGG - Exonic
922724838 1:227918023-227918045 GACTTAAGAAGGAACCCTGGGGG - Intergenic
923101016 1:230817563-230817585 GCCTTCAGCAAGAATCCTGTTGG + Intergenic
923339649 1:232996471-232996493 GCCTCCAGCAGGTGTCCTGCAGG + Intronic
924825760 1:247536586-247536608 GCCTTCAGGAGGGAGCCTGAGGG + Intronic
924926355 1:248686989-248687011 GCTTCCAGAAGGAAGCCTGGGGG + Intergenic
1062828111 10:587089-587111 GCTATCAGCAGGGATCCGGGTGG - Intronic
1063366980 10:5496843-5496865 GGCTTCAGCACAAAGCCTGGGGG - Intergenic
1063595598 10:7432342-7432364 GTCATCAGCAAGACTCCTGGGGG - Intergenic
1064352892 10:14592927-14592949 GACTTGAGCTGGAAGCCTGGGGG - Intronic
1064593704 10:16921712-16921734 GCCTACAGGAGGATTCCTGAGGG - Intronic
1067313129 10:45134007-45134029 GCCTACAGGAGGATTCCTGAGGG + Intergenic
1070480868 10:76881720-76881742 CCCTTCAGCAGAGATTCTGGGGG + Intronic
1073583463 10:104687635-104687657 CCCTTCAGCTTGAAACCTGGGGG - Intronic
1075239951 10:120769293-120769315 CCCCTCAGCAGGAATCTTTGGGG + Intergenic
1076749620 10:132536261-132536283 GCCGTAAGGAGGAACCCTGGGGG + Intergenic
1076850591 10:133090640-133090662 GTCTTGAGAAGGAAGCCTGGAGG + Intronic
1078662713 11:13299893-13299915 GCCTTCAGGTGGGAGCCTGGTGG + Intronic
1079306373 11:19327120-19327142 GCCTTGAGAAGGAGGCCTGGGGG - Intergenic
1079502063 11:21112055-21112077 GCCTTCATCAGGATTCTTGGTGG + Intronic
1080765995 11:35297269-35297291 GCCTTCAGCTAGAATCCTGTGGG + Intronic
1081288005 11:41296227-41296249 GCTTTCACAAGAAATCCTGGCGG + Intronic
1082816845 11:57514855-57514877 GACTTCGGCAGGAAGTCTGGCGG + Intronic
1083255315 11:61491817-61491839 GCCTTGAGCAGCAGGCCTGGGGG + Intergenic
1084696803 11:70760745-70760767 GCCTTCAGCTGGAAGCCTCCAGG - Intronic
1086405237 11:86493787-86493809 TCCTTCAACAGGAAACCTGGAGG + Intronic
1088689324 11:112311726-112311748 AGCTGCAGCAGAAATCCTGGTGG + Intergenic
1089423521 11:118350353-118350375 GGCTTCCCCAGGAATCCTGGGGG + Intronic
1090989049 11:131799790-131799812 GCCCTCAGCTAGAATCCTAGTGG + Intronic
1094502832 12:31036093-31036115 GCCTTCTGCAGGACTCCCAGTGG - Intergenic
1100910572 12:99356649-99356671 GTATTTAACAGGAATCCTGGAGG + Intronic
1101292985 12:103390082-103390104 ACCTTCAGCAGCAATGATGGAGG - Intronic
1103011288 12:117460432-117460454 GCCTGGAGCAGGGATACTGGAGG + Exonic
1103339824 12:120215431-120215453 GACGTCAGCAGGACTCCTGGTGG + Intronic
1104483602 12:129130172-129130194 CCCTCCAGCAGAACTCCTGGAGG - Intronic
1104880559 12:132067852-132067874 TCCTCCAGCAGGAGTCCAGGCGG - Intronic
1104964370 12:132502375-132502397 GCCTTCCGCAGGATTCCTCTGGG - Intronic
1106656610 13:31753300-31753322 GCCTTGAGCAGCAATCCAGTTGG + Intronic
1107011940 13:35678644-35678666 GCCTTCAGAACCATTCCTGGGGG - Intergenic
1107797281 13:44065594-44065616 GCCTTCAGATTGACTCCTGGGGG - Intergenic
1107995552 13:45856704-45856726 GGCTTCAGCAAGAATTTTGGGGG - Intergenic
1108535223 13:51370004-51370026 GAATTCAGCTGGGATCCTGGAGG - Intronic
1109230518 13:59751029-59751051 GCCTTCAGCAGCAATGCTTTTGG + Intronic
1109627575 13:64995569-64995591 GCCTTCAACAAGAATCCTGTAGG - Intergenic
1109915865 13:68984606-68984628 GCCTTCAGAAGTAAGCCCGGAGG + Intergenic
1110174242 13:72536999-72537021 GGCTTGATCAGGAATCCTAGTGG - Intergenic
1110432943 13:75446896-75446918 CCCATCAGCAGGAATTGTGGTGG + Intronic
1110773418 13:79377423-79377445 GCCATCATCAGGAAGCCTGAAGG - Exonic
1110971124 13:81762682-81762704 TCTTTCAGCAAGAACCCTGGTGG - Intergenic
1115881899 14:37928769-37928791 TCCTTGAGAAGGAATCCTGCAGG + Intronic
1119846427 14:77833714-77833736 GCCATCAGTGGGAGTCCTGGGGG + Intronic
1121263277 14:92581943-92581965 GCCTTCAGCAAGAATCCTGTTGG - Intronic
1124665144 15:31586032-31586054 TCCCTCAGCAGGAATTCTGAAGG + Intronic
1125343424 15:38696420-38696442 GCCTTCAGCAGAGCTCCTGGTGG - Intergenic
1126255221 15:46617373-46617395 GACTTCAGCAGGACACCTGCAGG - Intergenic
1128542474 15:68545589-68545611 GCCTGCAACAGGAATGCGGGGGG + Intergenic
1128820680 15:70650025-70650047 GTCTTCAGTAAGAATCCTGTGGG - Intergenic
1129536145 15:76315069-76315091 GTTTCCAGCAGGAATCCTGGAGG - Intergenic
1131333639 15:91526005-91526027 GCCGTAAGCAGGAAGCCAGGAGG - Intergenic
1132299562 15:100767574-100767596 GCCCTCAGCAGGAGTCCGTGCGG - Intergenic
1132663695 16:1072501-1072523 GCCGCCAGCAGGAGTCCAGGGGG - Intergenic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1136283993 16:29230669-29230691 GCCTTCTGCATGAAGCCTGCCGG - Intergenic
1137289444 16:47041943-47041965 GCCTTGAGCAGGCTTCCAGGAGG - Intergenic
1137633875 16:49968628-49968650 CCCTTCAGTAAGAATCCTGTTGG - Intergenic
1137754869 16:50893344-50893366 GACTTGAGCTGGAATCCTGGAGG + Intergenic
1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG + Intronic
1139506415 16:67400226-67400248 CCCTTCAACAGGCTTCCTGGTGG + Intronic
1140924549 16:79569907-79569929 TCCATCAGCTGGAATCCGGGAGG + Intergenic
1140959183 16:79896053-79896075 GACTCCAACAGGAATCGTGGTGG + Intergenic
1141351771 16:83304721-83304743 GCATTCAGCAGGTGTCCTGTGGG + Intronic
1141522819 16:84592795-84592817 GCCTTCAACAAGAAGCCGGGTGG + Intronic
1141944198 16:87298360-87298382 GGCTGCAGCAGGAAACCTGGTGG - Intronic
1143172606 17:4938856-4938878 GCCTTCAGCAGAAAGCCAGGGGG + Exonic
1144252859 17:13437297-13437319 GTCTTCAGCAAGAATCTTGGGGG - Intergenic
1145973831 17:28972796-28972818 GCAGGCAGCAGGAATCCTCGGGG + Intronic
1147623777 17:41885987-41886009 GACTTCAGCAGCATTCCTGCGGG + Intronic
1151882247 17:76902816-76902838 GCTTTCAGCAGGACAACTGGGGG + Intronic
1152408711 17:80111467-80111489 GCCTTCAGCAAGAATCCTGCTGG - Intergenic
1152749954 17:82058076-82058098 GGCTCCAGCAGCAGTCCTGGGGG + Exonic
1154390359 18:13931536-13931558 GCCACCAGCAGGGGTCCTGGGGG + Intergenic
1155250007 18:23945295-23945317 ACCTTCAGCATGCGTCCTGGCGG - Intronic
1155707024 18:28828629-28828651 GCCTTCAGCAAGAATCCTGCTGG + Intergenic
1157863344 18:51160897-51160919 GCCTCCAGCATGCATCCTGCAGG + Intergenic
1158983620 18:62790672-62790694 GCCACCACCAGGAATCATGGTGG - Intronic
1160432653 18:78822590-78822612 GCCCTCTGCAGAAATCCTAGTGG + Intergenic
1160562471 18:79767271-79767293 GCTTCCAGCAGGAAACCTGCTGG + Intergenic
1166503522 19:43357428-43357450 GCCTTCAGAATGGATACTGGTGG + Intronic
1166506932 19:43377333-43377355 GCCTTCAGAATGGATACTGGTGG - Intergenic
1167082132 19:47283591-47283613 GCCCTTAGCAGGAGTCCTTGGGG - Intergenic
1167522100 19:49961116-49961138 TCCTCCAGCAGGAAGCCTGGTGG + Exonic
1167523282 19:49969609-49969631 TCCTCCAGCAGGAAGCCTGGTGG - Intergenic
1167769423 19:51505122-51505144 GCCTGCAGCATCACTCCTGGAGG + Intergenic
1168161810 19:54515404-54515426 GCCTTCAGCAAGAATCCTGCTGG - Intergenic
1168336081 19:55598617-55598639 GACTTAAGGAGGAATCCAGGAGG - Intronic
1168679731 19:58305790-58305812 GCCGCCAGAAGGAATGCTGGGGG + Intronic
1168680883 19:58314959-58314981 GCCGCCAGAAGGAATGCTGGGGG + Exonic
926275571 2:11400681-11400703 GACCACAGCAGGAATCCTAGTGG - Intergenic
927188281 2:20497957-20497979 GCCTGCAACAGGACTTCTGGGGG - Intergenic
927271755 2:21217810-21217832 GCATTCAGGAGGCTTCCTGGAGG + Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
930086070 2:47498146-47498168 GCCTTCAGCAAGAGTCCTATTGG + Intronic
932467552 2:71933327-71933349 GCCCCCAGCAGGAGTCCTTGTGG - Intergenic
932467832 2:71934910-71934932 GCCCCCAGCAGGAGTCCTGTGGG + Intergenic
933049149 2:77580425-77580447 GCCTTCAGCAGAAATCCAGAAGG + Intronic
934915122 2:98295438-98295460 GCCTTCAGCAAAAATGCTGCGGG - Intronic
935391984 2:102562459-102562481 TCCTTCAGCAGTAATACAGGCGG - Intergenic
935423596 2:102896054-102896076 GCCTTCAGGAGGATTCCAGAAGG + Intergenic
936739882 2:115491932-115491954 GCCTTTAACAAGAATCCTGCTGG - Intronic
937278230 2:120700040-120700062 GCCTTCATCAAGAATCCTGTTGG + Intergenic
937978645 2:127597390-127597412 GGCCGCAGAAGGAATCCTGGTGG - Intronic
938119194 2:128622031-128622053 GTCTTCACCAGAAATCCTGTGGG + Intergenic
938392200 2:130915200-130915222 TCCTTCTGCAGGTCTCCTGGGGG + Intronic
946352219 2:219162571-219162593 GTGTTGAGCAGGAATCCTGTGGG - Intronic
946382568 2:219358849-219358871 ACCGTCAGGAGGAAACCTGGGGG - Intergenic
948705433 2:239789412-239789434 GGTTTCAGCAGGAACCCTGTGGG - Intronic
948941606 2:241199685-241199707 GCCCTCAGCAGGTGGCCTGGCGG - Intronic
1169776627 20:9262382-9262404 GCCTGCAGAAGGCATCCAGGAGG - Intronic
1170772960 20:19350046-19350068 GTCTTCTCCAGGACTCCTGGAGG - Intronic
1172181837 20:33008345-33008367 TGCTTCATCAGGAATCATGGGGG - Intronic
1172693164 20:36804315-36804337 GCCTTAACCAGGAGCCCTGGGGG - Intronic
1174483043 20:50844717-50844739 CCCTGCAGCAGGAGTGCTGGGGG - Intronic
1175390893 20:58626663-58626685 GCCTTGAGCTGGGAGCCTGGGGG - Intergenic
1179504128 21:41828787-41828809 GCCAACACCAGGGATCCTGGGGG - Intronic
1180797343 22:18612283-18612305 GGCTTCAGCAGAAATGTTGGAGG + Intergenic
1181224379 22:21382989-21383011 GGCTTCAGCAGAAATGTTGGAGG - Intergenic
1181254253 22:21551824-21551846 GGCTTCAGCAGAAATGTTGGAGG + Intronic
1181497880 22:23298224-23298246 GTCTTCAGCAAGAATCCTGTCGG - Intronic
1181557517 22:23680027-23680049 GTCTTTAGCAGGAATCCTCACGG + Intergenic
1182356105 22:29722856-29722878 GCCTGCCGCAGAAATCCAGGGGG + Intronic
1183335650 22:37244414-37244436 GGCTCCAGCAGGAGACCTGGGGG + Intronic
1183905104 22:41034597-41034619 GCATGCAGCAGGAAGCCTTGGGG + Intergenic
1184362297 22:44025596-44025618 CCCTTCAGTAGGTCTCCTGGCGG + Intronic
950134523 3:10571318-10571340 GCCTTCAGCAGGGATGCCAGAGG + Intronic
950924777 3:16729532-16729554 GTCTTCAGCAAGAATCTTGTTGG - Intergenic
954684531 3:52363200-52363222 GCCCTCAGCAGGTGCCCTGGAGG - Intronic
955066123 3:55535046-55535068 GGCCACAGCAGGAACCCTGGTGG - Intronic
955988641 3:64601645-64601667 GCCTCCAGGATGAATCCTGATGG + Intronic
956620810 3:71219978-71220000 GCCTCCACCATGAACCCTGGTGG + Intronic
956707017 3:72007871-72007893 GTCTTCAGCAAGAATCCTAGTGG + Intergenic
958701212 3:97592720-97592742 CCTACCAGCAGGAATCCTGGGGG - Exonic
958803017 3:98778085-98778107 GCTTTCAGAAGGAATGTTGGTGG - Intronic
959748735 3:109808328-109808350 GACTTCAGGAGGAATGTTGGTGG + Intergenic
961338789 3:126203506-126203528 GCCTTCTGCAGACACCCTGGTGG - Intergenic
961557085 3:127703104-127703126 CCCTGCAGAAGGAATCCTGGGGG - Intronic
962777316 3:138674313-138674335 GCCTTCAACAGTCAGCCTGGTGG - Intronic
962835809 3:139187518-139187540 GGCTCCAGCTGGGATCCTGGTGG + Intronic
962990391 3:140572566-140572588 GCCCTCAGCAGGTCTCGTGGAGG - Exonic
964478269 3:157116743-157116765 GCCCTCAGTAGGAAACCTTGCGG - Intergenic
965404457 3:168251861-168251883 TTCTTCAGCAGGAATCGTGTTGG + Intergenic
967980030 3:195060172-195060194 GCACGCAGCAGGAATCCAGGAGG + Intergenic
971016201 4:22491626-22491648 GCCTTCAACAAGAATCCTCAGGG + Intronic
971039776 4:22738825-22738847 GCCTTCAGCAGGTATAGTTGGGG - Intergenic
971766034 4:30833272-30833294 GATATCAGCAGGATTCCTGGAGG + Intronic
977107372 4:92904874-92904896 GACTTTAGCATGAATTCTGGTGG + Intronic
977605143 4:98977019-98977041 GCATTGAGCAGGAATCTTGTAGG + Intergenic
978343240 4:107739365-107739387 GCCTCCAGCAGGATTCCTGTTGG + Intergenic
978686395 4:111449960-111449982 CCTTTCAGGAGGAACCCTGGCGG - Intergenic
982093793 4:151902364-151902386 GTTTTCAGCAGAAATCCTGTGGG - Intergenic
983677472 4:170312473-170312495 GTCTTCAGCAAGAAGCCTGTTGG + Intergenic
985074059 4:186195413-186195435 GACTTGAGCAAGAAGCCTGGTGG + Intronic
988057366 5:26115776-26115798 GCCTTTTGCAGCAATCCTGGGGG + Intergenic
990942066 5:61212898-61212920 GCCTTCAGCAGAAATCATGGTGG + Intergenic
992589654 5:78281002-78281024 GCCTTCATCAGGAAACTTGGTGG - Intronic
993475669 5:88361279-88361301 GCTTTCAGCTGGAGTCCTTGAGG + Intergenic
994173750 5:96687136-96687158 GCCTTAAGCAAGAATCCTATAGG - Intronic
994885432 5:105555431-105555453 ACCTTCAGCAGGATTCTTGAGGG - Intergenic
1002130190 5:177076511-177076533 GTCTTCAGCAAGAATCCTGTTGG + Intronic
1008145464 6:47886384-47886406 GCCTTCAGAAGACATACTGGTGG + Intronic
1012451463 6:99356529-99356551 GTCTTCATCAGGAATCTTGTTGG - Intergenic
1016514141 6:144874739-144874761 ATCTTGAGCAGGAATCCTAGTGG + Intergenic
1018248143 6:161841801-161841823 GCCTACAGCAAGAATCCTATTGG + Intronic
1019143160 6:169961032-169961054 GCCTTCAGGAGGAAGACTGGAGG - Intergenic
1019555048 7:1625100-1625122 GCCATCAGCAGGAAGCCTCAGGG + Intergenic
1022342855 7:29485528-29485550 GCCTTAACCAAGAATCCTCGTGG + Intronic
1024983511 7:55177206-55177228 GGCCTCACCAGCAATCCTGGCGG + Intronic
1025859091 7:65309792-65309814 GCCTCCAGCAGGATTCCTGCTGG + Intergenic
1027598900 7:80213579-80213601 GCCTTCAACAGCAACCCAGGAGG - Intronic
1028751636 7:94389974-94389996 GACTGCAGCAGGAATTCTGAGGG - Intergenic
1029711986 7:102304703-102304725 AGCTTCAGCAGGTATCCTGCTGG - Intronic
1030624386 7:111828349-111828371 TACTTCAGCAGTAACCCTGGAGG + Intronic
1033683007 7:143614771-143614793 ACCTTTAGCAGAAAGCCTGGTGG + Intergenic
1033701606 7:143842867-143842889 ACCTTTAGCAGAAAGCCTGGTGG - Intergenic
1034265172 7:149777257-149777279 TGCCTCAGCAGGAAGCCTGGAGG + Intergenic
1034503153 7:151464764-151464786 CCCTTCCGCAGGCAACCTGGCGG + Intergenic
1035555301 8:563115-563137 GTCTTCAGCAAGAATCCTGGTGG - Intergenic
1035572477 8:681952-681974 GCCTTCATTAAGAATCCTGGTGG + Intronic
1035759747 8:2060992-2061014 GCCTTCAGCCAGAACCCTGCTGG - Intronic
1039900753 8:41750979-41751001 GCCGTGAGCTGGAATCCCGGGGG - Intronic
1040853013 8:51921537-51921559 GCCTTCAACAAGAATCCTGTAGG - Intergenic
1041233680 8:55777371-55777393 GCCCTCAGCAAGAATACTGTTGG + Intronic
1041993317 8:64021899-64021921 CCCTTCAGAAGTAATCTTGGGGG + Intergenic
1047941272 8:129829743-129829765 GCCCTCAGCAAGAATCCTGTTGG + Intergenic
1048974631 8:139664313-139664335 CTCTTCAGCATGAATCCTGCTGG + Intronic
1049386467 8:142345336-142345358 GACCTCTGCAGGTATCCTGGTGG - Intronic
1053410842 9:37915144-37915166 GAGTTCAGCAGAGATCCTGGCGG - Intronic
1054779751 9:69155485-69155507 GCCTGAAGCAGAAACCCTGGGGG - Intronic
1057206400 9:93175581-93175603 TGCTTCAGCAGGAGTCCTGGTGG + Intergenic
1057630318 9:96714811-96714833 GCCTTCAGCATGAATCCTGTTGG - Intergenic
1060647430 9:125292912-125292934 GCTTTCAAAAGGAATTCTGGAGG + Intronic
1061494432 9:130963615-130963637 CCCATCAGCAAGAATCCTGCTGG - Intergenic
1062299501 9:135857132-135857154 CCCTTCTTCAGGAATCCTGCTGG + Intronic
1062597375 9:137305373-137305395 GCCTTGAGCAGCCATCCCGGCGG - Intergenic
1186718966 X:12282210-12282232 CCCTTCAGCAGGCAGCCTGGAGG - Intronic
1187138346 X:16570088-16570110 GCCTTCAGCAAGAATTCTTTTGG + Intergenic
1187827489 X:23346471-23346493 GCTTTCAGCAAGAATCCTGTCGG - Intronic
1189995391 X:46632568-46632590 GTCTTCAGCAAGAATCCTATTGG + Intronic
1190005850 X:46737257-46737279 GTATTTGGCAGGAATCCTGGAGG + Intronic
1197715699 X:129704720-129704742 ACCTTCAGCCAGGATCCTGGGGG - Intergenic
1198550873 X:137743649-137743671 GCTTTCAGCAAGAATCCTGTTGG - Intergenic
1200710572 Y:6481317-6481339 GCCTGCAGCAGGAGGCCTTGGGG + Intergenic
1201342598 Y:12950900-12950922 GCCATCAGCAGGAAGCCAGTTGG + Intergenic