ID: 902986628

View in Genome Browser
Species Human (GRCh38)
Location 1:20158454-20158476
Sequence AAAGGCCCATTGAAATCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902986623_902986628 5 Left 902986623 1:20158426-20158448 CCAAGTGCATGGGGCATTATATA 0: 1
1: 17
2: 13
3: 13
4: 87
Right 902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG 0: 1
1: 0
2: 2
3: 56
4: 165
902986621_902986628 9 Left 902986621 1:20158422-20158444 CCCTCCAAGTGCATGGGGCATTA 0: 4
1: 14
2: 18
3: 31
4: 109
Right 902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG 0: 1
1: 0
2: 2
3: 56
4: 165
902986622_902986628 8 Left 902986622 1:20158423-20158445 CCTCCAAGTGCATGGGGCATTAT 0: 4
1: 15
2: 20
3: 28
4: 107
Right 902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG 0: 1
1: 0
2: 2
3: 56
4: 165
902986617_902986628 18 Left 902986617 1:20158413-20158435 CCTTCTTAACCCTCCAAGTGCAT No data
Right 902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG 0: 1
1: 0
2: 2
3: 56
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902986628 Original CRISPR AAAGGCCCATTGAAATCTGG GGG Intergenic
902667678 1:17951039-17951061 AAAGTCACCTTGACATCTGGAGG + Intergenic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
902989372 1:20175515-20175537 AAAGGCCTGATGACATCTGGAGG - Intronic
905374930 1:37514059-37514081 CAAGGCCCAATGCACTCTGGTGG - Intronic
906675851 1:47693239-47693261 ACAGCCCCATTGAAAGTTGGTGG + Intergenic
907024677 1:51104649-51104671 AAGGGCCAATTGTAAGCTGGAGG + Intronic
910373966 1:86549252-86549274 AAGAGCCCATTGAAAACTAGGGG + Intronic
910495211 1:87819160-87819182 AAATGTCCAGTGAAATCTGGTGG + Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
917476428 1:175373162-175373184 AAGGACCCATGGACATCTGGTGG + Intronic
917485419 1:175450781-175450803 AAGGGCCCATAAAAATCTAGGGG + Intronic
919488462 1:198173472-198173494 AAATGCCCAATGAATACTGGAGG + Intronic
920867860 1:209768297-209768319 AAAGGCCCAGAGACATCCGGAGG - Intronic
924037881 1:239954772-239954794 AAAGGCCCTCTGAAGTCTGCTGG - Intergenic
924155433 1:241170674-241170696 AAAGGCTGATGGAGATCTGGAGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064453994 10:15469651-15469673 AAAGCCCCAGAGAAATCTGCAGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066488577 10:35872528-35872550 AAAGGCCAAGTGAAGTCTGAGGG + Intergenic
1068810151 10:61246241-61246263 AAAGTCACTTTGAAATGTGGTGG + Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1073730419 10:106281109-106281131 ACATGCTAATTGAAATCTGGAGG + Intergenic
1074389595 10:113045628-113045650 AAGGGCTCATTGACATATGGTGG + Intronic
1074725746 10:116307216-116307238 AAAGGCCCATTATAAAGTGGGGG + Intergenic
1075793071 10:125099391-125099413 AAAGGGCCCTTTTAATCTGGAGG - Intronic
1076573152 10:131445726-131445748 AAATGCCCAGTGAGATGTGGGGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078877058 11:15409442-15409464 AAAGGCCCAGTGAAACAGGGAGG + Intergenic
1079196793 11:18335479-18335501 AAAAGCCCATTAATATCTGGAGG + Intronic
1083317715 11:61827001-61827023 TAAATCCCATTGAAATCTGAGGG + Intronic
1083730988 11:64652528-64652550 GAAGGCCCTTAGGAATCTGGGGG - Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1087332735 11:96802171-96802193 AAAGGCTGATTTAAATCTAGTGG + Intergenic
1088577005 11:111282063-111282085 ATAGTGCCATTGAAATTTGGTGG + Intronic
1088842613 11:113639508-113639530 GAAGGCCCACTGGAATCTCGGGG + Intergenic
1091554684 12:1563730-1563752 AAAGGCCCATCGAAGCCTTGGGG + Intronic
1091931930 12:4403239-4403261 ATAGGCCCACAGAAAGCTGGAGG - Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1094278100 12:28702001-28702023 AAAGACACAGGGAAATCTGGAGG - Intergenic
1094367323 12:29698024-29698046 AAAGGCCCTTGGAAATCAGGAGG + Intronic
1096264435 12:50111902-50111924 AGAGGCCCGCTGAATTCTGGGGG - Intergenic
1096289940 12:50333558-50333580 AAAGGCCATTTGAAAGATGGAGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1097455132 12:59790892-59790914 AAAGTCTCATTCAAAGCTGGTGG - Intergenic
1097976320 12:65690712-65690734 AGAGGCCCATAGATAGCTGGAGG + Intergenic
1098143779 12:67477622-67477644 GAAGGCCTATTGACATCTGTGGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1107509697 13:41071202-41071224 AAAGGCCTTTTGATATCTTGGGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1112203983 13:97305965-97305987 AAAGGCCCACCGGAATCTGTTGG - Intronic
1115479597 14:33848554-33848576 AAAGGCCTAATGGAAACTGGAGG - Intergenic
1115788897 14:36857015-36857037 AAAGGCCCATGGAAATATGAGGG - Intronic
1116988558 14:51247899-51247921 AAAGACAAATTGAAGTCTGGAGG - Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117741883 14:58827420-58827442 AGAGGAGCATTGAAAACTGGTGG - Intergenic
1119125249 14:72119383-72119405 AAAGGCCCATGGAAAACTATTGG - Intronic
1120207715 14:81604099-81604121 AAATGCCCATTGAAATCACCTGG + Intergenic
1120850747 14:89167077-89167099 AGAGGCCCAGTAAAATCAGGTGG - Intronic
1121651767 14:95564088-95564110 AAATGCCCGTGGAAATCTGCTGG + Intergenic
1124023903 15:25947070-25947092 AAAGACCCATTGTAAACTGAGGG - Intergenic
1125533647 15:40429875-40429897 GAAGACTCATTGAAATCTGGAGG - Intronic
1127766145 15:62187129-62187151 ACAGGCACCTGGAAATCTGGGGG + Intergenic
1128347151 15:66861503-66861525 GAAGGCCCAGAGAAAGCTGGGGG + Intergenic
1130335382 15:82953007-82953029 AAAGTCCCATTCACACCTGGCGG + Intronic
1135465712 16:22683160-22683182 AAGGACACACTGAAATCTGGGGG + Intergenic
1136744561 16:32573813-32573835 AGGAGCCCATTGAAATCTAGTGG + Intergenic
1138281636 16:55776396-55776418 CAAGGCCCAAAGAAATCAGGTGG + Intergenic
1139128336 16:64109170-64109192 TAAGGCCCCTTGAAATCATGGGG + Intergenic
1203025036 16_KI270728v1_random:501417-501439 AGGAGCCCATTGAAATCTAGTGG - Intergenic
1203046685 16_KI270728v1_random:833014-833036 AGGAGCCCATTGAAATCTAGTGG + Intergenic
1145771818 17:27498739-27498761 AAAGCCCCACTGGAATCTTGGGG + Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1147195621 17:38764739-38764761 AAAGGCCAATTGGAATCTCAAGG - Intergenic
1147895081 17:43745294-43745316 AAAGTGTCATTGAAACCTGGGGG - Intergenic
1147998439 17:44374417-44374439 AGAGGGCCATTCCAATCTGGTGG - Exonic
1148198267 17:45730366-45730388 AGAAACCCATTGAAATTTGGGGG + Intergenic
1150634015 17:66899920-66899942 AAAGAGACATTGCAATCTGGAGG - Intergenic
1152618203 17:81347463-81347485 AGAGGCCCTTTGAAATCTCACGG - Intergenic
1153500103 18:5740538-5740560 AGAGGCCCATTGATATTTAGTGG - Intergenic
1156099383 18:33575620-33575642 ACATGCCAATTGAACTCTGGAGG + Intergenic
1158111434 18:53944419-53944441 AAATGCCCATTTAACTCTGCCGG + Intergenic
1159316336 18:66778544-66778566 ATAGGCCCATTGGAATATTGAGG - Intergenic
1161085101 19:2331419-2331441 ACAGGCCCACCGAAATTTGGAGG - Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164305322 19:24000951-24000973 ACAGGCCCTTGAAAATCTGGGGG - Intergenic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
927923862 2:26995857-26995879 AAAGGCCCATTAGTATCTTGTGG - Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
931255246 2:60566222-60566244 TTAGGCACATTGAAATCTGATGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
932958638 2:76386183-76386205 CAAAGTCCATTGAAAGCTGGGGG - Intergenic
933466842 2:82662341-82662363 AAAAGCTCACTGAAATCAGGAGG + Intergenic
938644731 2:133318992-133319014 CCAGGCCCACTGAACTCTGGGGG + Intronic
938767781 2:134472284-134472306 AAGGGCTCATGGAAATCTAGAGG + Intronic
940101539 2:150045474-150045496 AAAGGCCCATGCAAATCTATAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941755032 2:169175914-169175936 ACAGGCCCATTGATAACTAGGGG - Intronic
942688206 2:178556617-178556639 AAAGGCCCATAGATATCCTGAGG + Intronic
943843584 2:192611540-192611562 AAAGGCCCATTGAAATTCAGGGG - Intergenic
947477015 2:230459400-230459422 AGAGGCTTATTGTAATCTGGGGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170821971 20:19761856-19761878 AAAGGCTGGTTGAAATCTGAAGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1174176643 20:48649613-48649635 AAAGGCCCAGTGGATGCTGGGGG - Intronic
1178353398 21:31889890-31889912 TATGTCCCTTTGAAATCTGGAGG - Intronic
1182713386 22:32336318-32336340 AAAGGCCCAGGTGAATCTGGGGG - Intergenic
1182990511 22:34763105-34763127 ACAGTGCCTTTGAAATCTGGAGG - Intergenic
1183275364 22:36893254-36893276 AAAGGCCAGCTGGAATCTGGAGG + Intergenic
1184400644 22:44271898-44271920 AAAGGCCCAGGCGAATCTGGGGG - Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
950875618 3:16269026-16269048 AAAGGCTCATTAAAATCAGTAGG - Intronic
953351890 3:42222194-42222216 AAAGGCCCACTGAAATGTGTGGG - Intronic
954971934 3:54658733-54658755 AAAGACACTTTGAAAACTGGAGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957214169 3:77297883-77297905 GAAGGCCCATTGACATGAGGAGG + Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961699867 3:128734751-128734773 AAAGGCCCACTAATATCTGAAGG - Intronic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962399655 3:135047435-135047457 AAAGGTCCATTGGCATCTGCAGG + Intronic
965164623 3:165180872-165180894 AAAGGACAATGGAAATATGGGGG - Intergenic
965693380 3:171381239-171381261 CAACACCCATGGAAATCTGGAGG - Intronic
966849078 3:184153682-184153704 CAAGGCCCTATGTAATCTGGCGG + Intronic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
967598232 3:191353226-191353248 ACGGGACCATTGAGATCTGGTGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970500721 4:16673930-16673952 AAAGACCCATTAAATTCTGTGGG + Intronic
974787187 4:66634120-66634142 AAAATTCCATTGAAATCTAGAGG + Intergenic
974892478 4:67898599-67898621 AAAGGCCCTTGGAGATGTGGTGG - Intergenic
974930904 4:68359862-68359884 AAATGCCCATGTAACTCTGGAGG - Intergenic
976419035 4:84816796-84816818 AAACGGGTATTGAAATCTGGGGG + Intronic
978871618 4:113584900-113584922 AAAGACCCATTAAAAACTGAAGG + Intronic
983692628 4:170491024-170491046 CAAGGCCTATACAAATCTGGAGG + Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
993822260 5:92633123-92633145 AAAGACCCATTGTTACCTGGAGG + Intergenic
993914300 5:93723452-93723474 AAAGACCCATTCAAAACTGGAGG - Intronic
997720370 5:136073839-136073861 AAAGGCCCTTAGGAATCAGGGGG + Intergenic
997881812 5:137598555-137598577 AGAGGCACACAGAAATCTGGTGG - Intergenic
999844887 5:155468715-155468737 AAAGGGCCATTGAAAAAAGGAGG + Intergenic
1000189396 5:158894776-158894798 AAAAGCCCATTGAAATCAGCAGG - Intronic
1000501746 5:162060519-162060541 AGAGGCCAATTGAAATCTTCAGG + Intergenic
1000561757 5:162798208-162798230 AGGGGCCCATTGGAATCTTGGGG + Intergenic
1003595895 6:7473923-7473945 AAAGGCCCATTGAAGGCATGTGG + Intergenic
1003655995 6:8009170-8009192 AAAGTGCCATGAAAATCTGGAGG - Intronic
1003760901 6:9177646-9177668 AAAGCCCTTTTGAAATGTGGAGG + Intergenic
1004086281 6:12452705-12452727 AAATGCCAATTGGAAACTGGAGG - Intergenic
1005313147 6:24578439-24578461 ACAGCCTCATTCAAATCTGGTGG - Intronic
1005362004 6:25039838-25039860 AAAGGCCCAGAGAAAACTGATGG + Intronic
1005771669 6:29079294-29079316 AAAGGCATAATGAGATCTGGGGG + Intergenic
1006445775 6:34079006-34079028 AAAGGCCTAGTGAGAGCTGGAGG - Intronic
1006925642 6:37653233-37653255 AAAGGCCAAATGGAATCAGGTGG + Intronic
1008644322 6:53498139-53498161 AAATACCCATTGAACTCTGATGG - Exonic
1011217089 6:85016372-85016394 AAAGGGTCATAGAAATGTGGTGG - Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013417610 6:109938855-109938877 AAAGACCCATGGAAATGGGGTGG + Intergenic
1014724612 6:124960378-124960400 AAAGGCCCAATGAATTCTGTAGG + Intergenic
1015596964 6:134875146-134875168 AAATGCCCATCGAAATCTGCAGG + Intergenic
1016137644 6:140565194-140565216 AAATCCCCTTTGAAATCAGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1026876915 7:73884695-73884717 AGAGGCCCAGTGAAAGCTGATGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030826415 7:114164762-114164784 AAAAGCCTATTTAAATTTGGTGG + Intronic
1031033971 7:116766915-116766937 AAATGCCTATTAACATCTGGTGG + Intronic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1039331251 8:36539475-36539497 AAAGGACCATTGTAAATTGGGGG - Intergenic
1040143499 8:43958057-43958079 AAAGGACCGTTGAACTCTGTGGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1043158749 8:76819188-76819210 AAAAGCCCATTAAAATCATGAGG - Intronic
1046850050 8:118961818-118961840 AAATTCCCATTGAAATCTTAAGG - Intergenic
1046972914 8:120242698-120242720 AAAGGGCCATTGAAATGTACAGG - Intronic
1048096005 8:131295368-131295390 AAAGTCGCATTGAAAAATGGTGG - Intergenic
1048274109 8:133052971-133052993 AACGGCCCATTCATATGTGGGGG - Intronic
1048956127 8:139537640-139537662 ATAGGCCTCTTGAAATTTGGAGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1052512006 9:29434329-29434351 AAAGGCAGATTGAAAGCGGGGGG - Intergenic
1055360065 9:75480132-75480154 AAAGGCAAATTGAAAACTGGGGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058973438 9:110103801-110103823 AAAGGCCCATCTAATTCTGGAGG - Intronic
1060765443 9:126292223-126292245 AAAGCCACATGAAAATCTGGGGG - Intergenic
1060862321 9:126964712-126964734 ACAGGCCTATCGAAATCTGCAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1189504789 X:41601587-41601609 AATGGCCCTGTGAAATCTAGTGG + Intronic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1198147537 X:133872550-133872572 AAAGGCCCAAAGCAATATGGGGG - Intronic
1198718785 X:139592659-139592681 GAAGGCCCTTTGAGATTTGGGGG + Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic