ID: 902983639

View in Genome Browser
Species Human (GRCh38)
Location 1:20142448-20142470
Sequence CTGGGTCCACACGCCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902983639_902983641 -7 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983641 1:20142464-20142486 GACCCAGTGCTGCATCCAGGAGG 0: 1
1: 0
2: 5
3: 18
4: 206
902983639_902983644 4 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983644 1:20142475-20142497 GCATCCAGGAGGATGTGCAGAGG 0: 1
1: 0
2: 12
3: 189
4: 1296
902983639_902983646 13 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983646 1:20142484-20142506 AGGATGTGCAGAGGCAGCGCAGG 0: 1
1: 0
2: 1
3: 32
4: 400
902983639_902983640 -10 Left 902983639 1:20142448-20142470 CCAGGCTGGGCGTGTGGACCCAG 0: 1
1: 0
2: 5
3: 32
4: 311
Right 902983640 1:20142461-20142483 GTGGACCCAGTGCTGCATCCAGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902983639 Original CRISPR CTGGGTCCACACGCCCAGCC TGG (reversed) Intronic
900156577 1:1205624-1205646 CAGGGTCCAGACTCCCAGCCAGG - Intronic
900342924 1:2197211-2197233 CTGGGTCCTCCCGCCCAGAAAGG - Intronic
900344800 1:2205450-2205472 CCAGGTCCACAGGCCCAGCCCGG + Intronic
901821258 1:11831111-11831133 GTGTGTCACCACGCCCAGCCTGG + Intronic
902053784 1:13583939-13583961 CCGCGGCCACAGGCCCAGCCTGG - Exonic
902420728 1:16277756-16277778 CTGAGCCACCACGCCCAGCCTGG - Intronic
902642055 1:17773266-17773288 CAGGGTCCAGACTCTCAGCCTGG - Intronic
902835221 1:19043053-19043075 CCAGGTCCACACTGCCAGCCTGG + Intergenic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
903568570 1:24286998-24287020 ATGGGACCACACGCACTGCCAGG + Intergenic
903763519 1:25716464-25716486 CTGGGACCACAGGCACAACCTGG + Intronic
903831636 1:26178630-26178652 CTGGGTTCAGACTCCCAGGCTGG + Intronic
904371426 1:30049951-30049973 CAGGGGCCACCGGCCCAGCCTGG + Intergenic
906153409 1:43600659-43600681 CTGGCTCCACACTTCCAGGCTGG - Intronic
906711015 1:47930059-47930081 TTGGCTCCCCAGGCCCAGCCAGG + Intronic
907188386 1:52629478-52629500 CAGGGACCACACACACAGCCAGG + Intergenic
907259896 1:53210172-53210194 CTGGCTCCAGAAGGCCAGCCCGG - Exonic
907450499 1:54542816-54542838 CTGGGTCCAGACGGCCAGCTGGG + Intronic
908690632 1:66775610-66775632 CTGGGTCCCCACTGCCATCCTGG - Intronic
911039970 1:93583626-93583648 CAGGATCCACCCGCCCACCCGGG + Intronic
911266837 1:95753389-95753411 CTGGGTCCACACCCGCAGCCAGG - Intergenic
913340515 1:117753530-117753552 CTCTGTCCCCACCCCCAGCCAGG - Intergenic
914789204 1:150861697-150861719 ATGAGTCACCACGCCCAGCCAGG + Intronic
915601423 1:156925051-156925073 CTCTGACCACCCGCCCAGCCAGG - Intronic
915983596 1:160440506-160440528 CTGGGTCTTCAAGACCAGCCTGG - Intergenic
916455402 1:164965991-164966013 CTGAGCCAGCACGCCCAGCCTGG - Intergenic
919637035 1:200013093-200013115 GTGAGTCACCACGCCCAGCCAGG - Intergenic
920243468 1:204570724-204570746 CTGGGTCCCCTAGCCCAGCAGGG - Intergenic
922724822 1:227917950-227917972 CTGGGGCCATACACGCAGCCTGG + Intergenic
923038480 1:230301976-230301998 ATGAGTCACCACGCCCAGCCTGG + Intergenic
923573376 1:235136555-235136577 CTGGGTCCCCAAGTCAAGCCAGG + Intronic
1063106151 10:2993982-2994004 CTGGAGCCACACGCGCAGCCTGG + Intergenic
1064410150 10:15097581-15097603 CTGGGTGCACGCGCCCGGCCCGG - Exonic
1064998071 10:21313882-21313904 CTCGGTCCTCGCGCACAGCCTGG + Intergenic
1069121703 10:64576523-64576545 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1069592859 10:69652642-69652664 CTGGGTCCACAGTCACAGCTGGG - Intergenic
1069915341 10:71783621-71783643 CTGGGGCCACAGGGCCAGCGGGG + Intronic
1070771127 10:79082880-79082902 CTGGGGACTCAAGCCCAGCCAGG - Intronic
1070784986 10:79157679-79157701 CTGGATCCCCACCCCCAGCTTGG + Intronic
1072619362 10:97069310-97069332 CTGCATCCACAAGCCCAGCCCGG - Intronic
1072798833 10:98377725-98377747 CTGCCTCCTCACGGCCAGCCAGG + Intergenic
1074818531 10:117162997-117163019 CTGGGTCCCTTCGCCCCGCCCGG + Intergenic
1075084511 10:119405553-119405575 CTGGCTCCCCACCCCCACCCAGG + Intronic
1075734300 10:124654633-124654655 CAGGGTCCCCACCCCCAGCTCGG + Intronic
1076996423 11:299439-299461 CCGGGCCCCCACGCCCAGCAAGG - Exonic
1077580436 11:3413832-3413854 GTGAGCCCACACGCCCACCCGGG - Intergenic
1078315286 11:10289256-10289278 CTTGGTCCACAGCCCCAGCTTGG + Intronic
1078634927 11:13040562-13040584 GTGAGTCACCACGCCCAGCCTGG - Intergenic
1079193807 11:18306012-18306034 GTGTGCCAACACGCCCAGCCAGG + Intronic
1080024605 11:27600277-27600299 CTGGGTCCACACTCCCTGTCTGG + Intergenic
1081573842 11:44307402-44307424 CTGGGCCCCCACAGCCAGCCTGG - Intronic
1081705738 11:45181100-45181122 CGGGGTCCTCATGCCAAGCCCGG - Intronic
1081984342 11:47290674-47290696 TTGGGTCCCCCCGCCCAGCTAGG - Exonic
1083670384 11:64296892-64296914 CTGGGTCCGCACCCCCTCCCAGG - Exonic
1083900660 11:65641786-65641808 CTGGCTCCTCACCCCCAGCCAGG + Intronic
1084219010 11:67666437-67666459 CAGGGTCCCCATGCCCAACCAGG + Intronic
1084333810 11:68445694-68445716 CTGGGCCCACACACCCACACAGG - Intronic
1084518761 11:69650348-69650370 CTGGAACGCCACGCCCAGCCAGG - Intronic
1084572985 11:69970643-69970665 CTGGGTCCCCACTCCCTGCGAGG - Intergenic
1084597563 11:70126096-70126118 CTGGGTGTACACGCCCAGCCAGG - Exonic
1085038595 11:73313951-73313973 CTGTGTTCACAAGCCAAGCCTGG - Intronic
1085044140 11:73343539-73343561 CTGGGTCCACAGGCTCAGGAAGG + Intronic
1085123771 11:73983511-73983533 CTGGGTGCTCCCGCCCCGCCGGG - Intergenic
1087602140 11:100329693-100329715 CTGGGTCCAGCCACCCAGCAGGG - Intronic
1089781936 11:120879298-120879320 CTGGGTCCTCATGACCAGCTGGG + Intronic
1090518363 11:127452342-127452364 CTGGGTCCCCACTGACAGCCTGG + Intergenic
1090972527 11:131655605-131655627 CTGGGACCACAGCCCCTGCCGGG + Intronic
1091857164 12:3749252-3749274 CTGGGACCACAAGCATAGCCAGG - Intronic
1092543665 12:9435603-9435625 CGAGGTCCACATGCGCAGCCTGG + Intergenic
1092781160 12:11988579-11988601 GTGGGTCACCATGCCCAGCCAGG + Intergenic
1096243857 12:49973702-49973724 CTGGGTCCTGGGGCCCAGCCCGG - Intronic
1101640842 12:106584824-106584846 CTGGGGGCTCACACCCAGCCAGG - Intronic
1101918375 12:108913341-108913363 ATGAGCCAACACGCCCAGCCAGG + Intronic
1102027666 12:109722735-109722757 CTGGGCCCACACTGCCCGCCAGG - Intronic
1102548172 12:113671556-113671578 CTATGTCCTCATGCCCAGCCCGG + Intergenic
1104919093 12:132281292-132281314 CTGAGGCTCCACGCCCAGCCTGG - Intronic
1105059924 12:133139919-133139941 GTGGGTCACCATGCCCAGCCTGG - Intronic
1108409016 13:50129539-50129561 CTGGGGCAACACGCCCCGCGCGG + Intronic
1109125765 13:58515210-58515232 GTGAGTCACCACGCCCAGCCTGG + Intergenic
1109348371 13:61145098-61145120 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1109755047 13:66747067-66747089 ATGGGCCACCACGCCCAGCCAGG - Intronic
1109789826 13:67231135-67231157 CTGGGTCCCCTCGGTCAGCCCGG + Intergenic
1111715451 13:91873961-91873983 CATGATCCACATGCCCAGCCTGG + Intronic
1112008324 13:95273350-95273372 TTGGGACCCCACGCCCATCCAGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113042759 13:106122665-106122687 CTGAGACCAAACTCCCAGCCTGG + Intergenic
1113636162 13:111920466-111920488 CTGGCCCCACTCGCCCAGGCTGG + Intergenic
1113839025 13:113348023-113348045 CCGGGTCCACTCGGCCAGACAGG - Intronic
1114535139 14:23417849-23417871 CTGGGTCTCCACGCCCTGCTGGG - Intronic
1115814160 14:37144899-37144921 CTGTGATTACACGCCCAGCCTGG + Intronic
1117424988 14:55584848-55584870 GTGGGTCATCACACCCAGCCAGG - Intronic
1118007153 14:61573678-61573700 TTGGGTCCCCATGCCCAGGCAGG + Intronic
1118768787 14:68928106-68928128 CTGAGCCCACCCGCCCAGCTGGG + Intronic
1119432710 14:74578807-74578829 CTGGGAACAGACACCCAGCCTGG - Intronic
1119476767 14:74934949-74934971 CTGCCCCCACACACCCAGCCTGG - Intergenic
1119539635 14:75429361-75429383 CTGGGTACACACGCCTAAGCAGG - Intronic
1122430590 14:101637972-101637994 ATGAGTCACCACGCCCAGCCAGG + Intergenic
1122630392 14:103104916-103104938 CTGGGTCCACCCTCCCAATCAGG - Intronic
1122929310 14:104926119-104926141 CTGGGTCCCAGCGCCCAGCCTGG + Intronic
1123049600 14:105534644-105534666 CTTGGTCCTCACGCCCAGTGCGG - Intergenic
1124350733 15:28953835-28953857 CTCGGTCCACACTCCCACCATGG + Intronic
1124663525 15:31570746-31570768 CTGGGCACACCTGCCCAGCCTGG - Intronic
1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG + Intergenic
1125581527 15:40789203-40789225 CTGGGACCACACACGGAGCCTGG + Intronic
1125594284 15:40874235-40874257 CTGGGCCGACTCGCCCAGCCTGG - Exonic
1125757352 15:42072479-42072501 CTGCCTCCTCACCCCCAGCCAGG - Intronic
1127992893 15:64133787-64133809 CTGGGGCCAGCCGCCCAGCCGGG - Intronic
1129116628 15:73368491-73368513 CGGGGTCCCCGCGCCCAGCCGGG - Exonic
1129290499 15:74563262-74563284 CCAGGTCCACACCCCCATCCTGG - Intronic
1129799876 15:78405820-78405842 CTGGGTCCACAAACCCAACTTGG - Intergenic
1131068327 15:89448387-89448409 CTGGGTCCTCATGCCCATCATGG + Intergenic
1131371266 15:91883823-91883845 GTGGGTCCACACCCCGTGCCAGG + Intronic
1132556836 16:576283-576305 AGGGGTCCCCACGCCCACCCGGG - Intronic
1132675788 16:1120794-1120816 CTCGGCCCCCACCCCCAGCCTGG - Intergenic
1133059423 16:3164752-3164774 CTGGGTGCACAGTCCCTGCCGGG - Intergenic
1133232010 16:4371443-4371465 CTGAGTCCTCATGACCAGCCCGG - Intronic
1133321284 16:4915158-4915180 CTGGAACAACAGGCCCAGCCAGG - Intronic
1134438793 16:14285440-14285462 CAGGGAGCCCACGCCCAGCCAGG - Intergenic
1135259599 16:20969635-20969657 TTGGGTGCACACACACAGCCTGG + Intronic
1136177369 16:28526718-28526740 CTGGGTCCAGTCGCCCAGGCTGG + Intergenic
1136568694 16:31084460-31084482 GTGGGTCCAGAGGCCAAGCCTGG + Intronic
1137607569 16:49796748-49796770 CTGGGGCCACTTGCTCAGCCTGG + Intronic
1138555776 16:57770491-57770513 GTGGGGGCACATGCCCAGCCAGG - Intronic
1139400097 16:66674428-66674450 CTCGGTGCACACACCCAGACAGG + Intronic
1141530471 16:84643129-84643151 CTGGGGCCAGACGCCCACCATGG + Intergenic
1141802953 16:86323449-86323471 TTGGATCCACACGCCCAGCGGGG - Intergenic
1142153615 16:88523457-88523479 CCGGGGCCACCCGCCCATCCTGG - Intronic
1142262380 16:89049022-89049044 CTCGGTCCACAGGCCCTGTCTGG - Intergenic
1142697660 17:1642842-1642864 CTGGGACTACAGGCGCAGCCCGG + Intronic
1142808305 17:2383296-2383318 CTGGGCCCCCTTGCCCAGCCTGG + Intergenic
1143637835 17:8176549-8176571 CTGGGTACCCGCGCGCAGCCAGG + Intergenic
1144690904 17:17263004-17263026 ATGAGCCAACACGCCCAGCCAGG - Intronic
1146137967 17:30339903-30339925 GTGAGTCACCACGCCCAGCCAGG + Intergenic
1146506319 17:33408929-33408951 ATGGGCCATCACGCCCAGCCAGG - Intronic
1147638105 17:41976242-41976264 CTGGGCCCAGAGGCACAGCCGGG + Exonic
1148106461 17:45121372-45121394 CCGGGTCCTCCCGCCCCGCCAGG - Exonic
1148336906 17:46848115-46848137 CTGGGTCCACACGTTCACACAGG - Intronic
1148746802 17:49922923-49922945 CTGGGATCACACTCCCAGGCCGG - Intergenic
1151668210 17:75557642-75557664 CTGTGTACACCAGCCCAGCCTGG - Intronic
1152403768 17:80084978-80085000 CTGGGACCTCACCCCCAGCTCGG - Exonic
1152536128 17:80951190-80951212 CAGGGACCCCAGGCCCAGCCGGG - Intronic
1152554269 17:81045302-81045324 CTGGGCCCCCAGCCCCAGCCTGG - Intronic
1154008887 18:10559104-10559126 ATGGGTCCACACACCCACGCAGG - Intergenic
1156462881 18:37331569-37331591 CCGAGTGCACACCCCCAGCCAGG - Intronic
1157590972 18:48836319-48836341 CAGGGTCCCCATGCTCAGCCTGG + Intronic
1157752614 18:50193362-50193384 CTGCGGCCCCACCCCCAGCCAGG + Intronic
1157755371 18:50212671-50212693 CACTGTCCACACTCCCAGCCTGG - Intergenic
1159359867 18:67386124-67386146 CATGGTCCACACGCCCACTCAGG - Intergenic
1160033350 18:75281057-75281079 GAGGGTCCAGACGCCCTGCCTGG + Intronic
1160276491 18:77442504-77442526 CTGGGTTCCCTCGCCCTGCCAGG - Intergenic
1160645127 19:183700-183722 GTGAGTCACCACGCCCAGCCAGG + Intergenic
1160712161 19:557180-557202 CTGGGGCCCCACGCTCAGCAAGG - Intergenic
1160868785 19:1267725-1267747 CGGGCGCCACATGCCCAGCCTGG - Intronic
1161769710 19:6224476-6224498 CAGGGGACACACGCCCAGCTGGG + Intronic
1161770051 19:6226141-6226163 CTGGGCCCACACGCAGGGCCTGG + Intronic
1161887110 19:7005495-7005517 CAGGCTCCACACGCCCACCAGGG + Intergenic
1162094745 19:8303764-8303786 ATGTGTCCACGCCCCCAGCCTGG + Intronic
1162334224 19:10050261-10050283 CTGGGCCCACCTGCCCAGCCTGG - Intergenic
1162550529 19:11355719-11355741 CGGGGTCCCCTCCCCCAGCCCGG - Intronic
1162722531 19:12670813-12670835 CTGGCTCCACTCACCCTGCCAGG - Exonic
1162939167 19:13997722-13997744 CTGGGGCCACCCTCCCTGCCAGG + Intronic
1163633272 19:18427582-18427604 TCTGGTCCACATGCCCAGCCGGG + Intronic
1163722081 19:18903150-18903172 GTGGGGCCACACGCACACCCAGG + Intronic
1163849332 19:19654512-19654534 CTGGGGCCTCAGGCCCAGCAAGG - Intronic
1164619710 19:29687349-29687371 CTGGGGCCAGAGGCGCAGCCAGG + Intergenic
1164775196 19:30847627-30847649 CTGGGTCCCCACCTCCACCCTGG - Intergenic
1166026498 19:40090636-40090658 CTGCGTCCACACGCCCTCCCGGG + Intronic
1166666397 19:44682902-44682924 CTGGGGCCACACAGCCAGTCAGG + Intronic
1166669743 19:44702697-44702719 CTGGGTCCTGACTCCCAGTCTGG - Intronic
1167021548 19:46880149-46880171 CGTGAGCCACACGCCCAGCCAGG - Intergenic
1167366762 19:49058567-49058589 CTGGGTCCCCAGGCCCCGCAGGG + Exonic
1167558020 19:50207551-50207573 CTGGGTCCTCAGGCCCACTCGGG + Intronic
1168058222 19:53875387-53875409 CTGGGTCCCTAGGCCCCGCCTGG + Exonic
925409979 2:3634385-3634407 CTGGGTCCGCCCAGCCAGCCTGG - Intronic
925891708 2:8439793-8439815 CTGGGTCCATAGACCCAACCAGG + Intergenic
925906541 2:8543163-8543185 CTGGCTCCAGAGGCCCAGACAGG + Intergenic
926008713 2:9392135-9392157 GTGGGCCACCACGCCCAGCCTGG + Intronic
927043706 2:19255786-19255808 CTGGGTTCACATGGCCAGGCAGG - Intergenic
927119437 2:19941664-19941686 CTGGGTCCACACTGCTAACCAGG + Intronic
927671157 2:25069977-25069999 CTGAGCCCCCACACCCAGCCAGG + Intronic
928109924 2:28498355-28498377 CTGGGACCACACACCCACTCAGG + Intronic
929913484 2:46114089-46114111 TCGGGTCCAAAGGCCCAGCCTGG - Intronic
932998147 2:76882996-76883018 CTGGCTCCACTCTGCCAGCCAGG + Intronic
933161872 2:79034032-79034054 CTAGGTCCCCACCCCCAGACAGG - Intergenic
934773310 2:96921623-96921645 CTGTGTGCCCAGGCCCAGCCGGG - Exonic
938124316 2:128661003-128661025 CAGTGCCCACACGCCCAGCAAGG - Intergenic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
940612332 2:156006934-156006956 CTGGGTCCACAGCCCCAGCTTGG + Intergenic
942053589 2:172162837-172162859 CTGGGTCCACAGTCACAACCTGG + Intergenic
944189006 2:196981491-196981513 GTGGGCCACCACGCCCAGCCTGG - Intronic
944241557 2:197490546-197490568 CTGAGTCACCACGCCCGGCCAGG - Intronic
945338191 2:208617837-208617859 CTGGGTCTAGACACCCAGCAGGG + Intronic
946431041 2:219627614-219627636 CTGCGTCCGCCCGGCCAGCCCGG + Exonic
947327105 2:228991515-228991537 CTGGTTCCACCCACTCAGCCTGG + Intronic
947501796 2:230676331-230676353 CTGGGTCCCCACGCCTAGCCAGG + Intergenic
947711026 2:232315948-232315970 CAGGGTCCACCCTCCAAGCCCGG + Intronic
947922909 2:233893817-233893839 CAGGGTCCTCACTGCCAGCCAGG - Intergenic
1168849020 20:963995-964017 CTGCCTCCTCATGCCCAGCCCGG + Exonic
1169194025 20:3673855-3673877 CTCGGTCCACACCTCCAGGCCGG + Exonic
1169198732 20:3697393-3697415 AGGGGTCCAGCCGCCCAGCCTGG + Intronic
1170856587 20:20061890-20061912 CTGGGTACTCACTCCCAGCTAGG + Intronic
1172167500 20:32907974-32907996 CTGGGTACAAAAGCCAAGCCAGG - Intronic
1172547363 20:35772214-35772236 CTGGCCCCGCTCGCCCAGCCTGG + Intronic
1172837269 20:37881094-37881116 ACGGGTCCACGTGCCCAGCCCGG - Intergenic
1173662835 20:44745936-44745958 CAGGGTGCACAGGACCAGCCCGG - Exonic
1174414978 20:50360438-50360460 CTGTGCCCCCAGGCCCAGCCTGG + Intergenic
1175490625 20:59378708-59378730 CTGGCTTCAAACCCCCAGCCAGG - Intergenic
1175822004 20:61915063-61915085 CTTGGTCCTCACGCCCACCAAGG + Intronic
1176048577 20:63104964-63104986 CTGGGGCCACACGCTCCTCCTGG + Intergenic
1176050380 20:63116210-63116232 ATGTGACCACACGCCCAGTCCGG + Intergenic
1180223724 21:46376478-46376500 CGGGCTCCTCAGGCCCAGCCAGG - Intronic
1180968219 22:19801432-19801454 CTGGAGCCACAGGCCCAGACAGG + Intronic
1181279563 22:21709491-21709513 GTGAGTCACCACGCCCAGCCAGG - Intronic
1181314361 22:21962075-21962097 CTGAGTCCACACAGCCAGCCTGG - Intronic
1182146325 22:27998972-27998994 CTTGGTCCTCACGCCCAGCATGG - Exonic
1182809697 22:33105429-33105451 CGGGGCCCACCCGCCCAGGCTGG + Intergenic
1183346192 22:37309736-37309758 CTGAGGCCACACAGCCAGCCAGG + Intronic
1184232573 22:43166573-43166595 CTGGAGCCACAGGCTCAGCCTGG - Intergenic
1184442355 22:44525035-44525057 CTGAGCCCCGACGCCCAGCCAGG + Intergenic
1185338640 22:50282006-50282028 CTGGCTCCTCAGGCACAGCCGGG + Exonic
949158839 3:857197-857219 CTGAGTCCATTCGCACAGCCTGG - Intergenic
949366520 3:3287333-3287355 CTGACTCCACCCTCCCAGCCTGG - Intergenic
950033030 3:9864360-9864382 CTGGGGCCCCCCGCACAGCCAGG - Intergenic
950051370 3:9992406-9992428 GTGAGCCCCCACGCCCAGCCTGG + Intronic
950300184 3:11869986-11870008 GTGAGCCCCCACGCCCAGCCTGG + Intergenic
950635099 3:14308634-14308656 CTGGGCCCCCAGTCCCAGCCTGG - Intergenic
951566058 3:24013599-24013621 ATGGGCCACCACGCCCAGCCAGG - Intergenic
952252334 3:31666498-31666520 CTGTGTTCACTCTCCCAGCCGGG - Intronic
952867574 3:37864045-37864067 CTGAGGGCACACACCCAGCCAGG - Intronic
953724879 3:45388975-45388997 CTGGGTCCAAACCCCTAGTCCGG - Intronic
954286987 3:49626096-49626118 CTGGGTCCACAGCCCCAGCCTGG + Intronic
957654537 3:83058171-83058193 ATGGGTCCCCACTCCCAGGCTGG + Intergenic
958498500 3:94875274-94875296 CCGGGTCCACAGCCCCAGCTGGG + Intergenic
958892400 3:99795549-99795571 CTTGGTCCTCAAGGCCAGCCTGG + Exonic
960974158 3:123159208-123159230 CTGAGGCCCCATGCCCAGCCCGG - Intronic
960994559 3:123332379-123332401 CTGTGTCCTCACGCCCTGCGTGG - Intronic
961173027 3:124812572-124812594 CTGGGTCCACACGTGCAGAGGGG - Intronic
961452944 3:127010634-127010656 CTGGGCCCACACGCTCACACTGG + Intronic
962249900 3:133829459-133829481 CTGGTTCCAAATGCACAGCCAGG + Intronic
962719370 3:138158608-138158630 CTGAGCCACCACGCCCAGCCCGG - Intergenic
963384710 3:144576734-144576756 CTGAGGCATCACGCCCAGCCAGG - Intergenic
963620586 3:147600387-147600409 GTGAGCCCCCACGCCCAGCCAGG + Intergenic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
966788258 3:183639721-183639743 GTGAGTCACCACGCCCAGCCCGG - Intronic
968446401 4:654368-654390 GTGGGTCTTCACGACCAGCCTGG - Intronic
968524830 4:1050977-1050999 CTGGGGCAACAAACCCAGCCGGG + Intergenic
968621942 4:1607642-1607664 CTGGCTTCACCCGCCCAGTCCGG + Intergenic
968996106 4:3946745-3946767 TTGAGTCCCCACGCCCACCCGGG - Intergenic
969065547 4:4477470-4477492 CTGGGACCTCACTCCCAGTCAGG + Intronic
969180439 4:5436554-5436576 CTGGGTCCAGAGGCCCAGCTGGG + Intronic
969488489 4:7485651-7485673 CTGGGTCCACACGGCCTGGCCGG - Intronic
969524587 4:7697722-7697744 CTGTGTCCACAGCCCCTGCCAGG - Intronic
969757878 4:9161953-9161975 GTGAGCCCACACGCCCACCCGGG + Intergenic
971414797 4:26414449-26414471 ATGGGTCACCGCGCCCAGCCTGG + Intronic
972295321 4:37732311-37732333 CTGAGTCACCATGCCCAGCCTGG - Intergenic
977317173 4:95465017-95465039 CTGGGGACACACGTTCAGCCTGG - Intronic
980731035 4:136824304-136824326 CTGGGTCAACAGCCCCAGCTTGG + Intergenic
981527585 4:145721483-145721505 CTGAGTCCAGAGGCCCATCCCGG - Intronic
984905340 4:184621042-184621064 CTGAGTCGCCACGTCCAGCCTGG - Intergenic
985577187 5:678843-678865 CTGCGTCCCCAAGCCCTGCCTGG - Intronic
985592104 5:770893-770915 CTGCGTCCCCAAGCCCTGCCTGG - Intergenic
985688377 5:1294089-1294111 CTCGGTCCACGCGTCCTGCCCGG + Exonic
985836700 5:2277139-2277161 CAGGGTGCACACACTCAGCCAGG - Intergenic
985851762 5:2393611-2393633 CTGGGTCAGCAGGCACAGCCAGG - Intergenic
988925908 5:35991022-35991044 CCAGGTCCGCAAGCCCAGCCTGG + Intronic
988934231 5:36066571-36066593 CCGGGTCCGCAAGCCCAGCCTGG + Intronic
988940302 5:36139080-36139102 CTGGGTCCACAGCCACAGCTGGG - Intronic
988951555 5:36267037-36267059 ATGAGCCAACACGCCCAGCCAGG + Intronic
989695097 5:44190943-44190965 CTGGGTCCACAGACTCACCCAGG - Intergenic
990638097 5:57751434-57751456 GTGAGTCACCACGCCCAGCCTGG - Intergenic
992494858 5:77282213-77282235 CTGGGACCACAGGGCCAGGCTGG - Intronic
993186928 5:84634331-84634353 CTGGTTCCACCCACTCAGCCTGG + Intergenic
995693857 5:114857975-114857997 CTGCTTCCAGACGGCCAGCCGGG + Intergenic
997346536 5:133196315-133196337 CCGGGTCCAAAAGCCCACCCAGG - Intergenic
997626964 5:135337693-135337715 CTGGGTCCACCCTGCCAGCTTGG - Intronic
998132584 5:139658889-139658911 CTGGGTTCAAACGCCCAGCTAGG - Intronic
998503353 5:142652658-142652680 CTGGGCCCACACGTGCAGCCTGG + Intronic
999295547 5:150457583-150457605 CTGGGTCCTCAAGCTCAACCTGG + Intergenic
1001461883 5:171923193-171923215 CTGAGTCACCACACCCAGCCTGG + Intronic
1002101447 5:176860084-176860106 CTGCCCCCACACGCCCAGCCAGG + Intronic
1002494844 5:179604697-179604719 CTGAGCCCCCACGCCCAGCCTGG - Intronic
1003633220 6:7807559-7807581 CTGAGCCCACGCGCCCGGCCGGG + Intronic
1006239557 6:32665302-32665324 CTGGGTTCACAGGCTCAGGCAGG - Intronic
1006920646 6:37625160-37625182 CTCGGTGCCCACGCCCTGCCGGG + Intergenic
1009428365 6:63539633-63539655 CTGGGACTACAGGCACAGCCTGG - Intronic
1012952752 6:105536195-105536217 CTGCCACCACAGGCCCAGCCTGG + Intergenic
1014147271 6:118012501-118012523 TTGGGTCCACACACCAAGCATGG - Intronic
1015721795 6:136250191-136250213 CTGGAGCCTCACGCTCAGCCAGG + Exonic
1018428046 6:163700882-163700904 CTGGGCCCACAGGCTCAGCCGGG - Intergenic
1018677507 6:166235837-166235859 CTGGCTGCAGACGGCCAGCCTGG + Intergenic
1019325274 7:435132-435154 CTGGGGCCACTCGCCCTGCACGG - Intergenic
1019689979 7:2404921-2404943 CTGGGAGCTCACGGCCAGCCTGG + Intronic
1019925837 7:4191306-4191328 CAGGCTTCACACGCACAGCCCGG + Intronic
1020276583 7:6628315-6628337 CGGGGTGCACAGGCCCAGGCAGG - Intergenic
1020320382 7:6935155-6935177 CTGAGCCCCCACGCCCACCCGGG - Intergenic
1024558961 7:50627859-50627881 CAGGCTCCACACAGCCAGCCTGG - Intronic
1025615384 7:63113076-63113098 CTGGGTCTACCCGGCCAGGCGGG + Intergenic
1025973876 7:66354201-66354223 CTGGGACATCATGCCCAGCCTGG - Intronic
1026592760 7:71711053-71711075 TTGGGTCCACAAGCCCAGCCCGG - Intronic
1032429038 7:131846050-131846072 CTCCGTCCACTGGCCCAGCCTGG - Intergenic
1032451962 7:132039448-132039470 CTGGGTCTACTTCCCCAGCCAGG + Intergenic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1035053985 7:156021668-156021690 CTGCTGCCACACGCCCTGCCCGG + Intergenic
1035234085 7:157485022-157485044 CTGAGTCCACACATGCAGCCAGG + Intergenic
1036159905 8:6377723-6377745 ATGGGCCACCACGCCCAGCCAGG + Intergenic
1037882955 8:22581745-22581767 CTGTGACTGCACGCCCAGCCTGG - Intronic
1039947145 8:42140067-42140089 CTGGGCCCAGACGCGCAGGCCGG - Intergenic
1039959005 8:42230589-42230611 CTGAGCCACCACGCCCAGCCTGG - Intergenic
1039981161 8:42410958-42410980 CGGGGTCCCCACTCCAAGCCCGG + Intergenic
1041287982 8:56280442-56280464 CTGGATCCACAAGTCCACCCAGG - Intergenic
1043758053 8:84029513-84029535 CAGTGTGCACACACCCAGCCAGG - Intergenic
1048264209 8:132971225-132971247 CTGGGTCAGCCCACCCAGCCAGG - Intronic
1049073967 8:140379156-140379178 CTGGGGCCACAGGGCCTGCCCGG + Intronic
1049207922 8:141372005-141372027 CTGGGTCTCCAGGCCCACCCAGG + Intergenic
1049423247 8:142526057-142526079 CTGGGTGCAGGCGCCCAGCCAGG + Intronic
1049455168 8:142682961-142682983 CTGGGTCCATCCTCCCAGCAAGG - Intergenic
1049613405 8:143566282-143566304 CTGGGACCACTTGCCCAGACTGG - Exonic
1049854484 8:144852912-144852934 CTAGGCCCACACCCCCAGCTCGG + Intronic
1051029720 9:12658969-12658991 CTGGGTCCACAACCACAGCTGGG + Intergenic
1052972634 9:34386311-34386333 GTGAGTCACCACGCCCAGCCGGG - Intronic
1058768868 9:108210821-108210843 GTGGGTCACCACGCCCGGCCCGG + Intergenic
1058937915 9:109786170-109786192 CTGGCCCCACACTCCAAGCCTGG - Intronic
1059401120 9:114071168-114071190 CTGGGTCCACAGCCACAGCAGGG - Intronic
1059912479 9:119060774-119060796 CTGGGACTACAGGCCCACCCGGG - Intergenic
1060664690 9:125425717-125425739 ATGGGGCAAGACGCCCAGCCGGG + Intergenic
1060749262 9:126158145-126158167 CTAGGTCCCTAAGCCCAGCCAGG + Intergenic
1061623213 9:131824978-131825000 CTGGGCCCACACCCCGACCCAGG + Intergenic
1061677108 9:132223695-132223717 CTGGGCCCACCCGTCCCGCCTGG - Intronic
1062118373 9:134821201-134821223 CAGGGTCCCCACGGCCAGCGGGG + Intronic
1062162696 9:135088622-135088644 CTGGGGCCCCACTCCCAGCCCGG - Intronic
1062384627 9:136304262-136304284 CTGACCCCACAAGCCCAGCCCGG - Intronic
1062429515 9:136520825-136520847 CTGGGGTCGCAGGCCCAGCCAGG - Intronic
1062756201 9:138293882-138293904 GTGAGTCACCACGCCCAGCCAGG - Intergenic
1185505357 X:629679-629701 CTGGGTCCCCAGGCCCCGCCGGG + Intronic
1185652381 X:1657782-1657804 CTGGGTCCAGACGGCCAGCGGGG - Intergenic
1185886780 X:3790194-3790216 CTGTGTACACCCGCCCAGCAGGG - Intergenic
1186805989 X:13140313-13140335 CTTGGTTCACACTACCAGCCTGG - Intergenic
1188207678 X:27380440-27380462 CTGGGTCCACAGCCACAGCTTGG - Intergenic
1190298011 X:49039882-49039904 CTGGGACCAGAGGCCCAGGCAGG - Intronic
1190360427 X:49644124-49644146 CTGGTTCCACCCACTCAGCCTGG + Intergenic
1190878360 X:54475397-54475419 TTGGGTCCACCCGCCCCTCCTGG - Intronic
1191171684 X:57453895-57453917 CTTGTTCCACAGGGCCAGCCTGG + Intronic
1192204686 X:69088208-69088230 CTGGGGCCAGAAGTCCAGCCTGG + Intergenic
1192466186 X:71357987-71358009 CAGGGTTCACATGCCCAACCTGG - Intergenic
1192905166 X:75543779-75543801 CTGGGTCTAAACACCCAGCAGGG + Intergenic
1194438993 X:93906202-93906224 CTGGGTCCAGCCACCCAGCGAGG + Intergenic
1195176752 X:102320414-102320436 CTCGGTCCCCAGGGCCAGCCAGG + Intronic
1195182112 X:102366679-102366701 CTCGGTCCCCAGGGCCAGCCAGG - Intronic
1201226595 Y:11824594-11824616 GTGCGTCACCACGCCCAGCCTGG - Intergenic