ID: 902983639

View in Genome Browser
Species Human (GRCh38)
Location 1:20142448-20142470
Sequence CTGGGTCCACACGCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902983639_902983644 4 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983644 1:20142475-20142497 GCATCCAGGAGGATGTGCAGAGG 0: 1
1: 0
2: 12
3: 189
4: 1296
902983639_902983641 -7 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983641 1:20142464-20142486 GACCCAGTGCTGCATCCAGGAGG 0: 1
1: 0
2: 5
3: 18
4: 206
902983639_902983640 -10 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983640 1:20142461-20142483 GTGGACCCAGTGCTGCATCCAGG 0: 1
1: 0
2: 0
3: 17
4: 197
902983639_902983646 13 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983646 1:20142484-20142506 AGGATGTGCAGAGGCAGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902983639 Original CRISPR CTGGGTCCACACGCCCAGCC TGG (reversed) Intronic