ID: 902984679

View in Genome Browser
Species Human (GRCh38)
Location 1:20148396-20148418
Sequence CTCAAACCTCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 171}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902984679_902984688 6 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984688 1:20148425-20148447 AGCGGGAGGAGGGTCTGGCTTGG 0: 1
1: 0
2: 1
3: 26
4: 384
902984679_902984690 8 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984690 1:20148427-20148449 CGGGAGGAGGGTCTGGCTTGGGG 0: 1
1: 0
2: 2
3: 24
4: 286
902984679_902984685 -5 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984685 1:20148414-20148436 TTGAGAGAGAGAGCGGGAGGAGG 0: 1
1: 1
2: 19
3: 240
4: 2210
902984679_902984694 29 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984694 1:20148448-20148470 GGACCAGACGAGGTGCAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 203
902984679_902984684 -8 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984684 1:20148411-20148433 GGTTTGAGAGAGAGAGCGGGAGG 0: 1
1: 0
2: 5
3: 57
4: 655
902984679_902984689 7 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984689 1:20148426-20148448 GCGGGAGGAGGGTCTGGCTTGGG 0: 1
1: 0
2: 2
3: 26
4: 326
902984679_902984693 26 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984693 1:20148445-20148467 TGGGGACCAGACGAGGTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 167
902984679_902984687 1 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984687 1:20148420-20148442 GAGAGAGCGGGAGGAGGGTCTGG 0: 1
1: 0
2: 5
3: 104
4: 1131
902984679_902984695 30 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984695 1:20148449-20148471 GACCAGACGAGGTGCAGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 182
902984679_902984691 19 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984691 1:20148438-20148460 TCTGGCTTGGGGACCAGACGAGG 0: 1
1: 0
2: 0
3: 10
4: 146
902984679_902984692 25 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984692 1:20148444-20148466 TTGGGGACCAGACGAGGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 121
902984679_902984686 -4 Left 902984679 1:20148396-20148418 CCCTAGAGCCTCTGAGGTTTGAG 0: 1
1: 0
2: 3
3: 14
4: 171
Right 902984686 1:20148415-20148437 TGAGAGAGAGAGCGGGAGGAGGG 0: 1
1: 2
2: 65
3: 1317
4: 7216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902984679 Original CRISPR CTCAAACCTCAGAGGCTCTA GGG (reversed) Exonic
900459474 1:2795527-2795549 CCCAAGCCTCAGAGGCCCCACGG - Intronic
900567773 1:3342317-3342339 CTCAAACCTGAGAAGCCCTCTGG + Intronic
900602661 1:3509713-3509735 AACACACCTCAGAGGCTCTTGGG - Intronic
902138547 1:14332446-14332468 GTCAAACATCAGAGCCTCTGAGG - Intergenic
902984679 1:20148396-20148418 CTCAAACCTCAGAGGCTCTAGGG - Exonic
903681415 1:25099872-25099894 CCCAAACCTCAGAGACTCTGGGG - Intergenic
904767669 1:32862827-32862849 CTCACACCACTCAGGCTCTAAGG + Exonic
908441748 1:64162185-64162207 TTCAAAAGTCAGAGACTCTAGGG + Intronic
911127453 1:94353688-94353710 CTCAAAACTCCTAGGCTCAAAGG + Intergenic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
914840920 1:151248060-151248082 CTCAACTCTCTGAGGCACTAAGG - Intronic
915601301 1:156924595-156924617 CTCAGACCTGGGAGGCTCCAGGG - Intronic
916321128 1:163505384-163505406 CACAAACCTCAGAAGCTTTATGG + Intergenic
916340185 1:163724883-163724905 CTCAGACCACAGGGACTCTAAGG + Intergenic
918443164 1:184588943-184588965 CCCAAACAACAGAGGCTCAATGG - Intronic
919425478 1:197425133-197425155 TTCAAACCTCAGGGGCTTCAAGG + Intronic
919702056 1:200641014-200641036 CAATGACCTCAGAGGCTCTAGGG - Intronic
919705803 1:200674235-200674257 GTCAAACCTCAGAGCCACTCAGG + Intergenic
924341537 1:243039849-243039871 CTCAAACCTCATCAGCACTAAGG - Intergenic
1071606327 10:86994299-86994321 CTCAAAACTCCTAGGCTCAAGGG + Intergenic
1072566070 10:96617748-96617770 ATCAGACCTCAGAGTCTCTTTGG - Intronic
1074537149 10:114336678-114336700 CCCCACCCTCAGAGGCTCCAGGG - Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075423914 10:122327186-122327208 CTGAAATCTCAAAGGATCTAAGG - Intronic
1076136530 10:128049039-128049061 CTCAAACCCCATAAGCTCCAAGG - Intronic
1078362578 11:10680591-10680613 CTCTAACCTAAGAGGGTTTAGGG - Intronic
1079851364 11:25539984-25540006 TTCAAACCTCAGAGTCCCTGAGG - Intergenic
1080361140 11:31515578-31515600 CTCGAACCTCCCAGGCTCAAGGG - Intronic
1084685756 11:70694195-70694217 GTCAAACAGCAGAGGCCCTAAGG - Intronic
1086077561 11:82870694-82870716 CTCCAACCTCAGGAGCTTTATGG - Intronic
1087370121 11:97273622-97273644 CACTAACCTCAGGGCCTCTAAGG - Intergenic
1087542498 11:99537979-99538001 CTGAATTCTCAGAGTCTCTAAGG - Intronic
1088633443 11:111796401-111796423 TTCAAACCTGAGAGCTTCTATGG + Intronic
1089047443 11:115515277-115515299 CTCAGCCTCCAGAGGCTCTATGG - Intergenic
1092216310 12:6685881-6685903 CTCAAATCTCAGAAGCCCTCAGG + Intronic
1093373896 12:18399811-18399833 CTCAACCTTTAGAGGCTCTTGGG + Exonic
1095375751 12:41526339-41526361 CTCCAAGCTCAGAGACTCTCTGG + Intronic
1095522387 12:43082957-43082979 CTCAAATCTCAGTGGCTTAATGG - Intergenic
1096109720 12:49021495-49021517 CTCAAACCTGAGATGCCCAATGG + Exonic
1101297664 12:103441155-103441177 CTCAAACCTCATGGGCTGTTTGG - Intronic
1107118587 13:36774154-36774176 CTTCAAACTCAAAGGCTCTAAGG + Intergenic
1107253563 13:38395089-38395111 CTCAAACCCCAGTGACTCAAAGG - Intergenic
1107710030 13:43142479-43142501 GTCCAACCTCAGAGGCTCCGTGG + Intergenic
1107710520 13:43146263-43146285 CTCAAACCTAACAGGCAGTAAGG + Intergenic
1107915902 13:45150625-45150647 CTCAGACCTCAGAGATTTTAGGG + Intronic
1110384095 13:74888432-74888454 CACAAATGTCATAGGCTCTAGGG + Intergenic
1112280588 13:98059549-98059571 CTCAAGCCTCAGGGGTTCTCTGG - Intergenic
1112371822 13:98800767-98800789 TTCAAACCTCAGAGCTTCCAAGG - Intronic
1113483021 13:110635461-110635483 GTCATAGCTCAGAGGCCCTATGG + Exonic
1113629465 13:111872368-111872390 CTCAGACCTCTGAGGAGCTAAGG + Intergenic
1114485803 14:23061035-23061057 CTCAAGCCTCAGTGCCACTAGGG + Intronic
1114662614 14:24357483-24357505 CCAAAACCTCAGAGGATGTATGG + Intergenic
1114674455 14:24431068-24431090 CTCAAAACTCAGGGGCACTGAGG - Intronic
1116242817 14:42367739-42367761 CTTATACCTCAGAGGGTCCATGG + Intergenic
1116699147 14:48216367-48216389 TTAAAACCTAAGAGGCTCCAGGG - Intergenic
1117791304 14:59344728-59344750 CTCAACCCCCAGAGGCTGTCTGG - Intronic
1117968547 14:61230171-61230193 CTTAAACCTTAGAGGCTGTGTGG + Intronic
1118321605 14:64756802-64756824 CACAACCCTCAGGGGCGCTAAGG - Intronic
1119859258 14:77924631-77924653 CTCTAACCCCAGAGGCCCCAGGG - Intronic
1124166058 15:27326945-27326967 CTAAAACCGCAGAGGCTCACTGG + Exonic
1125769147 15:42153574-42153596 CTCAAATCTCTGAGTCTCTGAGG + Intronic
1127313459 15:57772642-57772664 CTCAAACTTCAGTGTCTATACGG + Intronic
1130666131 15:85871613-85871635 CTCAGAGCTCAGAGGGTCCAAGG - Intergenic
1131115607 15:89793184-89793206 CCCCAACATCAGAGGCTCTGTGG - Intronic
1135610107 16:23859045-23859067 CTCAACCCTCACAAGCTCAAGGG - Intronic
1136189302 16:28606306-28606328 CTCTAACCTCAGAGGCGATCTGG + Intronic
1137979143 16:53055104-53055126 CCCCGACCTCAGAGGCTCCAGGG - Intronic
1139046716 16:63069644-63069666 CTCAAACCTTAAAAGCTCTAGGG - Intergenic
1139709333 16:68763829-68763851 CTTAAACATCAGAATCTCTAGGG - Intronic
1140455849 16:75105150-75105172 CTCCAACCTGTGAGGCTCTACGG - Intronic
1141450550 16:84097892-84097914 GCAAAACCTCAGAGGCTCTTAGG + Intronic
1141945301 16:87305340-87305362 CTCAGAGCTCAGAGGCTGGAGGG + Intronic
1143003051 17:3807715-3807737 CTCCATCCTCTGAGGCTCTGGGG - Intergenic
1146807598 17:35877834-35877856 CCTAAACCTCAGAGGAACTAGGG - Intronic
1147283211 17:39379694-39379716 CTCAAACTCCTGAGGCTCAAGGG - Intronic
1148450665 17:47775825-47775847 CTCAAAGCTCAGAGACTCTCAGG - Intergenic
1150961145 17:69913732-69913754 CTGAAACATCAGAGGCTTAATGG - Intergenic
1151636601 17:75353383-75353405 CTCAAACCTCTGTTGCTCAAGGG + Intronic
1151752185 17:76045767-76045789 CTCAGGTCTCAGATGCTCTATGG + Intronic
1152981784 18:284726-284748 CTGAACCCTCAGAGTCTCTGAGG + Intergenic
1153655857 18:7281605-7281627 CTCAACCTTCAGAGGTTCTAGGG + Intergenic
1154281233 18:13005055-13005077 TTCAAAGCTGTGAGGCTCTAGGG + Intronic
1155420136 18:25646944-25646966 CAAACAACTCAGAGGCTCTATGG - Intergenic
1160383135 18:78475927-78475949 ATCAAACCTCAGGGAATCTATGG + Intergenic
1162810212 19:13159777-13159799 CTCAAACCTCAGATGGTTGAGGG + Intergenic
1163282894 19:16327868-16327890 CTAAAACCTCAGAGGCTTCCAGG - Exonic
1164548232 19:29186520-29186542 CTCAAATCCCAGAGGCACTAAGG - Intergenic
1166473414 19:43099804-43099826 CTCTAACCTCAGAGCCACTGGGG + Intronic
925284398 2:2706325-2706347 ATCAAAGCTCAGAGGCTGTGTGG - Intergenic
926879959 2:17534093-17534115 CTCAAAACTCAGAGGCATCAAGG - Intergenic
929223008 2:39484722-39484744 CTAAAACTTCAGTGGCCCTAGGG - Intergenic
932166504 2:69512648-69512670 GTCAAAGCTGAGAAGCTCTATGG + Intronic
932463468 2:71898144-71898166 CTCCAAGCACAAAGGCTCTAGGG - Intergenic
933879455 2:86654879-86654901 CTCTACCCTCAGAGACTCTGAGG + Intronic
936677220 2:114729384-114729406 CTGAAACCTCTGAGCCTCTTCGG + Intronic
939418222 2:141929007-141929029 ATCAAACCACAGACCCTCTAAGG - Intronic
940594472 2:155772189-155772211 TTCAAACCCCAGAGGATCCAGGG - Intergenic
943040792 2:182802582-182802604 CTCAAACATCAGCAGCTCCAAGG - Intergenic
946024219 2:216662079-216662101 CTCAGACCTCAGAGGATCATAGG - Intronic
946497175 2:220206219-220206241 AACAAACCCTAGAGGCTCTATGG - Intergenic
947533527 2:230927370-230927392 CTCAAACCTTTGAGTCTCTCTGG - Intronic
947747035 2:232513139-232513161 CTCCAACCTCAGAGGCTCTGAGG + Intergenic
949083857 2:242130382-242130404 CTCAAACCTCATCAGCACTAAGG + Intergenic
1168789030 20:563646-563668 CTCTCCCCTCAGTGGCTCTAGGG - Intergenic
1169285883 20:4306772-4306794 CTCCAAGCTCCGAGGCTCTGGGG + Intergenic
1169532330 20:6499155-6499177 CTCAAACCTCCTAGGTTCTTTGG + Intergenic
1172319247 20:33983401-33983423 CTCAACACTCAGAGTCCCTAAGG - Intergenic
1176280439 20:64302903-64302925 CTCAAACCTCATCAGCACTAAGG + Intergenic
1179262612 21:39771816-39771838 CTCAAAGCTCACAGGCGCTATGG - Intronic
949112946 3:284783-284805 CTCCAACCTCAGTAGATCTAAGG + Intronic
950985935 3:17366205-17366227 CTCCAACCTCCCAGGCTCAAGGG - Intronic
952347241 3:32499880-32499902 TTCAAACCTCTGAGGCTCCATGG - Intronic
954092288 3:48294789-48294811 CTGAAACCACAGAGTCTGTAAGG + Exonic
954317366 3:49808389-49808411 CTCAAACATCAGAGGCTTCAGGG + Exonic
954638215 3:52083105-52083127 CACATACCTCAGAGGAGCTAAGG - Intronic
954690917 3:52395174-52395196 CTGGAACCTCAGAGCCTTTAGGG - Intronic
955124652 3:56099210-56099232 CACACCCCACAGAGGCTCTAAGG - Intronic
955209779 3:56929887-56929909 TTTATACCTCAGAGGATCTAGGG - Intronic
956718853 3:72100787-72100809 CTCAAACCCCAGAGTCCCTCCGG - Intergenic
956958291 3:74367516-74367538 CTCAAACCTCACTGGCTACATGG - Intronic
959397633 3:105860903-105860925 TTCAAACCCAAGAGGCTCTCAGG + Intronic
960416916 3:117396535-117396557 CTCCCACCTCAGAGCCTCTGTGG + Intergenic
961211920 3:125132030-125132052 CACAAACCTGAAAGGCCCTATGG + Intronic
961575540 3:127833085-127833107 CTCAACCCTCAGAGGATCTCTGG - Intergenic
963188262 3:142441825-142441847 CTCAAACCTAAGCCGCTCGAGGG + Intronic
965810926 3:172591479-172591501 TTCAAAACTGAGAGGCTTTAGGG + Intergenic
969656944 4:8504063-8504085 CACCAACCTCAGAGGCTCAGAGG - Intergenic
973610576 4:52632600-52632622 CTCGAACCACTGAGGCTCAAGGG - Intronic
977391596 4:96416340-96416362 AGCACACCTCAGAGGCTCTAAGG - Intergenic
977437926 4:97023627-97023649 CTCAAACCTCACCTGATCTATGG + Intergenic
977749887 4:100596596-100596618 CTCATACCTCAGTGGCACCAGGG - Intronic
980628437 4:135405844-135405866 CTCAACCATCAAAGGCTGTAGGG + Intergenic
981394730 4:144234209-144234231 TTCAAGGCTCAGAGGCTCTTTGG - Intergenic
984329179 4:178293324-178293346 CTAAAACCTCAGAGTTTTTAAGG + Intergenic
984724040 4:183002944-183002966 CTCAAACCTATGCTGCTCTAGGG + Intergenic
986630598 5:9768347-9768369 TTCAAAACTGAGAGGCTTTAGGG - Intergenic
988677959 5:33453372-33453394 CTCAAACTTGAGAAGCTCCAAGG - Exonic
990278750 5:54227405-54227427 CTTAATCCTCACAGGCTCTCTGG + Intronic
990458382 5:56010928-56010950 ATCAAAGCTCAGAGACACTAGGG + Intergenic
993057773 5:83001997-83002019 CTCAAGCCTCAGAGGAACTGGGG + Intergenic
994518214 5:100796173-100796195 CTTAAACTTCAAAGGCTGTAGGG - Intergenic
997956565 5:138283206-138283228 CTCAAAGCCCAGAAGGTCTAGGG - Intergenic
999015684 5:148101925-148101947 CTCAATCCTCAGACGCTATGGGG - Intronic
1000919573 5:167122176-167122198 CTCAAAAATCAAAGGTTCTAGGG - Intergenic
1001889805 5:175329397-175329419 CTGAAAACTCAGAGGCCCCAGGG + Intergenic
1003606887 6:7570421-7570443 CTCAATCCTAAGAGGCACAAAGG - Exonic
1004170615 6:13292945-13292967 CTCAAACCTGCGATGCTGTAGGG - Intronic
1006438632 6:34040010-34040032 CCCAGACCTCAGCGGCTCTGAGG - Intronic
1011034597 6:82959465-82959487 GTTAGACCTCAGAGGCTGTAGGG - Intronic
1012959052 6:105603184-105603206 CCCAGACCTCAGACGCTCGACGG + Intergenic
1014046655 6:116896628-116896650 CTGCAACCTCCGAGCCTCTAGGG - Intronic
1016181932 6:141157245-141157267 CTCCAACCTCAGTGGTTCTCAGG - Intergenic
1017792488 6:157813546-157813568 CTCATTCCTCAGAGGGTCTCAGG + Intronic
1019236100 6:170614049-170614071 CTCAAACCTCATCAGCACTAAGG + Intergenic
1022312397 7:29209269-29209291 CTCAGCCCTTAGAGTCTCTAAGG + Intronic
1027840715 7:83307801-83307823 CTCAAACCTCAGATTCTCATGGG + Intergenic
1029123751 7:98284087-98284109 CTCGGCCCTCAGAGGCTGTAGGG + Intronic
1029210737 7:98906240-98906262 CTCATACCTTAGAGTCTCTCTGG - Exonic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1030953052 7:115816715-115816737 CTCAAACCTCATAGGGTCAGAGG + Intergenic
1032005880 7:128301672-128301694 CTCAAACCCCAGAGGCTCTGTGG + Exonic
1032445177 7:131976215-131976237 ATCAGACCTCAGAGTATCTATGG + Intergenic
1034277962 7:149832020-149832042 CTCAACCCTCGGCCGCTCTACGG + Intergenic
1034764018 7:153700666-153700688 CTCACACCTCACAGGCTGCAAGG + Intergenic
1036577409 8:10040894-10040916 CTCAAACATCACAGCCTCTCAGG + Intergenic
1040016789 8:42706631-42706653 CTGGAACCCCACAGGCTCTAGGG - Intronic
1041768789 8:61450088-61450110 CTCTCATCTCAGAGGCTCTATGG + Intronic
1043242439 8:77952287-77952309 CTCATGCCACAGAGGCTGTATGG + Intergenic
1043575486 8:81651629-81651651 AACAAACCTCAGAGGGTCTTAGG - Intergenic
1045476388 8:102556372-102556394 CTGAAACCTCTGAAACTCTAGGG + Intronic
1047733029 8:127741906-127741928 CGCAAACCCCAGAGGATCTCTGG + Intergenic
1049012368 8:139895694-139895716 GTCAGAACTGAGAGGCTCTAGGG + Intronic
1050697667 9:8297345-8297367 GCCAAACCTAAGAGGCTCAATGG + Intergenic
1050698648 9:8309756-8309778 GTCAGACCTCAGAGGATCTTGGG - Intergenic
1055529742 9:77171970-77171992 CTCAGAACTCAGAGGCACAAGGG - Intergenic
1058624905 9:106924863-106924885 CTCCAACTTCAGGGGCTCCATGG + Exonic
1059248266 9:112866592-112866614 CTCTAACCTCAGAGTCACCAAGG + Intronic
1060345408 9:122811563-122811585 CTCAAACCTCACATCCTCTCTGG - Intronic
1060892608 9:127198333-127198355 CTCAGACCTCAGAGGCTCTGAGG - Intronic
1061363475 9:130158125-130158147 CTCCAACCACCCAGGCTCTAGGG - Intergenic
1062484427 9:136767895-136767917 CCCAGCCCTCACAGGCTCTAGGG - Intergenic
1190284125 X:48950962-48950984 CTCACACCTGTGAGGCACTAGGG - Intronic
1190988284 X:55520819-55520841 CTGAAACCACTGAGGATCTAGGG + Intergenic
1193604544 X:83548755-83548777 CTCTACCCTCAGAGACTCTGAGG - Intergenic
1194219719 X:91175922-91175944 CTGATCCCTCAGAGTCTCTAGGG - Intergenic
1198642210 X:138768882-138768904 CTCTTCCCTCAGAGGCTCTAGGG - Intronic
1198740006 X:139832147-139832169 TACAAACCTCAGAGGCTGGAGGG + Exonic
1200556230 Y:4639686-4639708 CTGATCCCTCAGAGTCTCTAGGG - Intergenic
1201924098 Y:19266115-19266137 CTCCATCCTCAGAGGATGTATGG - Intergenic