ID: 902987022

View in Genome Browser
Species Human (GRCh38)
Location 1:20161092-20161114
Sequence CTGTGTGAGGAGGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1342
Summary {0: 1, 1: 0, 2: 8, 3: 80, 4: 1253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902987016_902987022 4 Left 902987016 1:20161065-20161087 CCAGGCTCAGTCACTGCTGGCCG 0: 1
1: 0
2: 0
3: 19
4: 189
Right 902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG 0: 1
1: 0
2: 8
3: 80
4: 1253
902987013_902987022 29 Left 902987013 1:20161040-20161062 CCACTGAGGGTCTGAGCAGAGAG 0: 1
1: 0
2: 5
3: 36
4: 321
Right 902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG 0: 1
1: 0
2: 8
3: 80
4: 1253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902987022 Original CRISPR CTGTGTGAGGAGGAGATGGA GGG Intergenic
900238260 1:1602594-1602616 AGGGGTGAGGAGGAGAGGGAGGG + Intergenic
900369595 1:2325589-2325611 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
900768329 1:4520381-4520403 CTGTGTGTGGTGGAAATGGTGGG - Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768383 1:4520669-4520691 CTGTGTGTGGTGGAGATGGTGGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768421 1:4520837-4520859 CTATGTGTGGTGGAGATGGAGGG - Intergenic
900768433 1:4520885-4520907 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768452 1:4520981-4521003 CTGCGTGTGGTGGAGATGGAGGG - Intergenic
900768474 1:4521080-4521102 CTGTGTGTGGTAGAGATGGTGGG - Intergenic
901051064 1:6426126-6426148 CTGGGTGACCTGGAGATGGAAGG + Intronic
901562065 1:10080176-10080198 CTTTGGGAGGCCGAGATGGAGGG + Intronic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
901755990 1:11441892-11441914 ATGAGGGAGGAGGAGAGGGAAGG + Intergenic
901921347 1:12539992-12540014 CCGTGTGAGCAGGAGGTGGGTGG + Intergenic
902036913 1:13464575-13464597 GTGTGAGAGCAGGAGAGGGAGGG - Intergenic
902349640 1:15844799-15844821 CTTTGGGAGGCTGAGATGGACGG - Intergenic
902367602 1:15987492-15987514 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
902483809 1:16728068-16728090 CTGTGTGAGGCCGAGGCGGATGG + Intergenic
902664145 1:17925849-17925871 CTCTGTGGGGAGAAGACGGAGGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903099494 1:21016440-21016462 CTTTGAGAGGTGGAGGTGGAAGG + Intronic
903140752 1:21337887-21337909 CAGTGTGGGGAGGAGAGGGCAGG - Intronic
903493810 1:23750912-23750934 CAGAAGGAGGAGGAGATGGAGGG + Exonic
903966930 1:27096565-27096587 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
904197245 1:28795072-28795094 CTTTGGGAGGTGGAGATGGGTGG - Intergenic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904563869 1:31415570-31415592 CTTTGTGAGGATTAAATGGAAGG - Intronic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904733559 1:32613008-32613030 CTTTGGGAGGAGGAAGTGGAAGG + Intronic
905036303 1:34920129-34920151 CTGTGAGAGGAGTAGAGAGAAGG - Intronic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
905746228 1:40420828-40420850 CAGTGTCAGGAAGAAATGGAAGG + Intronic
905814752 1:40940786-40940808 ACGTGTGAGGCTGAGATGGAAGG + Intergenic
905926079 1:41750955-41750977 CTTTGGGAGGCCGAGATGGATGG - Intronic
905949450 1:41936374-41936396 CCCTGAGAGGTGGAGATGGAGGG + Intronic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
906266430 1:44434219-44434241 ATGTTTGAGGAGGAGAGAGAAGG + Intronic
906301756 1:44687513-44687535 CTCTGTGAGGAGAAACTGGAGGG + Intronic
907213021 1:52839460-52839482 CTGTGGGAGGCCGAGGTGGATGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907470732 1:54671805-54671827 GTGAGTGTGGGGGAGATGGATGG + Intronic
907685256 1:56604910-56604932 CTTTGAGAGGCCGAGATGGATGG - Intronic
907722604 1:56986088-56986110 CTCTTTGAGGAGGGGATTGATGG + Intergenic
907790903 1:57662437-57662459 CTTTGGGAGGTGGAGATGGGCGG - Intronic
907847132 1:58219190-58219212 CTGTGTGAGGAGGGGAGGAGAGG - Intronic
907960802 1:59278973-59278995 CTCTATGGGTAGGAGATGGAGGG + Intergenic
908273942 1:62449670-62449692 CTTTGGGAGGCTGAGATGGATGG + Intronic
908389928 1:63675240-63675262 GTGTGGGAGGGGGAGAGGGAAGG - Intergenic
908766628 1:67560142-67560164 CTTTGTGAGGCTGAGATGGGTGG + Intergenic
909012062 1:70346073-70346095 CTTTGGGAGGACGAGATGGGAGG - Intronic
909830412 1:80182201-80182223 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
910205686 1:84746944-84746966 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910865710 1:91786505-91786527 CTTTGGGAGGCTGAGATGGATGG + Intronic
911149951 1:94589062-94589084 CTTTGGGAGGCTGAGATGGACGG + Intergenic
911344623 1:96681530-96681552 CTCTGTGAGGAAGAGGAGGAAGG - Intergenic
911356855 1:96833285-96833307 AAATGTGAGGAGGAGAAGGAGGG - Intergenic
911741418 1:101390114-101390136 ATGTGTCAGGAGGAGATGTGAGG - Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912307583 1:108585624-108585646 AGGTCTGGGGAGGAGATGGAAGG - Intronic
912396482 1:109348734-109348756 CTTTGGGAGGCTGAGATGGAAGG - Intronic
912550928 1:110484847-110484869 CTGTGGGTGGAGGACTTGGACGG - Intergenic
912650400 1:111433511-111433533 CTTTGGGAGGACGAGGTGGAAGG + Intergenic
913117620 1:115711397-115711419 CTTTCAGAGGAGGAGATGAAAGG - Intronic
914264085 1:146022680-146022702 CTCTGAGAGGCTGAGATGGAAGG - Intergenic
914354797 1:146875300-146875322 ATCTGTGAGGAGGAAATGGCAGG - Intergenic
914694385 1:150062955-150062977 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
914888866 1:151605230-151605252 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
915127206 1:153674213-153674235 CTTTGGGAGGCTGAGATGGATGG - Intergenic
915228491 1:154428801-154428823 GAGTGTGAGGAGGAGAGCGAGGG + Intronic
915279874 1:154815074-154815096 AGGTGTGATGAGCAGATGGAAGG - Intronic
915515307 1:156409304-156409326 ATGTATGAGCAGGGGATGGAAGG + Intronic
915623115 1:157098337-157098359 CTTTGGGAGGACGAGGTGGACGG - Intronic
916118525 1:161508343-161508365 CTTTGGGAGGACGAGGTGGATGG + Intronic
916204637 1:162303683-162303705 CTATGGGAGGCTGAGATGGAAGG - Intronic
916557583 1:165906609-165906631 CTTTGGGAGGCTGAGATGGAAGG - Intronic
916772709 1:167928103-167928125 CTTTGTGAGGCCGAGATGGGCGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
916794691 1:168154879-168154901 TGGTGGGAGGAGGAGAAGGAGGG + Intergenic
917341986 1:173989430-173989452 CTGTGGGAGGCCAAGATGGATGG - Intronic
917729616 1:177861799-177861821 CTGAGTGAGGAGGAGTTGAGGGG - Intergenic
917796709 1:178538099-178538121 GGGTGTGAGGGGGAGATGCAGGG + Intronic
918295222 1:183149942-183149964 GTGTGTGAGCAGGAGAGGGGTGG - Intergenic
918987524 1:191651904-191651926 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
919360721 1:196590880-196590902 CTTTGGGAGGAGGAGGTGGGTGG + Intronic
919658588 1:200221520-200221542 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
919693558 1:200549035-200549057 CTTTGGGAGGCTGAGATGGATGG - Intergenic
919706240 1:200678598-200678620 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920442974 1:205993805-205993827 CTGTGTGTGTAGGACATGGGAGG + Intronic
920766671 1:208840192-208840214 CTGTGTGAGGAGGAGAATTTGGG + Intergenic
922072531 1:222209915-222209937 TTTTGGGAGAAGGAGATGGAAGG + Intergenic
922279355 1:224108281-224108303 GTGTGTGTTGAGGAGATGGGGGG - Intergenic
922503365 1:226112348-226112370 CTGTGTGACCAGGACATGGGTGG - Intergenic
922657251 1:227396552-227396574 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
922761650 1:228136031-228136053 CTTTGGGAGGCTGAGATGGAGGG + Intergenic
922878729 1:228962748-228962770 CTGAGAGGGGAGGAGATGGGAGG - Intergenic
923132576 1:231090052-231090074 CTTTGGGAGGTGGAGACGGATGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923361845 1:233219368-233219390 CTGTGAGAGGATAAGATGCAGGG + Intronic
923436001 1:233968726-233968748 CTTTGGGAGGACGAGATGGGTGG - Intronic
923557088 1:235009807-235009829 CTGAGAGAAGAGCAGATGGAGGG + Intergenic
923800904 1:237207320-237207342 CTTTGAGAGGTGGAGGTGGATGG + Intronic
923831889 1:237567333-237567355 CTTTGAGAGGCTGAGATGGAGGG + Intronic
923870372 1:237986875-237986897 CTTTGGGAGGACGAGATGGGTGG + Intergenic
924159042 1:241211039-241211061 CTTTGGGAGGACGAGAAGGATGG + Intronic
924264135 1:242263977-242263999 ATGTGTTAGGAAGAGAAGGAGGG - Intronic
924539017 1:244963412-244963434 CTGTGGGAGGCTGAGTTGGATGG + Intergenic
1062900132 10:1137878-1137900 CTGTGTGGTGAGGGGAGGGAAGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063563559 10:7151216-7151238 CTTTGCGAGGCTGAGATGGACGG - Intergenic
1063668036 10:8077510-8077532 CTTTGTGAGGCCGAGATGGGTGG - Intergenic
1063929126 10:11011407-11011429 GTGGGTGAGGGGGAGAGGGAAGG + Intronic
1064024335 10:11834861-11834883 CTTTGTGAGGCTGAGATGGGTGG + Intronic
1064135990 10:12751360-12751382 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1064161537 10:12950821-12950843 CTCTGTGAGGAAGATATGGGGGG + Intronic
1064340654 10:14482509-14482531 CTTTGAGAGGACGAGATGGGTGG - Intergenic
1064574764 10:16733245-16733267 CTTTGGGAGGCCGAGATGGACGG + Intronic
1064731654 10:18337343-18337365 CTTTGGGAGGCTGAGATGGACGG - Intronic
1065104060 10:22362495-22362517 CTGTGGGAGGACAAGATGGGAGG + Intronic
1065378166 10:25063391-25063413 CTGTGGGAGGCTGAGATGGGAGG - Intergenic
1065513727 10:26504997-26505019 CTTTGTGAGGCTGAGATGGGTGG - Intronic
1065576745 10:27128490-27128512 CTTTGTGAGGCTGAGATGGGAGG + Intronic
1065659436 10:27990417-27990439 CTTTGGAAGGTGGAGATGGAAGG - Intronic
1065705728 10:28469984-28470006 CTTTGGGAGGCCGAGATGGATGG + Intergenic
1065897337 10:30175633-30175655 CTTTGGGAGGACGAGATGGGAGG - Intergenic
1066322468 10:34317843-34317865 CTGTGTGAGCAGGATATGTTGGG - Intronic
1066489474 10:35880852-35880874 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1066525023 10:36268181-36268203 TTCAGTCAGGAGGAGATGGATGG - Intergenic
1066574869 10:36814354-36814376 CTTTGTGAGGCTGAGATGGGCGG + Intergenic
1066720662 10:38334486-38334508 ATGTGTTAGGAAGAGAAGGAGGG + Intergenic
1066972764 10:42329347-42329369 CTGTGGGAGGCGGAGGTGGGGGG - Intergenic
1067047344 10:42992025-42992047 CAGTGTGAGCTGGAGATGCAGGG - Intergenic
1067242091 10:44505863-44505885 CTGTGAGATGAGGAGACTGATGG + Intergenic
1067570083 10:47365178-47365200 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1067809795 10:49417891-49417913 GTGGGTGGGGGGGAGATGGAGGG - Intergenic
1068897428 10:62222353-62222375 CTTTGGGAGGACGAGATGGGAGG - Intronic
1068981559 10:63068338-63068360 CTGGGGGAGGAGGAAATGGGAGG + Intergenic
1069011697 10:63381260-63381282 CTTTGGGAGGAGGAGATGGGAGG + Intronic
1069266469 10:66464517-66464539 CTTTGTGAGGTAGAGATGGGTGG + Intronic
1069347603 10:67488145-67488167 CTGTTTGGGGAGGAGAGGAAGGG + Intronic
1069443681 10:68453142-68453164 CTTTGGGAGGCTGAGATGGATGG - Intronic
1069507283 10:69011932-69011954 CTTTGGGAGGCCGAGATGGATGG - Intronic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069720120 10:70544503-70544525 CTGAGTGAGGAGGGGCTGCAGGG + Intronic
1069868522 10:71518994-71519016 GCGTGGGAGCAGGAGATGGAGGG + Intronic
1069943388 10:71970253-71970275 CTTTGTGAGGAGGTGGTGGGGGG - Intronic
1070057255 10:72947481-72947503 CTTTGGGAGGCCGAGATGGATGG - Intronic
1070069282 10:73070936-73070958 CTGTGGGAGGCTGAGGTGGAAGG + Intronic
1070254298 10:74800804-74800826 CTTTGGGAGGATGAGATGGGTGG + Intergenic
1070329061 10:75405116-75405138 GGGTGGGAGGAGGAGAAGGAAGG + Intergenic
1070389624 10:75958132-75958154 TTATGTGAGGAGGAGAAGGATGG + Intronic
1070413650 10:76168651-76168673 CTGTATGATGAGTAGATGAAAGG + Intronic
1070413653 10:76168693-76168715 CTGTATGATGAGTAGATGAAAGG + Intronic
1070619704 10:77999723-77999745 CTGTTAGAGGAGAACATGGATGG - Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070890401 10:79938739-79938761 CTGTGTGATGGGGTGATGAAAGG + Intronic
1071302497 10:84266581-84266603 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1071367407 10:84913210-84913232 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072236613 10:93459219-93459241 CTGTTAGATGAGGAGAGGGAAGG - Intronic
1072423494 10:95309533-95309555 CTGTGGGAGGCCGAGGTGGACGG - Intergenic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1072635732 10:97176650-97176672 CTGTCTGAGGAGGAGGTCCAAGG - Intronic
1072982936 10:100114962-100114984 CTCTTTAAGGAGGAGTTGGACGG - Intergenic
1074455787 10:113594235-113594257 CTCTGTGAGGAAGATGTGGAGGG - Intronic
1074578477 10:114693541-114693563 CTGTGCGAGGAAGAGCTGCAGGG - Intergenic
1074695856 10:116049791-116049813 CGGTGAGCGGGGGAGATGGAGGG + Intergenic
1075088673 10:119430724-119430746 GTGTGTGGGGAGGAGATGTGAGG + Intronic
1075666562 10:124234748-124234770 CTGCGTGAGCAGGACATTGACGG + Intergenic
1075944761 10:126423130-126423152 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1076178236 10:128385278-128385300 CTGTGTGCTGAGGAGGTGAATGG - Intergenic
1076398245 10:130157365-130157387 GGGTGTGCGGAGGAGAGGGAGGG + Intronic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1076742403 10:132493227-132493249 CTGTGTGAGATGGAGACTGAGGG - Intergenic
1077056615 11:597102-597124 CTGTGTGGGGAGGACATCTAGGG + Intronic
1078195802 11:9135748-9135770 CTTTGGGAGGACGAGGTGGATGG - Intronic
1078599701 11:12719208-12719230 CAGTTTGGGGAGGTGATGGAAGG + Intronic
1078668813 11:13347147-13347169 CTTTGGGAGGCCGAGATGGAGGG + Intronic
1079249940 11:18780049-18780071 CTGTGTGAGGTTGACTTGGAGGG - Intronic
1080035727 11:27708333-27708355 TTGTGTGCGGACAAGATGGAAGG - Intronic
1080139262 11:28895752-28895774 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080524862 11:33104990-33105012 CTTTGGGAGGCCGAGATGGAAGG - Intronic
1080569421 11:33542619-33542641 CTGGGGGAGGGGGAGACGGATGG - Exonic
1080813032 11:35725105-35725127 CTGTATGATATGGAGATGGAGGG - Intronic
1081377289 11:42375034-42375056 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1081570257 11:44286331-44286353 GTATGAGAAGAGGAGATGGAGGG + Intronic
1081875762 11:46407476-46407498 CTCTGGGAGGAGGTGGTGGAAGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083411213 11:62493712-62493734 CTTTGGGAGGTGGAGATGGGAGG - Intronic
1083451875 11:62751680-62751702 CTGCGGGAGGTGGAGATGGGCGG + Exonic
1083803901 11:65062420-65062442 GTGAGTGAGGAGGACAGGGAGGG - Intergenic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084107816 11:66991666-66991688 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084397305 11:68920725-68920747 CTGTGGGAGGCAGAGGTGGAAGG - Intronic
1084428506 11:69098541-69098563 CTGTGGGAGGACGAGGTGGGCGG - Intergenic
1084506290 11:69570386-69570408 CTCTGAGAGCAGGAGATAGATGG - Intergenic
1084509084 11:69591898-69591920 CTGTTTCAGGAGGAGATGGTGGG - Intergenic
1084662444 11:70554079-70554101 CTTTGTGGGGAGCAGATGGTAGG + Intronic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1084791499 11:71477894-71477916 CTGTGTGAAGATGGGATGGCTGG - Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1085089995 11:73703824-73703846 CTTTGGGAGGCCGAGATGGATGG + Intronic
1085214312 11:74814632-74814654 CTTTGTGAGGCTGAGATGGGTGG - Intronic
1085243962 11:75082836-75082858 CTTTGGGAGGCGGAGGTGGAAGG + Intergenic
1085456043 11:76665959-76665981 CTGTGTAAGGCGGAGAGGAAAGG + Intronic
1085539904 11:77257540-77257562 GTGTGTGTGTAGGAGAGGGAGGG - Intronic
1085780131 11:79400796-79400818 CTGTGGGAGGAGGAGAGCAAGGG - Intronic
1086289073 11:85284901-85284923 CTGTAGGGGAAGGAGATGGATGG - Intronic
1086360614 11:86055085-86055107 CTGTGGGAGGCTGAGATGGGTGG + Intronic
1086960789 11:92978527-92978549 CTGTCTGGGGAAGAAATGGATGG + Intronic
1087102928 11:94382107-94382129 CTTTGTGAGGCCGAGATGGGCGG + Intronic
1087111967 11:94480202-94480224 CTCTGAGAAGAGGAGCTGGATGG - Intronic
1087173564 11:95075193-95075215 GTGAGGGAGGAGGTGATGGAAGG - Intergenic
1087919631 11:103851454-103851476 TTGTGGGTGGAGGAGAAGGAAGG - Intergenic
1087961413 11:104355112-104355134 CTTTGGGAGGACGAGAGGGATGG - Intergenic
1088269170 11:108016374-108016396 CTGTGGGAGGATGAGGTGGGAGG - Intronic
1088594795 11:111432933-111432955 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
1088612151 11:111588209-111588231 CTTTGGGAGGATGAGATGGGTGG - Intergenic
1088796632 11:113271124-113271146 CTTTGGGAGGCCGAGATGGATGG + Intronic
1088977698 11:114830428-114830450 CTATGAGAAGAGGAGATGGTAGG + Intergenic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089307443 11:117535500-117535522 GTGGGTGAGGACGAGAAGGAAGG + Intronic
1089424053 11:118356170-118356192 CTTTGGGAGGATGAGATGGGAGG - Intergenic
1089435188 11:118459308-118459330 CTTTGGGAGGCTGAGATGGATGG - Intronic
1089488399 11:118864997-118865019 CTTTGGGAGGACGAGGTGGAAGG + Intergenic
1089603963 11:119630888-119630910 CAGTGTGAGTAGGAGATGCTGGG + Intronic
1089764026 11:120749964-120749986 CTGTGTGAGGGAGAGAAGGCAGG + Intronic
1089843891 11:121442919-121442941 CTTTGGGAGGCCGAGATGGACGG - Intergenic
1089890697 11:121878029-121878051 ATCTGAGGGGAGGAGATGGATGG + Intergenic
1090292608 11:125558717-125558739 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1090294160 11:125571631-125571653 CTTTGGGAGGCTGAGATGGATGG + Intronic
1090437582 11:126699247-126699269 CTATGTGAGGACAAGCTGGATGG - Intronic
1090748967 11:129729456-129729478 CTGTGGGAGAAGGAGATGGGAGG - Intergenic
1090802958 11:130185407-130185429 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1091026939 11:132149769-132149791 CAGTGTGGGAGGGAGATGGAGGG + Intronic
1091206524 11:133824979-133825001 ATGTCAGAGGTGGAGATGGAAGG + Intergenic
1091576195 12:1738127-1738149 CTTTGGGAGGCTGAGATGGATGG + Intronic
1092220730 12:6711329-6711351 CTTTGGGAGGATGAGATGGGTGG + Intergenic
1092377441 12:7967573-7967595 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1092561801 12:9622536-9622558 CTTTGTGAGGTGGAGGTGGGTGG - Intergenic
1093169971 12:15849433-15849455 CTGTGGGAGGCCGAGCTGGATGG - Intronic
1093623356 12:21318360-21318382 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1093691310 12:22112787-22112809 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1094144574 12:27215002-27215024 CTTTGGGAGGATGAGGTGGAAGG - Intergenic
1094606599 12:31954818-31954840 CTTTGTGAGGCAGAGATGGGAGG + Intergenic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1094827081 12:34277838-34277860 GTGAGGGAGGAGGAGAAGGATGG - Intergenic
1095551406 12:43445599-43445621 CTTTGGGAGGCCGAGATGGAAGG + Intronic
1095598889 12:43992520-43992542 CTTTGAGAGGCTGAGATGGAAGG - Intronic
1095614634 12:44173318-44173340 CTTTGGGAGGACGAGGTGGATGG - Intronic
1096142185 12:49251529-49251551 CTTTGGGAGGCCGAGATGGATGG + Intronic
1096302501 12:50443508-50443530 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1096304593 12:50463338-50463360 CTTTGTGAGGCTGAGATGTACGG + Intronic
1096398957 12:51289369-51289391 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096563393 12:52453464-52453486 ATGGGTGAGGAAGAGGTGGAGGG + Intergenic
1096578456 12:52569447-52569469 CAGTGGGAGGAGGAGACAGAGGG + Intronic
1096688848 12:53307160-53307182 CTGGGTCAGTATGAGATGGAAGG - Intronic
1097014216 12:55974039-55974061 CAGGGCGAGGAGGAGAAGGAGGG + Exonic
1097064700 12:56312339-56312361 CTGTGTGAGGCTGAGATGGGAGG - Intronic
1097072092 12:56362534-56362556 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
1097207767 12:57338058-57338080 CTTTGTGAGGCTGAGATGGGCGG + Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097794939 12:63851347-63851369 CTTTGGGAGGCAGAGATGGAAGG + Intronic
1098088761 12:66878460-66878482 CTGGGAGAGGAGAAAATGGAGGG + Intergenic
1098314467 12:69178455-69178477 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1098467154 12:70800649-70800671 CTGTGGGAGGCGGAGGTGGGTGG + Intronic
1098614453 12:72506053-72506075 CTTTGAGAGGCTGAGATGGAAGG + Intronic
1099206351 12:79732397-79732419 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1099390708 12:82075218-82075240 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1099949462 12:89284860-89284882 CTGTCTGAGGAATAAATGGAAGG - Intergenic
1100239716 12:92699078-92699100 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1100281121 12:93119334-93119356 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1100433500 12:94551373-94551395 CTGTGTGAGGATGTGATGCCTGG + Intergenic
1101094558 12:101323893-101323915 CTTTGGGAGGCGGAGGTGGATGG + Intronic
1101332395 12:103767837-103767859 CTTTGGGAGGCTGAGATGGACGG + Intergenic
1101717789 12:107326146-107326168 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102080685 12:110095579-110095601 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1102196325 12:111027892-111027914 CTGTGGGAGGCTGAGATGGGAGG + Intergenic
1102208378 12:111106233-111106255 CTCTGTGAGGCCGAGGTGGATGG - Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102263421 12:111459958-111459980 CTTTGGGAGGCCGAGATGGACGG - Intronic
1102290549 12:111695768-111695790 CTTTGGGAGGACGAGATGGGCGG + Intronic
1102471790 12:113163509-113163531 CTGGGTGAGGAGGAGAGTGCCGG + Intronic
1102694831 12:114790749-114790771 CTTTGGGAGGCCGAGATGGATGG + Intergenic
1102738089 12:115181027-115181049 CTGTGGGAGGCAGAGATGGGTGG + Intergenic
1102957125 12:117066046-117066068 GTGTGTGAAGAGAAGAGGGAGGG - Intronic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104765152 12:131325675-131325697 ATGTGTGAGGGGGAGCTGGCAGG - Intergenic
1104814211 12:131636726-131636748 GTGTGTGAGGAGGAGCTGGCAGG + Intergenic
1104884147 12:132095072-132095094 CTTTGGGAGGCTGAGATGGATGG - Intronic
1104895458 12:132161588-132161610 CTGAGTGAGGAGGAGCTGAGTGG - Intergenic
1105229417 13:18476428-18476450 CTTTGGGAGGATGAGATGGGTGG + Intergenic
1105443618 13:20434963-20434985 CTCTGGGAGGATGAGATAGAGGG - Intronic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106241292 13:27915761-27915783 TGGTGGGAGGAGGAGGTGGAAGG + Intergenic
1106390393 13:29329855-29329877 CTGTGGGAGGCTGAGATGGGTGG - Intronic
1106738363 13:32611750-32611772 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1106971647 13:35147655-35147677 CTGGGTCAGGAGGTGAGGGAAGG + Intronic
1107080061 13:36365142-36365164 CAGTGTGTAGAGGAGATGGGAGG - Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107780842 13:43900825-43900847 CTTTGGGAGGACGAGATGGACGG + Intergenic
1108248029 13:48536734-48536756 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1108563622 13:51672025-51672047 CTTTGGGAGGCTGAGATGGACGG - Intronic
1108625552 13:52225058-52225080 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1108660511 13:52581360-52581382 CTTTGTGAGGCTGAGGTGGAAGG - Intergenic
1108755377 13:53495095-53495117 CTTTGGGAGGATGAGATGGGTGG + Intergenic
1108861822 13:54869765-54869787 CTTTGGGAGGAGGAGGTGGGCGG - Intergenic
1108863718 13:54896016-54896038 CTGAGTGAAGAGGAGAGTGACGG - Intergenic
1109740378 13:66546079-66546101 CTTTGGGAGGCCGAGATGGATGG - Intronic
1110047270 13:70845833-70845855 CTGGGTGGAGGGGAGATGGATGG - Intergenic
1110293992 13:73840866-73840888 CTTTGTGAGGAGGAGCTGCTAGG - Intronic
1110642986 13:77847961-77847983 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1111308469 13:86448243-86448265 CTGTCTGAGGAGGAGATAGAGGG - Intergenic
1111370392 13:87309611-87309633 CTTTGAGAGGCCGAGATGGATGG + Intergenic
1111629949 13:90837760-90837782 GTGTTTGATGAGGAGAAGGAAGG - Intergenic
1112346540 13:98594725-98594747 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1113098875 13:106695742-106695764 CTGTGAGAGAAGGACAGGGAGGG + Intergenic
1113159447 13:107363348-107363370 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1113521571 13:110945829-110945851 CTGGGTGTTGAGGAGATGGAAGG - Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113880111 13:113620157-113620179 CTGTGGGTGGAGCAGATGGAGGG + Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114471421 14:22965569-22965591 CTTTGGGAGGTGGAGATGGGAGG - Intronic
1116127243 14:40802703-40802725 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1116457929 14:45140795-45140817 CTTTGGGAGGTGGAGATGGGAGG + Intronic
1117149581 14:52871954-52871976 CTGTGTGAGGAAGAGGTGTTGGG + Intronic
1117273695 14:54170727-54170749 CTGGATGAGTTGGAGATGGATGG - Intergenic
1117530494 14:56656171-56656193 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1117701672 14:58420031-58420053 CTGTGGGAGGTGGAGATGGGAGG - Intronic
1117842560 14:59875160-59875182 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
1117886336 14:60367948-60367970 CTTTGTGAGGCCGAGGTGGATGG - Intergenic
1118204226 14:63706797-63706819 CTTTGGGAGGATGAGATGGGTGG + Intronic
1118306792 14:64661759-64661781 CTGTGTGTGGAGGAGAAAGGGGG + Intergenic
1118554263 14:66997120-66997142 CTTTGTGAGGCCGAGATGGGTGG + Intronic
1118569913 14:67184066-67184088 CTGTGGGAGGCTGAGATGGGCGG - Intergenic
1118580962 14:67296896-67296918 CTCTGGGAGGCTGAGATGGAAGG - Intronic
1118606237 14:67505941-67505963 CTTTGGGAGGCTGAGATGGACGG - Intronic
1119402959 14:74376756-74376778 CTTTGAGAGGATGAGGTGGATGG + Intergenic
1119518372 14:75266444-75266466 CTTTGGGAGGCGGAGGTGGAAGG + Intronic
1120868734 14:89318400-89318422 CTGTGGGAGGCTGAGATGGGTGG - Intronic
1121226729 14:92326731-92326753 CTTTGTGAGGAGGATCTGGGGGG + Intronic
1121345369 14:93131766-93131788 CTGTGGAAGGCCGAGATGGAAGG - Intergenic
1121543596 14:94747149-94747171 CATTGGGAGGATGAGATGGATGG + Intergenic
1121970081 14:98347929-98347951 GTCTGTGAGGAGCAGAGGGAAGG - Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122180090 14:99948579-99948601 CTGTGGGAGGCCGAGGTGGATGG + Intergenic
1122388722 14:101365832-101365854 CTGTGTGAGGAGGAGAGTCTAGG - Intergenic
1122541554 14:102500444-102500466 GTGTGTGAGCAGGCGTTGGAGGG + Exonic
1122925648 14:104898254-104898276 CTGCGGGAGGAGGCGGTGGAGGG + Intergenic
1122998414 14:105277995-105278017 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1123170287 14:106366832-106366854 CTGTGTGAGAGAGAGAAGGAGGG + Intergenic
1123433356 15:20236872-20236894 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1123708828 15:22971293-22971315 CTTTGTGAGGATGAGGTGGGAGG + Intronic
1124057774 15:26258439-26258461 CTTTGTGAGGCCGAGATGGGCGG - Intergenic
1124368757 15:29091415-29091437 CTGTCTGAGCAGGTGAGGGAGGG + Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1125451714 15:39815180-39815202 CTGTGTGTAGAGGAGACAGAAGG + Intronic
1125697928 15:41654755-41654777 CTTTGGGAGGAGGAGGTGGAAGG - Intronic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126477130 15:49077293-49077315 CTTTGGGAGGCCGAGATGGACGG - Intergenic
1126624319 15:50671563-50671585 CCGTGGGAGGAGGAGATGAGAGG + Intronic
1127055336 15:55125699-55125721 CTTTGGGAGGTGGAGAGGGAAGG - Intergenic
1127058803 15:55161074-55161096 CTGTGTGGTGAGGTGAGGGAGGG + Intergenic
1127206141 15:56721212-56721234 CTTTGGGAGGTGGAGATGGGTGG - Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127292010 15:57579604-57579626 CTGGGTGAGGAGGATGTGGGTGG - Intergenic
1127654459 15:61043330-61043352 CTGTGAGATGAGGAGTTGGGAGG - Intronic
1127691089 15:61398554-61398576 AAGTTTGAGGAGGAGAAGGAAGG + Intergenic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1128049843 15:64654542-64654564 CTTTGGGAGGAAGAGATGGAAGG - Intronic
1129055308 15:72815468-72815490 CTTTGGGAGGATGAGTTGGAGGG - Intergenic
1129166494 15:73781177-73781199 CTGTGTGAGGCTGACATTGATGG - Intergenic
1129193833 15:73952808-73952830 GGGTGTGAGTGGGAGATGGAGGG + Intergenic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1129357736 15:75003164-75003186 CTTTGAGAGGCCGAGATGGACGG - Intronic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1130725798 15:86438147-86438169 CTTTGGGAGGCCGAGATGGATGG - Intronic
1131132993 15:89912285-89912307 CTGGGTGAGGAGGATTTGGAGGG - Intronic
1131170216 15:90173060-90173082 CTTTGGGAGGCTGAGATGGATGG - Intronic
1131216661 15:90542420-90542442 CTTTGGGAGGACGAGATGGGCGG - Intronic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1131443163 15:92473996-92474018 GTGTCTGAGGATGAGATGGGAGG + Intronic
1131533137 15:93211642-93211664 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1131885243 15:96905320-96905342 CTTTGAGAGGACGAGATGGAAGG + Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132201601 15:99958150-99958172 CTTTGGGAGGATGAGATGGGTGG - Intergenic
1132346598 15:101112484-101112506 ATGTGTGTGGAGGAAATGAATGG - Intergenic
1132440081 15:101853356-101853378 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1132477211 16:146218-146240 CTTTGTGAGGCCGAGATGGGCGG + Intergenic
1132695563 16:1200314-1200336 CGGCGTGAGGAGCAGATGAACGG - Exonic
1132912066 16:2319115-2319137 CTGTGGGAGAATGAGATGGGAGG + Intronic
1133181910 16:4062073-4062095 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1133261037 16:4550326-4550348 CTGTGGGAGGCTGAGATGGGCGG - Intergenic
1133925713 16:10190355-10190377 CTCTGTGAGAGGGAGACGGAGGG + Intergenic
1133949355 16:10377517-10377539 CTTTGGGAGGAGGAGATAGGAGG - Intronic
1133952181 16:10405117-10405139 CTTTGGGAGGCTGAGATGGATGG + Intronic
1134077357 16:11301126-11301148 CTTTGAGAGGCTGAGATGGAAGG + Intronic
1134146848 16:11771949-11771971 CTGTGGGAGGATGAGGTGGGTGG + Intronic
1134175734 16:12004559-12004581 CTGTGTGGGAAGGAAAGGGAAGG + Intronic
1134195098 16:12153719-12153741 CTTTGGGAGGCTGAGATGGATGG - Intronic
1134420883 16:14088039-14088061 CTTTGGGAGGTGGAAATGGATGG + Intronic
1134465312 16:14471024-14471046 CTTTGGGAGGATGAGATGGGAGG - Intronic
1135252363 16:20911839-20911861 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135408147 16:22213034-22213056 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135544376 16:23355845-23355867 CTTTGTGAGGTGGAGACGGGAGG + Intronic
1135566582 16:23515945-23515967 CTGTGGGAGGCTGAGGTGGAAGG - Intronic
1135605774 16:23823279-23823301 CTTTGTGAGGCTGAGGTGGACGG + Intergenic
1135739539 16:24961775-24961797 CTTTGTGAGGCTGAGATGGGAGG - Intronic
1135875778 16:26198767-26198789 CTTTGAGAGGCCGAGATGGAAGG + Intergenic
1136233558 16:28901840-28901862 CTGAGGGAGGAGGAGAAGGTGGG - Intronic
1136254746 16:29030419-29030441 CTGTGTGGGCAGGAGAGAGATGG - Intergenic
1136353362 16:29727008-29727030 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1136423806 16:30155072-30155094 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1136485260 16:30567741-30567763 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
1136547043 16:30960984-30961006 CTTTGGGAGGATGAGGTGGACGG - Intronic
1136614847 16:31392294-31392316 CTTTGGGAGGAGGAGGTGGGAGG + Intergenic
1136851269 16:33614249-33614271 CTTTGGGAGGCGGAGGTGGAAGG - Intergenic
1137516092 16:49145858-49145880 CTGTGTGAGGAGCATCTGCAAGG - Intergenic
1137603038 16:49769499-49769521 GTGTGTGGGGAAGAGATGGTCGG - Intronic
1138025366 16:53518065-53518087 GTGTGTGGGGAGGAGAGAGAGGG + Intergenic
1138202543 16:55100921-55100943 CTGTGGAAGGAAGAGAGGGAGGG + Intergenic
1138295709 16:55883514-55883536 CTCTGTGAGGCCGAGATGGGAGG - Intronic
1138329038 16:56198313-56198335 CTGTGTGTGAATGAGAGGGATGG - Intronic
1138329465 16:56201997-56202019 CTGAGTGAGAAGGAGAGAGAAGG + Intronic
1138569579 16:57860953-57860975 CTTTGGGAGGCTGAGATGGATGG - Intronic
1138719422 16:59061677-59061699 GTGTGTTAGCAGGAGATGAAGGG - Intergenic
1138903539 16:61302867-61302889 CTTTGTGGGGTGGAGATGGGTGG - Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1139438411 16:66949978-66950000 CTGTGTGAGGCAGAGATGGGAGG + Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139643920 16:68313535-68313557 CTGAGGCAGGAGGAGAAGGAGGG - Intronic
1139764389 16:69214768-69214790 CTGTGGGAGGCTGAGATGGGTGG - Intronic
1139848752 16:69938255-69938277 CTTTGGGAGGGTGAGATGGAAGG - Intronic
1139871653 16:70113275-70113297 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1139898404 16:70307604-70307626 CTTTGGGAGGCCGAGATGGATGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1139979223 16:70840232-70840254 ATCTGTGAGGAGGAAATGGCAGG + Exonic
1140089638 16:71827097-71827119 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
1140231280 16:73119348-73119370 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1140364282 16:74369211-74369233 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1141045870 16:80715767-80715789 GAGAGTGAGGAGGAGATGGAAGG - Intronic
1141127017 16:81408163-81408185 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1141319033 16:82989399-82989421 CAGTGTGAGCTGGAGAGGGATGG + Intronic
1141588159 16:85048971-85048993 GTGTGTGAGAGGGAGAGGGAGGG + Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141686770 16:85574776-85574798 CTGGGTGAGGAGGAGACCCAGGG - Intergenic
1141817912 16:86425441-86425463 GTGGGTGAGAAGGAGAAGGAAGG + Intergenic
1142009129 16:87704885-87704907 CTGTGTGAGGATGAATTGGAGGG - Intronic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142254432 16:89006961-89006983 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254442 16:89006991-89007013 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254452 16:89007018-89007040 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254460 16:89007039-89007061 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254470 16:89007069-89007091 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254498 16:89007152-89007174 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254517 16:89007212-89007234 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1142254536 16:89007271-89007293 GGGAGTGGGGAGGAGATGGAGGG - Intergenic
1203112871 16_KI270728v1_random:1462710-1462732 CTTTGGGAGGCGGAGGTGGAAGG - Intergenic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1143028620 17:3955000-3955022 CTGTGTGGGGATGAGAGGGGCGG + Intronic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143101962 17:4509463-4509485 CTGTGAAAGGAGGAGAGGAAAGG + Intronic
1143220758 17:5259711-5259733 CTTTGGGAGGCTGAGATGGACGG + Intergenic
1143363101 17:6387385-6387407 CTGGGTGAGAAGAAGATGAATGG - Intergenic
1143530999 17:7503362-7503384 CTGAGAGAGGGGGAAATGGAGGG - Intronic
1143573769 17:7777769-7777791 GATTGTGGGGAGGAGATGGAAGG - Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1143963518 17:10739299-10739321 CTGTGGGAGGAAGCGAGGGAGGG - Intergenic
1144140181 17:12340630-12340652 CTGTGGGAGGCGAAGATGGGAGG - Intergenic
1144221824 17:13106665-13106687 ATTTGGGAGGTGGAGATGGAAGG + Intergenic
1144503202 17:15807394-15807416 CTGTGTGAAGAGGACCTGGTGGG + Intergenic
1144796288 17:17893412-17893434 CTTTGTGAGCAGCAGAGGGATGG + Intronic
1145023618 17:19451327-19451349 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1145083725 17:19917582-19917604 CTTTGTGAGACTGAGATGGAAGG - Intronic
1145165384 17:20610109-20610131 CTGTGTGAAGAGGACCTGGTGGG + Intergenic
1145721287 17:27075488-27075510 CTGGATGATGAGGAGAGGGAAGG - Intergenic
1145893541 17:28436626-28436648 CTTTGGGAGGACGAGATGGGTGG - Intergenic
1146023719 17:29301297-29301319 CTTTGGGAGGTGGAGGTGGATGG - Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146498995 17:33348340-33348362 GTGTGTGTGGAGGAGATATATGG + Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1146948609 17:36890724-36890746 GTGTCTGGGGAGGAGATGAATGG + Intergenic
1147020804 17:37531122-37531144 CTGTGGGAGGTTGAGATGGAAGG + Intronic
1147202666 17:38813785-38813807 CTTTGGGAGGCAGAGATGGATGG - Intronic
1147288871 17:39425436-39425458 CTGTGGGAGGCTGAGATGGGTGG - Intronic
1147322621 17:39655425-39655447 CTGTGAGAGGCCGAGATGGGAGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147774740 17:42892638-42892660 CTTTGGGAGGCCGAGATGGATGG + Intergenic
1147882047 17:43660497-43660519 AGGGGTGAGGGGGAGATGGAGGG - Intronic
1148110921 17:45144361-45144383 CTGTGTGGAGGGGAGAGGGAGGG + Intergenic
1148179747 17:45595729-45595751 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
1148269155 17:46250172-46250194 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1148333831 17:46828444-46828466 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1148384659 17:47225465-47225487 CTGGCTGAGGAGGAGAGGGCTGG + Intergenic
1148504258 17:48114908-48114930 CTTTGGGAGGTGGAGATGGGTGG - Intronic
1148779316 17:50112629-50112651 CTGGGGGAGGAGCAGATGAAGGG - Intronic
1148832635 17:50444307-50444329 CTTTGGGAGGCTGAGATGGACGG + Intronic
1149306512 17:55352064-55352086 CTGGTTGAGGCTGAGATGGAAGG + Intergenic
1149320555 17:55476808-55476830 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
1149617165 17:58010412-58010434 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1150106285 17:62464805-62464827 CTGTGGGTGGAGGGGCTGGAGGG + Intronic
1150674314 17:67231807-67231829 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1151194922 17:72424627-72424649 CAGTGGGAGGAGGGGATGGCAGG - Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151460038 17:74248988-74249010 CTGAGTGAGGGAGAGAGGGACGG - Intronic
1151941345 17:77294173-77294195 CTGTGGGAGGTTGAGATGGGCGG + Intronic
1152139349 17:78527137-78527159 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1152228449 17:79103255-79103277 CTGTGAGCAGAGGAGAGGGAAGG + Intronic
1152556253 17:81054664-81054686 CTTTGTGAGAAGGAGCTGCAGGG - Intronic
1152908382 17:82982933-82982955 CTGGGGGTGGAGGAGATGGGGGG + Intronic
1152915562 17:83032961-83032983 CTGGGTCAGGAGGAGAGGAACGG + Intronic
1153172043 18:2327620-2327642 CTTTGGGAGGAGGAGATGGGTGG - Intergenic
1153414653 18:4833581-4833603 GGGTTTGAGGAGGACATGGATGG + Intergenic
1153503254 18:5769933-5769955 CTCTGTGATGAGGAGATGTGTGG + Intergenic
1153514697 18:5892434-5892456 GAGTGTGTGGAGGAGATGGGTGG - Intronic
1153575070 18:6511957-6511979 CTGTGGGAGGTGGAGAAGCATGG - Intronic
1153706387 18:7749637-7749659 CAGTGTGAGGAGGTGGTGTATGG + Intronic
1153724688 18:7942801-7942823 CTGGGTGGGGAGGAGAAGGGAGG - Intronic
1153897390 18:9578480-9578502 CTTTGGGAGGAGGAGGTGGGAGG - Intronic
1154524030 18:15263691-15263713 CTTTGGGAGGACGAGATGGGTGG - Intergenic
1154532781 18:15364656-15364678 CTTTGTGAGGACGAGTTGGGTGG + Intergenic
1154960977 18:21308436-21308458 ATGTGTGAGGCTGCGATGGAAGG - Intronic
1154961146 18:21309895-21309917 GTGTGTGGGGAGGGGATGGGGGG - Intronic
1155208653 18:23582556-23582578 CTTTGGGAGGCGGAGGTGGATGG + Intronic
1155255396 18:23992920-23992942 CTGTGTGTGTAGGTGCTGGAGGG - Intronic
1155327084 18:24675500-24675522 CTGTGTGTGGAGGGGAGGAAGGG + Intergenic
1155494239 18:26427031-26427053 CTTTGTGAGGCTGAGATGGGAGG + Intergenic
1155825059 18:30431111-30431133 CTGTGTGGGGAGGCGGTGAAGGG - Intergenic
1156496836 18:37531248-37531270 CTCAGTGAGGAGTAGCTGGAGGG - Intronic
1157377457 18:47179428-47179450 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1157485367 18:48083459-48083481 CTGTATGAGGAGGTGTGGGATGG - Intronic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1157671222 18:49530452-49530474 CTTTGGGAGGACGAGATGGGAGG + Intergenic
1157725906 18:49963669-49963691 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1158009104 18:52708196-52708218 CTTTGGGAGGCCGAGATGGATGG + Intronic
1158179730 18:54700525-54700547 CAGAGTGAGGAGGAGACTGACGG + Intergenic
1158552641 18:58449610-58449632 CTGTGTTAGGAGGAGCTGTAGGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1158971097 18:62667363-62667385 CTTTGAGAGGCTGAGATGGAAGG - Intergenic
1159140510 18:64388835-64388857 CTTTGGGAGGATGAGGTGGATGG + Intergenic
1159317047 18:66788820-66788842 CTTTGGGAGGAAGAGATGGGCGG + Intergenic
1159949280 18:74468645-74468667 CTCTGTGTGGAGGAGATGGAGGG + Intergenic
1160050248 18:75426746-75426768 GACTGTGAAGAGGAGATGGATGG - Intronic
1161017204 19:1989148-1989170 CTTTGTGAGGCCGAGATGGGAGG + Intronic
1161383249 19:3977582-3977604 CTGTGTGAGGAGAACATGCGGGG - Exonic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1161811512 19:6473949-6473971 CTCTGGGAAGAGGAGATGGATGG + Intronic
1162044972 19:7993010-7993032 CTTTGGGAGGGTGAGATGGAAGG - Intronic
1162087985 19:8260012-8260034 CTGTGAGATGGGGAGATGGTGGG + Intronic
1162111917 19:8404031-8404053 CTGTGTGCGGAGGAGCGGGTGGG - Exonic
1162174264 19:8819422-8819444 CTTTGGGAGGCTGAGATGGATGG - Intronic
1162928827 19:13945409-13945431 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1163104378 19:15115112-15115134 CTCCCTGAGGAGGGGATGGAGGG - Exonic
1163408243 19:17136846-17136868 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1163456620 19:17409998-17410020 CTTTGGGAGGCCGAGATGGACGG - Intronic
1163464300 19:17457614-17457636 CTTTGGGAGGCAGAGATGGAAGG - Intronic
1163569274 19:18070693-18070715 CTTTGGGAGGTGGAGATGGGTGG + Intronic
1163732861 19:18960075-18960097 CTTTGTGAGGCCGAGGTGGATGG + Intergenic
1163743392 19:19030675-19030697 CTCTGGGAGGCAGAGATGGAAGG + Intronic
1163822480 19:19503961-19503983 CTTTGTGAGGCCGAGATGGGAGG + Intronic
1164021280 19:21308520-21308542 CTGTGGGAGGCCGAGATGGGTGG - Intronic
1164076494 19:21823810-21823832 CTTTGGGAGGCCGAGATGGATGG - Intronic
1164092234 19:21967627-21967649 CTTTGGGAGGCTGAGATGGATGG - Intronic
1164413521 19:28025798-28025820 ATGTGTGAGGAAGAGATGAGAGG + Intergenic
1164431320 19:28191434-28191456 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
1164864565 19:31593140-31593162 CTGTGAGAGGAGGAGAGGCCAGG + Intergenic
1165238051 19:34439584-34439606 CTGTGGGAGGGTGAGATGGGAGG + Intronic
1165379372 19:35467452-35467474 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165536167 19:36447258-36447280 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1165811533 19:38614568-38614590 CAGTGGGAGGGGGAGATGGTGGG + Intronic
1166063103 19:40339726-40339748 CTTTGGGAGGCCGAGATGGACGG + Intronic
1166110090 19:40616863-40616885 CAGAGTGTGGAGGAGATGAAAGG - Intronic
1166284738 19:41817874-41817896 CTTTGGGAGGATGAGGTGGATGG - Intergenic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166431560 19:42732347-42732369 GTGTATGAGGAGGAAATGGTGGG + Intronic
1166434681 19:42757560-42757582 GTGTATGAGGAGGAAATGGTGGG + Intronic
1166529120 19:43532270-43532292 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1166629425 19:44392066-44392088 ATGTGTGAGTAGGGGAGGGAGGG + Intronic
1166799637 19:45448602-45448624 CTTTGAGAGGCGGAGATGGGAGG + Intronic
1166961004 19:46495737-46495759 CTGTGTCAGGGAGAGAGGGAGGG - Exonic
1167071632 19:47225598-47225620 CTTTGGGAGGCGGAGATAGAAGG - Intronic
1167076103 19:47250409-47250431 CTTTGGGAGGCGGAGCTGGATGG - Intergenic
1167171216 19:47833523-47833545 CTTTGGGAGGCTGAGATGGATGG - Intronic
1167446411 19:49540388-49540410 CTTTGGGAGGCTGAGATGGATGG + Intronic
1167663005 19:50807422-50807444 CTGTATGAGAGGGAGATAGATGG + Intergenic
1167689288 19:50975342-50975364 CTGAGGGAGGAGGGGCTGGAGGG + Intergenic
1167899740 19:52610914-52610936 CTTTGGGAGGCGGAGATGGGTGG - Intronic
1167931594 19:52870235-52870257 CTTTGTGAGGCCGAGGTGGATGG + Intronic
1168114479 19:54214060-54214082 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1168295289 19:55374993-55375015 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
1168295322 19:55375075-55375097 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
1168512852 19:56987340-56987362 CTGGGTTAGGAGGGGATGAAAGG - Intergenic
1168665696 19:58203338-58203360 CTTTGGGAGGCCGAGATGGACGG + Intronic
1202631849 1_KI270706v1_random:7249-7271 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925510866 2:4623444-4623466 TTGCGAGGGGAGGAGATGGAAGG + Intergenic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925969846 2:9098653-9098675 GGGTGTGGGGAGGAGAGGGAAGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926099304 2:10103775-10103797 CTTTGGGAGGCTGAGATGGACGG + Intergenic
926292079 2:11539292-11539314 CTGTGGGAGGCCGAGATGGGAGG - Intronic
926329399 2:11812366-11812388 CAGTGCTAGGAGGAGAGGGAAGG + Intronic
926900903 2:17751235-17751257 CTTTGGGAGGCCGAGATGGATGG + Intronic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927657616 2:24964175-24964197 CTGTGGGAGGCCGAGATGGGCGG + Intronic
927691711 2:25213174-25213196 CAGTTGGAGGAGGAGAGGGAGGG - Intergenic
927952161 2:27178775-27178797 CTTTGAGAGGTGGAGATGGGTGG - Intergenic
928325244 2:30314441-30314463 CTTTGGGAGGCTGAGATGGAAGG + Intronic
928450308 2:31372360-31372382 CAGTCTGAGGAGGACATGGTGGG - Exonic
928568236 2:32575519-32575541 CTGTGGGAGGCCGAGGTGGATGG + Intronic
929113538 2:38425327-38425349 CTGTGGGAGGCTGAGATGGGAGG - Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929582876 2:43094514-43094536 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929583078 2:43096504-43096526 CTGTGTGAGTGGGAGAGAGAAGG - Intergenic
929786577 2:44997663-44997685 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930145536 2:47999115-47999137 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
930663485 2:54079102-54079124 CTCAGTGAGGAGGAGCTGGGAGG + Intronic
931381517 2:61757824-61757846 CTTTGGGAGGCGGAGGTGGACGG + Intergenic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
931730245 2:65146968-65146990 TTGTGAGAGGAGGAAATGGATGG + Intergenic
932020290 2:68077778-68077800 CCATGTGAGGAGGACATGGTGGG - Intronic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932342175 2:70971366-70971388 CTTTGGGAGGACGAGGTGGAAGG + Intronic
932461950 2:71888032-71888054 CTTTGGGAGGCTGAGATGGATGG + Intergenic
932482296 2:72051714-72051736 CTCTGGAAGGAGGTGATGGAAGG - Intergenic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
933041377 2:77471427-77471449 CTTTGTGAAGAATAGATGGAAGG - Intronic
933642514 2:84778737-84778759 CTTTGGGAGGCGGAGGTGGAGGG - Intronic
933666233 2:84967438-84967460 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
933883831 2:86699301-86699323 CTTTGGGAGGCGGAGATGGGCGG + Intronic
933899180 2:86836910-86836932 CTTTGGGAGGCCGAGATGGATGG + Intronic
933981090 2:87551478-87551500 TTGGGTGAGTAGGGGATGGAAGG + Intergenic
934920485 2:98340535-98340557 CTTTGGGAGGACGAGATGGGCGG + Intronic
935287274 2:101576289-101576311 CTCTGTGTGAAGGAGAGGGAGGG + Intergenic
935687846 2:105699913-105699935 GTGTTTGAGGAGGAGAAGGAAGG - Intergenic
936399334 2:112153838-112153860 CTGTGCGAGAAGGGGCTGGAGGG + Intronic
936786917 2:116104393-116104415 CTGCATGAGGAGGACAAGGAAGG - Intergenic
936876156 2:117192129-117192151 CTGTGTGGGAAGGAAAGGGAAGG - Intergenic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937052453 2:118903564-118903586 CTGTGTGAGGATGTGATGGCTGG - Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937238532 2:120445334-120445356 CACTGTGAGGATGAAATGGAAGG - Intergenic
937471447 2:122177130-122177152 CTGTGAGTGGAGCAGATGGTTGG - Intergenic
937670582 2:124533517-124533539 GTGGGTGTGGAGGAGAGGGATGG + Intronic
938333704 2:130469645-130469667 CTTTGTGAGGATGAGGTGGGTGG + Intronic
938356111 2:130651022-130651044 CTTTGTGAGGATGAGGTGGGTGG - Intronic
938905543 2:135832725-135832747 CTTTGGGAGGCGGAGATGGGAGG - Intronic
939605610 2:144251950-144251972 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
939831745 2:147080734-147080756 CTTTGAGAGGCTGAGATGGATGG - Intergenic
939985211 2:148823496-148823518 GTGTGGGAGGAGCAAATGGATGG + Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
941032661 2:160530665-160530687 CTTTGTGAGGCTGAGATGGCAGG + Intergenic
941155569 2:161973577-161973599 TTGAGAGAGGAGGAAATGGAAGG - Intronic
941624716 2:167818701-167818723 CTGTGTGAGGAGGAGATTCAAGG - Intergenic
941647470 2:168056830-168056852 CTGTGTGATAGGGAGCTGGAAGG - Intronic
941904478 2:170707621-170707643 CTTTGGGAGGTGGAGGTGGACGG - Intergenic
942058087 2:172204062-172204084 CTTTGGGAGGACGAGGTGGACGG - Intergenic
942291125 2:174472160-174472182 CTTTGGGAGGCCGAGATGGATGG + Intronic
942309271 2:174639487-174639509 CTTTGGGAGGATGAGATGGGAGG - Intronic
943225002 2:185161574-185161596 ATGTGTGTGGATGAGAGGGAGGG + Intergenic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
943862844 2:192890663-192890685 GTGTCAGAGGAGGAGATAGAGGG - Intergenic
944091769 2:195919586-195919608 CTTTGGGAGGATGAGGTGGATGG - Intronic
944176695 2:196837515-196837537 CTGTGGGAGGCTGAGATGGGAGG + Exonic
944213864 2:197234433-197234455 CTGTGTGAGGCCGAGATGGGTGG - Intronic
944536748 2:200717726-200717748 CTGTGGGAGGCTGAGGTGGAAGG + Intergenic
944583091 2:201149996-201150018 CTTTGTGAGGCTGAGATGGGAGG + Intronic
944794135 2:203165102-203165124 CTTTGGGAGGCAGAGATGGACGG - Intronic
944905315 2:204256373-204256395 GTGTGTGAAAAAGAGATGGAGGG + Intergenic
944998212 2:205318798-205318820 CTGGGTGAGGTGGAGTTAGAAGG - Intronic
945097921 2:206237095-206237117 CTTTGGGAGGAGGAGGTGGGTGG + Intergenic
945214054 2:207414412-207414434 CTTTGGGAGGTGGAGATGGGGGG + Intergenic
945216709 2:207441977-207441999 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
945545936 2:211151656-211151678 CTTTGGGAGGACGAGATGGGTGG + Intergenic
945825292 2:214714111-214714133 CTTTGTGAGGCTGAGATGGAAGG + Intergenic
945936618 2:215908825-215908847 CTGTGTGAGCAGGAGTTTAAGGG + Intergenic
946077981 2:217091580-217091602 CTGGGACAGGAGGAGATAGAAGG + Intergenic
946199766 2:218064833-218064855 CTGGGTGGGGAGGAACTGGAGGG - Intronic
946200609 2:218068821-218068843 CTGACTGAGGTGGAGAAGGAAGG + Intronic
946380333 2:219343861-219343883 CTTTGGGAGGCTGAGATGGATGG - Intergenic
946404506 2:219485134-219485156 CTGTGGGAGGAGCAGAGGGCTGG + Intronic
946433759 2:219639014-219639036 GTGTGTGTGGAGGAGCTGGCAGG + Intronic
946736315 2:222757868-222757890 CTTTGGGAGGCCGAGATGGACGG - Intergenic
946810225 2:223515588-223515610 CTTTGAGAGGCCGAGATGGAAGG + Intergenic
946941245 2:224772162-224772184 CTTTGGGAGGCCGAGATGGATGG - Intronic
946955931 2:224929955-224929977 CTCTGTGAGGCCGAGATGGGTGG + Intronic
947093727 2:226542890-226542912 CTCTGGGAGGTGGAGATGGGCGG - Intergenic
947432288 2:230041571-230041593 CTTTGAGAGGCGGAGATGGGCGG - Intronic
947456534 2:230259432-230259454 CTTTGGGAGGCTGAGATGGATGG + Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948020548 2:234729822-234729844 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
948297471 2:236873116-236873138 CCGTATGAGCAGGAGATGAAAGG - Intergenic
948937845 2:241179558-241179580 CAGTGTGAGAAGGACATGGGAGG + Intronic
1168902674 20:1378171-1378193 CTGTGTGAGGATAAGATGTCTGG + Intronic
1168906086 20:1404981-1405003 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
1169440925 20:5633256-5633278 CTTTGGGAGGATGAGGTGGATGG + Intergenic
1169444606 20:5660818-5660840 CTTTGGGAGGTGGAGATGGGTGG + Intergenic
1169968245 20:11240807-11240829 CTGTGTGAGGAGGTTGTGCAGGG - Intergenic
1170235705 20:14102711-14102733 ATGTTTGAGTAGGTGATGGATGG + Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170696422 20:18663274-18663296 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1170838560 20:19905477-19905499 CTGTGGGAGGCTGAGATGGGAGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171256642 20:23693589-23693611 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171279533 20:23884063-23884085 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171903733 20:30881317-30881339 CTTTGGGAGGAGGAGGTGGGTGG + Intergenic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172176622 20:32976407-32976429 CAGTGAGGGGAGGAGCTGGAGGG - Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172614253 20:36273091-36273113 CTGTGGGAGGCTGAGATGGGCGG + Intergenic
1172652601 20:36514655-36514677 CTGTGGGAGGCTGAGATGGGGGG - Intronic
1172682117 20:36724682-36724704 CTTTGGGAGGCGGAGATGGATGG + Intronic
1172964495 20:38824783-38824805 CTTTGTGAGGCAAAGATGGATGG + Intronic
1173618634 20:44419604-44419626 CTGTGGGAGGAGGACCTGCAGGG - Intronic
1173738543 20:45378986-45379008 CTGTGGGAGGTGGAGGTGGGCGG - Intronic
1173868632 20:46328603-46328625 CTGTGGAAGGAGGAGAGGAATGG - Intergenic
1173985671 20:47259647-47259669 CTGGTTGAGGAGGAGAAGCAAGG - Intronic
1174276864 20:49410195-49410217 ATGTGTGAGGGGGAGAAGCAGGG + Intronic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1174391290 20:50219891-50219913 CTGTATGAGGAAGAGATGGCAGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174689235 20:52486746-52486768 CTCTGGGAGGAGGAGGTGGGTGG - Intergenic
1175353378 20:58342801-58342823 CTGGGTGAGGGGGGAATGGAAGG + Intronic
1175726105 20:61319700-61319722 CTTTGGGAGGTGGAGGTGGATGG + Intronic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1176006839 20:62869633-62869655 CTTTGGGAGGCTGAGATGGACGG + Intergenic
1176773404 21:13104787-13104809 CTTTGGGAGGACGAGATGGGTGG + Intergenic
1177162618 21:17564247-17564269 CTTTGGGAGGCGGAGATGGGAGG + Intronic
1177776834 21:25577332-25577354 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1177818964 21:26010564-26010586 CTTTGGGAGGCCGAGATGGATGG + Intronic
1178508519 21:33182528-33182550 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
1178602677 21:34008538-34008560 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
1178715589 21:34961130-34961152 CTTTGGGAGGCTGAGATGGATGG + Intronic
1178872898 21:36390897-36390919 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1178901803 21:36604835-36604857 CGGTGTGAAGGGGAGAGGGAGGG - Intergenic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179188989 21:39107483-39107505 CTGAGTGTGGAGGTGATGGATGG + Intergenic
1179490388 21:41737327-41737349 CTGTGAGATGTGGAGATGGTAGG - Intergenic
1179804877 21:43831072-43831094 CTTTGGGAGGCCGAGATGGAAGG + Intergenic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180902933 22:19387706-19387728 CTGAGCGAGGAGGAGAAGGTAGG - Exonic
1181031824 22:20152036-20152058 CTTTGGGAGGTGGAGATGGGTGG - Intergenic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181263767 22:21617936-21617958 CTTTGGGAGGATGAGATGGGTGG + Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181857817 22:25794745-25794767 CTTTGGGAGGCCGAGATGGATGG - Intronic
1181990690 22:26834594-26834616 GTGAGTGAAGAGGAGATGGCAGG - Intergenic
1182219750 22:28748758-28748780 CTTTGGGAGGCTGAGATGGATGG - Intronic
1182291436 22:29283003-29283025 CTGTGGGAGGCCGAGATGGGTGG - Intronic
1182304030 22:29355650-29355672 CTGGGTGAGGCTGAGATGGGTGG + Intronic
1182587340 22:31352080-31352102 TGATGGGAGGAGGAGATGGAGGG + Intergenic
1182597061 22:31430006-31430028 CTTTGGGAGGCAGAGATGGAAGG - Intronic
1182654502 22:31879300-31879322 GGGTGGGAGGAGGAGTTGGAAGG - Intronic
1182696449 22:32202230-32202252 CAGTGAGAGGAGGAGATGTGGGG - Intronic
1182710329 22:32318678-32318700 CTGTGTTGAGAGCAGATGGAAGG - Intergenic
1182848341 22:33450153-33450175 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1183082585 22:35466028-35466050 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1183558815 22:38553578-38553600 CTTTGGGAGGATGAGATGAATGG + Intronic
1183622136 22:38980728-38980750 CTGTGGGAGGCCGAGGTGGACGG - Intronic
1183641016 22:39092373-39092395 AGGTATGATGAGGAGATGGAAGG - Intergenic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184198601 22:42949047-42949069 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
1184283878 22:43455351-43455373 CTTTGGGAGGCCGAGATGGATGG - Intronic
1184397899 22:44255643-44255665 CTGTGTTGAGAGCAGATGGAAGG - Intronic
1184618401 22:45654208-45654230 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1184756356 22:46518151-46518173 CTTTGGGAGGTCGAGATGGATGG - Intronic
1184772976 22:46608763-46608785 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1184972510 22:48036358-48036380 TTGGTAGAGGAGGAGATGGAAGG + Intergenic
1185094205 22:48797336-48797358 CTTTGGGAGGCCGAGATGGATGG - Intronic
949151893 3:779140-779162 CTTTGGGAGGCCGAGATGGATGG + Intergenic
949180496 3:1124358-1124380 ATGTGTTTGGAGGAGATGGAGGG - Intronic
949341447 3:3035062-3035084 CTGTGGGAGGTAGAGTTGGATGG + Intronic
949399209 3:3648002-3648024 GTGTGTGGGGAAGAGAAGGACGG + Intergenic
949412791 3:3784050-3784072 CTTGGTGTGGAAGAGATGGAGGG + Intronic
949461476 3:4299563-4299585 CTTTGGGAGGTGGAGATGGGTGG + Intronic
949571740 3:5300387-5300409 CAGTGTGAGGAAAAGATGCATGG + Intergenic
949831693 3:8221762-8221784 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
950040793 3:9917900-9917922 CTGTGTGTGGAGGAGCGGGTGGG - Intronic
950056604 3:10030028-10030050 CTTTGGGAGGCCGAGATGGATGG - Intronic
950204575 3:11068889-11068911 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
950209849 3:11114790-11114812 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
950388552 3:12678451-12678473 CTTTGGGAGGCCGAGATGGACGG - Intergenic
950489424 3:13294676-13294698 CTGGGTTAGGGGGAGATGGCTGG - Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950841893 3:15975812-15975834 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
951262294 3:20524088-20524110 CTGTCTGAGTAGGAGCTGCAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951505487 3:23440349-23440371 CTTTGGGAGGACGAGATGCAAGG - Intronic
951702008 3:25506360-25506382 ATTTGTGAGAAGGAGATGGGAGG + Intronic
952044914 3:29306831-29306853 GTGTATGAGGAGAACATGGAAGG - Intronic
952288013 3:31986765-31986787 CTGTGGGAGGCTGAGATGGGAGG + Intronic
952498106 3:33933897-33933919 CTGTGGGAGGATGAGGTGGGTGG + Intergenic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
952557722 3:34552072-34552094 GTGTGTGAGGAAGAGAGAGACGG - Intergenic
952907595 3:38152558-38152580 CTTTGTGAGGCCGAGGTGGATGG - Intergenic
953040453 3:39251192-39251214 CCCTGTGTGGAAGAGATGGAAGG - Intergenic
953311827 3:41887918-41887940 CTTTAGGAGGATGAGATGGAAGG + Intronic
953574151 3:44099385-44099407 GTGTGTGTGGAGGGGAGGGATGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953607005 3:44418854-44418876 CTGAAAGATGAGGAGATGGAGGG - Intergenic
953633004 3:44635844-44635866 CAGTGGGAGGAGGAGATGGATGG + Intronic
953741820 3:45545015-45545037 GTGTGTGAGCAGGAGAGAGAGGG + Intronic
954103164 3:48393523-48393545 CTGTATGATGAGGAAATGGTGGG - Intronic
954311547 3:49772644-49772666 CTTTGGGAGGCTGAGATGGAAGG - Intronic
954456395 3:50601946-50601968 CTGTGGGAGGAGGAGCTGCTGGG - Intergenic
954560663 3:51553581-51553603 CTTTGGGAGGTGGAGATGGGAGG + Intronic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
954825838 3:53372654-53372676 CAGTGTTAGGAGGAGATGTTAGG - Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955278621 3:57572475-57572497 CTTTGGGAGGCGGAGATGGGAGG + Intronic
955280369 3:57589157-57589179 CTGGGTGAGGCTGAGATGGGAGG + Intronic
955486228 3:59437586-59437608 CTTTGGGAGGCGGAGGTGGAAGG + Intergenic
955576406 3:60369213-60369235 CTGTGTGAGGCTGAGGTGGGAGG - Intronic
955690703 3:61587900-61587922 CTTTGTGAGGCCAAGATGGAAGG - Intronic
955804122 3:62716295-62716317 CTTTGGGAGGCCGAGATGGACGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955954687 3:64276761-64276783 CTTTGGGAGGCTGAGATGGAGGG - Intronic
956719183 3:72103004-72103026 CTTTGTGAGGCCGAGATGGGTGG - Intergenic
956820224 3:72947554-72947576 CTTTGGGAGGTGGAGATGGGTGG + Intronic
956999231 3:74865537-74865559 TTGTGTGAGGATGATATGCATGG - Intergenic
957095637 3:75774860-75774882 CTTTGGGAGGCCGAGATGGACGG - Intronic
957131666 3:76230693-76230715 CAGTGTGAGAAGGAGAGGGTTGG - Intronic
957187977 3:76967448-76967470 CTTTGGGAGGTGGAGGTGGATGG - Intronic
957862250 3:85969107-85969129 CTATGTGAGAAAGAGATTGAAGG - Intronic
958091293 3:88879960-88879982 CTTTGTGAGGGAGAGAGGGAAGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959989453 3:112615025-112615047 CTATGTGAAATGGAGATGGATGG + Intronic
960143743 3:114176352-114176374 CTTTGGGAGGCTGAGATGGAAGG + Intronic
960181474 3:114585334-114585356 CTGAGTGAGGAGGAGGTTAAGGG + Intronic
960470266 3:118055674-118055696 CTGAGTGAAGAAGAGAGGGAGGG + Intergenic
960590113 3:119357411-119357433 CTGTGTGGGGCTGAGAGGGAGGG + Intronic
960801853 3:121547804-121547826 CTTTGGGAGGCGGAGGTGGACGG - Intergenic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961542656 3:127610512-127610534 ATGCGTGAGGAGGAAAAGGAAGG - Intronic
961554154 3:127686302-127686324 ATGTGTGATGAGGGAATGGATGG - Intergenic
961554234 3:127687066-127687088 ATGTGTGATGAGGGAATGGATGG - Intergenic
961667117 3:128499354-128499376 GTGTGTGCGGAGGAGATGGGGGG - Intergenic
961833656 3:129639003-129639025 CTTTGGGAGGCGGAGATGGGTGG + Intergenic
962325047 3:134425956-134425978 CTTTGGGAGGACGAGGTGGAAGG + Intergenic
962470888 3:135707438-135707460 TTGTGGTGGGAGGAGATGGATGG + Intergenic
962682196 3:137812026-137812048 CTATATTAGGAGGACATGGATGG - Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963219194 3:142788223-142788245 CTGTGGCAGGAGTAGATGGAGGG + Intronic
963426593 3:145136256-145136278 CTATGGGAGGCCGAGATGGACGG - Intergenic
963982922 3:151560311-151560333 GTGTGAGAGGAGGAAATGTATGG - Intergenic
964058355 3:152489236-152489258 CTTTGGGAGGCTGAGATGGATGG + Intergenic
964740054 3:159955487-159955509 CTTTGGGAGGACGAGGTGGATGG + Intergenic
965311680 3:167135923-167135945 TTGTTTAAGGAGGAGAGGGAAGG + Intergenic
965673419 3:171170805-171170827 CTTTGGGAGGCTGAGATGGATGG + Intronic
965876125 3:173322502-173322524 CTTTGGGAGGCGGAGATGGGAGG - Intergenic
965917907 3:173873330-173873352 CTTTGGGAGGCTGAGATGGACGG - Intronic
966113365 3:176431046-176431068 AGATGTGAGGAGGAGAGGGAAGG - Intergenic
966290781 3:178355561-178355583 GTGTGTGAGGTGGAGTTGAAGGG - Intergenic
966620085 3:181954048-181954070 CAGTGGGAGGAGGACATGGGAGG - Intergenic
966739024 3:183214741-183214763 CTTTGGGAGGCGGAGATGGGTGG + Intronic
966767951 3:183479225-183479247 CTCTGTGAGGGAGAGATGGAGGG - Intergenic
967083711 3:186074668-186074690 CTTTGGGAGGACGAGATGGGTGG + Intronic
968025359 3:195437958-195437980 CTTTGTGAGGTCGAGGTGGAAGG - Intronic
968157603 3:196395699-196395721 CTTTGGGAGGATGAGATGGGAGG - Intronic
968170800 3:196508691-196508713 CTGTGGGAGGACGAGGTGGTTGG + Intronic
968276235 3:197442417-197442439 CTGTGGGAGGTCGAGATGGAAGG + Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968430987 4:558658-558680 CTGTGGGAGGCCGAGACGGACGG + Intergenic
968779182 4:2566444-2566466 CTTTGTGAGGATGAGGCGGACGG + Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
968938728 4:3626986-3627008 ATATGTGGGGAAGAGATGGAAGG + Intergenic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969223934 4:5781988-5782010 CTGTCTGAGGCTGAGAGGGAGGG + Intronic
969314988 4:6376695-6376717 CTTTGGGAGGCTGAGATGGATGG - Intronic
969517068 4:7653808-7653830 CTGTGTGAGGATGGGAGGAAGGG - Intronic
970539794 4:17065982-17066004 CTATCTGAGCAGGAGAAGGATGG + Intergenic
970633085 4:17975637-17975659 CTTTGGGAGGCTGAGATGGATGG - Intronic
970741608 4:19246218-19246240 CTTTGGGAGGCGGAGGTGGACGG + Intergenic
971171033 4:24232951-24232973 AAGTGTGATGAGGAGATGGATGG + Intergenic
972170613 4:36341282-36341304 CTTGGTGAGGAGGAGATTAAGGG + Intronic
972366302 4:38378236-38378258 CTGAGTGAGGAAGAGAAAGAAGG + Intergenic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
972510635 4:39765574-39765596 CTTTGGGAGGCCGAGATGGATGG + Intronic
972562258 4:40239033-40239055 CTGTGGGAGGAGGGGAGGTAGGG - Intronic
972782350 4:42297077-42297099 CTTTGTGAGGCCGAGGTGGAAGG + Intergenic
973611812 4:52643161-52643183 CAGCCAGAGGAGGAGATGGAGGG - Intronic
973615034 4:52669884-52669906 CTGTCTGCGGAGAAGATGGAGGG - Intergenic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
973816850 4:54627075-54627097 CTGTGGGAGGCTGAGATGGAGGG - Intergenic
974034213 4:56803174-56803196 CTTTGGGAGGATGAGATGGGAGG + Intergenic
974038054 4:56834381-56834403 CTTTGGGAGGCGGAGATGGGAGG + Intergenic
975112938 4:70647419-70647441 CTTTGGGAGGCGGAGGTGGATGG - Intronic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
976204500 4:82611590-82611612 CTTTGTGAGGCTGAGATGGGAGG + Intergenic
976259088 4:83128636-83128658 CTTTGTGAGGCCAAGATGGAAGG - Intronic
976738714 4:88336532-88336554 CTGTGGGAGGTTGAGATGGGAGG + Intergenic
977689696 4:99893255-99893277 CTTTGGGAGGCCGAGATGGAAGG - Intronic
977870328 4:102082902-102082924 TAGAGAGAGGAGGAGATGGAGGG - Intergenic
978345374 4:107762155-107762177 CCGGGGGAGGAGGAGATGGAAGG + Intergenic
978495783 4:109357933-109357955 CTTTGGGAGGAGGAGTTGGGCGG + Intergenic
978580569 4:110227628-110227650 CTTTGTGGGGCAGAGATGGAAGG - Intergenic
978840702 4:113208744-113208766 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
978849775 4:113320408-113320430 CTCTGGGAGGACGAGGTGGACGG + Intronic
978973064 4:114834268-114834290 CTGTGTGAGGCTGAGGTGGGTGG + Intronic
979241045 4:118447163-118447185 CTTTGTGAGGATGAGATGAGAGG + Intergenic
979267248 4:118717878-118717900 ATGTGGGAGGCTGAGATGGAAGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979483802 4:121247970-121247992 CTATGTGAGGAGGAGGTTGAAGG + Intergenic
980108636 4:128613140-128613162 CTGTGGGAGGCCGAGGTGGATGG + Intergenic
980449919 4:132958187-132958209 CTGTGTCATGAGGATAAGGAGGG + Intergenic
980970956 4:139566539-139566561 CTTTGGGAGGACGAGATGGGTGG + Intronic
981786573 4:148486160-148486182 CTTTGGGAGGAGGAGGTGGGAGG - Intergenic
981980781 4:150788339-150788361 CTTTGGGAGGAGTAGGTGGATGG - Intronic
981982319 4:150809086-150809108 CAGTGTGAGGAGGAAATCCAAGG + Intronic
982185010 4:152787457-152787479 CTGTGTGAGGAAAAGATATATGG - Intronic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982263370 4:153515972-153515994 CTGTGTGAGGTCAAGATGGGAGG - Intronic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983479031 4:168250766-168250788 CTTTGGGAGGCCGAGATGGACGG - Intronic
983518028 4:168677730-168677752 CTCTGTGATGAGGAGATGCAGGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983622220 4:169773652-169773674 CTTTGGGAGGCCGAGATGGATGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984501469 4:180564598-180564620 CTGTGCGAGAAGCAGATGTAAGG - Intergenic
985095338 4:186407537-186407559 CTGTGTGTGGGGGAAAGGGAAGG + Intergenic
985396030 4:189545354-189545376 CTGCGTGCAGAGGAGATGGGTGG + Intergenic
985645031 5:1080737-1080759 CTGTTTGAGGAGGACACAGAGGG + Intronic
985956056 5:3267199-3267221 CTGTGAGTGGAGGAAAGGGAGGG + Intergenic
985982878 5:3487007-3487029 CTTTGGGAGGTGGAGATGGGAGG + Intergenic
985995127 5:3593492-3593514 CTGGGTGGGGAGGAGCTGGGTGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986689861 5:10305432-10305454 TTGTGTGAGGCAGAGCTGGAGGG + Intronic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
987764442 5:22206968-22206990 CTTTGGGAGGCGGAGGTGGATGG + Intronic
987884726 5:23799223-23799245 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
988450600 5:31339126-31339148 CTTTGGGAGGTGGAGATGGCCGG + Intergenic
988898736 5:35708303-35708325 TGGGGTGAGGAGGAAATGGAAGG - Intronic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989052207 5:37332713-37332735 CTGTGGGAGGATGAGGTGGGTGG + Intronic
989781051 5:45264945-45264967 CTGTGGGAGGCTGAGATGGGTGG + Intronic
990128643 5:52551389-52551411 CAATGTGAGGAGGACTTGGAAGG + Intergenic
990181748 5:53168231-53168253 CTGTGGGAAGTGGAGAAGGAGGG + Intergenic
990301567 5:54454205-54454227 CTTTGGGAGGATGAGGTGGAAGG + Intergenic
990397303 5:55395160-55395182 CTGTGGGAGGCTGAGATGGGTGG + Intronic
991008986 5:61861956-61861978 CTGTGGCAGGAAGAGTTGGAAGG - Intergenic
991640141 5:68743768-68743790 CTGAGTGGGGAGGAGATTGCAGG + Intergenic
991899180 5:71440094-71440116 CTTTGGGAGGCGGAGGTGGATGG + Intergenic
991977960 5:72201117-72201139 CTTTGGGAGGCTGAGATGGAAGG + Intronic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
992666798 5:79018280-79018302 CTTTGGGAGGTGGAGGTGGAAGG - Intronic
992841467 5:80699313-80699335 CTATGGGAGGACGAGATGGGTGG + Intronic
992874748 5:81042928-81042950 CGCTGTGAGGAGGAGCAGGATGG + Exonic
992889358 5:81189600-81189622 CTTTGGGAGGCGGAGGTGGAAGG - Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
993507774 5:88732490-88732512 CTGTGTGAGGAGGAAAGCAAGGG - Intronic
994013560 5:94938038-94938060 CTGTCAGAGGTAGAGATGGAGGG - Intronic
994189032 5:96846993-96847015 CTTTGGGAGGCTGAGATGGATGG + Intronic
995518105 5:112974246-112974268 GTGTGTGAGGAGGCAGTGGAGGG + Intergenic
995769064 5:115650606-115650628 CTTTGGGAGGCGGAGATGGGTGG - Intergenic
996523390 5:124451492-124451514 CTGAGGGAAGTGGAGATGGAAGG + Intergenic
996819892 5:127615060-127615082 CTTTGGGAGGACGAGATGGGTGG + Intergenic
996936519 5:128955739-128955761 CTGTGTGATGAGCATATTGAGGG + Intronic
997016448 5:129940973-129940995 CTTTGGGAGGCTGAGATGGAAGG + Intronic
997226948 5:132215916-132215938 CTTTGGGAGGTGGAGATGGGTGG + Intronic
997227958 5:132223503-132223525 CTTTGGGAGGTCGAGATGGATGG - Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997614086 5:135234586-135234608 CTATGTGAGGAAGAGATTGCTGG + Intronic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
997952563 5:138253652-138253674 CTCTGTTTGGTGGAGATGGATGG + Intronic
998085086 5:139314158-139314180 CTTTGGGAGGCTGAGATGGATGG - Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998214887 5:140230113-140230135 CTTTGGGAGGCTGAGATGGATGG - Intronic
998305162 5:141068854-141068876 CTTTGGGAGGCTGAGATGGATGG - Intergenic
998464468 5:142332328-142332350 GTATGTGAGGAGCAGAAGGAAGG + Intergenic
998538467 5:142956330-142956352 CTTTGTGAGGCTGAGATGGGAGG + Intronic
998550273 5:143070664-143070686 CTTTGGGAGGCCGAGATGGATGG + Intronic
998760620 5:145428200-145428222 CTTTGGGAGGCTGAGATGGATGG - Intergenic
999401288 5:151266233-151266255 CTTTGGGAGGTGGAGGTGGAAGG + Intronic
999434329 5:151551420-151551442 CTGTATTGAGAGGAGATGGAAGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000084107 5:157874194-157874216 CTTTGGGAGGACGAGATGGGTGG + Intergenic
1001104897 5:168844500-168844522 CTGTGTGGGGAGGAGAGAGGGGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001976477 5:176003996-176004018 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1002110291 5:176904727-176904749 CTGTGTGAGTACAAGATGAAGGG + Intergenic
1002407409 5:179046572-179046594 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1002705832 5:181160485-181160507 CTGTTTCAGGAGGCGAAGGAAGG + Intergenic
1002904412 6:1437369-1437391 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1003411014 6:5863034-5863056 CTCTGTGAGGAGCAGAGGGCAGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1003778470 6:9396442-9396464 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1004136898 6:12976105-12976127 CTGGGGGAGGGGGTGATGGAAGG + Intronic
1004256278 6:14067804-14067826 CTGTGGGTGGAGCAGTTGGAAGG - Intergenic
1004271419 6:14199501-14199523 CTGGGTGAAGAGGAGAGAGAAGG + Intergenic
1004364502 6:15000386-15000408 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1005011058 6:21336139-21336161 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1005482436 6:26267512-26267534 CTGTGTGAGGTGGGAATTGAAGG + Intergenic
1005566799 6:27104174-27104196 CTTTGGGAGGAAGAGGTGGACGG + Intergenic
1005640863 6:27794813-27794835 TGGTGTGAGAAGGAGATTGAGGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005968736 6:30744601-30744623 CTGCGGGAGGAGGAGTTAGAAGG - Intergenic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1006462550 6:34170887-34170909 CTTTGTGAGGCTGAGATGGGTGG + Intergenic
1006531124 6:34655218-34655240 CTTTGGGAGGCTGAGATGGATGG - Intronic
1006724364 6:36186222-36186244 CTTTGAGAGGCCGAGATGGAAGG - Intergenic
1006863572 6:37190310-37190332 ATGTGTCATGAGGAGTTGGAAGG - Intergenic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007231286 6:40349220-40349242 CCCTGGGAGGAGGAGAGGGAGGG - Intergenic
1007326015 6:41060202-41060224 GCCTTTGAGGAGGAGATGGATGG - Intronic
1007483943 6:42167753-42167775 CTTTGGGAGGACGAGATGGGTGG - Intronic
1007897529 6:45377929-45377951 CTGTGTGACGGGGCGATGGGGGG + Exonic
1007954387 6:45902895-45902917 CTATGTGAGGAGGCCAGGGATGG + Exonic
1008578344 6:52882555-52882577 GTGTCTGAGGAGGAAATGCAGGG - Intronic
1008959109 6:57247636-57247658 CTGTGTGAGGAGGTGTTTCATGG + Intergenic
1008972496 6:57386140-57386162 CTTTGGGAGGAGGAGGTGGGAGG + Intronic
1009425164 6:63505890-63505912 CTTTGGGAGGATGAGGTGGACGG - Intergenic
1009512004 6:64564522-64564544 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1009520122 6:64671006-64671028 CTGTGGGAGGAGGAAATAGTAGG - Intronic
1010506586 6:76667906-76667928 CTTTGGGAGGAGGAGGTGGTTGG - Intergenic
1010745722 6:79559218-79559240 CTTTGGGAGGATGAGGTGGATGG + Intergenic
1011312065 6:85990247-85990269 CTTTGGGAGGCGGAGATGGGCGG - Intergenic
1011634477 6:89358252-89358274 CTTTGGGAGGTGGAGGTGGAGGG + Intergenic
1011637086 6:89384571-89384593 CTTTGGGAGGCTGAGATGGATGG + Intronic
1011742487 6:90376356-90376378 CTGTGTGAAGAGTAGATCAACGG + Intergenic
1012052820 6:94364684-94364706 CTGTGTGAGGAGGAGTTTCGGGG - Intergenic
1012148415 6:95715803-95715825 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1013135960 6:107282965-107282987 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013405273 6:109837739-109837761 CTTTGGGAGGAGGACATGGTTGG + Intergenic
1013501265 6:110754274-110754296 CTTTGTGAGGTGGAGATGGGAGG - Intronic
1014153090 6:118081385-118081407 CTGTGGGAGGCTGAGATGGGAGG + Intronic
1014333132 6:120096196-120096218 CTTTGGGAGGCCGAGATGGACGG + Intergenic
1014409288 6:121094408-121094430 CTTTGGGAGGCTGAGATGGATGG - Intronic
1014417366 6:121198506-121198528 CTTTGGGAGGCCGAGATGGATGG + Intronic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015591805 6:134829591-134829613 CTGTGAGAGGAGGAAAAGAAGGG + Intergenic
1015714421 6:136177217-136177239 CTTTGGGAGGTGGAGATGGGAGG + Intronic
1015819765 6:137248185-137248207 TTGCTTGAGGAGAAGATGGAAGG + Intergenic
1016031952 6:139346956-139346978 CTTTGGGAGGAGGAGGTGGACGG + Intergenic
1017025130 6:150174719-150174741 CTTTGGGAGGTGGAGGTGGACGG + Intronic
1017086464 6:150717421-150717443 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1017144993 6:151226598-151226620 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1017213359 6:151881035-151881057 GTGTGGGAGGCGGTGATGGAAGG + Intronic
1017591522 6:155983118-155983140 TTCTGTTAGGAGGAGAAGGAAGG - Intergenic
1017711515 6:157172988-157173010 CAGAGTGAGGAAGAGAGGGAAGG - Intronic
1017771914 6:157650417-157650439 CCAGGTGAGGAGGAGAAGGACGG + Intronic
1018170315 6:161139103-161139125 CTGTCTGCGGAGGACAGGGAGGG + Intronic
1018458955 6:163979376-163979398 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1018513865 6:164556559-164556581 CCGTGTGAGGACCAGAGGGAAGG - Intergenic
1018633464 6:165840247-165840269 CTGTGTGAGGGAGATAAGGATGG - Intronic
1018853809 6:167661655-167661677 GTGTGGGAGGAGGTGAGGGAAGG - Intergenic
1019165109 6:170093586-170093608 CAGTTTGAGGAGGGAATGGATGG + Intergenic
1019299881 7:297559-297581 CTGTGAGGGGAAGAGATAGATGG + Intergenic
1019436017 7:1022556-1022578 CCGTGGGAGGAGGTGGTGGAGGG - Intronic
1019456814 7:1132447-1132469 CTTTGGGAGGATGAGATGGGAGG + Intronic
1019838699 7:3416927-3416949 CTTTGGGAGGATGAGGTGGATGG + Intronic
1019875656 7:3808311-3808333 TTGAGTGAGGAGCAGATGGAGGG + Intronic
1020183469 7:5940697-5940719 CTGTGGGAGGCCGAGATGGTTGG + Intronic
1020185581 7:5956928-5956950 CTTTGAGAGGCAGAGATGGAAGG + Intronic
1020297335 7:6767828-6767850 CTTTGAGAGGCAGAGATGGAAGG - Intronic
1020299441 7:6784061-6784083 CTGTGGGAGGCCGAGATGGTTGG - Intronic
1020643311 7:10782565-10782587 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
1020807382 7:12807511-12807533 CTGTGGGAGGTGGAGGTGGGAGG - Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1021666743 7:22989599-22989621 CTTTGAGAGGCAGAGATGGAAGG - Intronic
1022411210 7:30139896-30139918 CTGTGTGTGGAGGAAATTCAAGG + Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022797109 7:33740937-33740959 CTTTGAGAGGCTGAGATGGAAGG - Intergenic
1023120371 7:36902952-36902974 TGGAGTGAGGAGGAGCTGGAAGG - Intronic
1023434818 7:40131454-40131476 CTGTGGGAGGCTGAGATGGGTGG + Exonic
1023440037 7:40175986-40176008 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1023769682 7:43545018-43545040 CTGTGGGAGGCAGAGGTGGAAGG + Intronic
1023828123 7:44023434-44023456 CTTTGTGAGGATGAGGTGGGCGG + Intergenic
1024338283 7:48231556-48231578 CGGTGTGAGGAGTAGATTGGAGG + Intronic
1024370024 7:48571932-48571954 CTGTGGGAGGCCGAGGTGGATGG + Intronic
1024444941 7:49466146-49466168 CAGTGTTAGGAGCAGAGGGAAGG + Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025074116 7:55927651-55927673 CTTTGGGAGGCCGAGATGGACGG + Intronic
1025230339 7:57199960-57199982 CTTTGTGAGGCTGAGGTGGATGG + Intergenic
1025873717 7:65460469-65460491 CTTTGGGAGGTGGAGGTGGAAGG + Intergenic
1026049315 7:66931719-66931741 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1026386369 7:69852694-69852716 CTTTGGGAGGCTGAGATGGATGG - Intronic
1026607935 7:71831640-71831662 CTTTGGGAGGAGGAGGTGGGCGG + Intronic
1026716643 7:72795061-72795083 CTTTGGGAGGCCGAGATGGATGG - Intronic
1026730740 7:72909888-72909910 CTGTGGGAGGCCGAGATGGGAGG - Intronic
1026735406 7:72945742-72945764 CTGTCTGAGGAGGGGTTGGGCGG + Intronic
1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG + Intronic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1027113355 7:75458284-75458306 CTGTGGGAGGCCGAGATGGGAGG + Intronic
1027178977 7:75924436-75924458 CTGTGGGAGGCCGAGGTGGACGG + Intronic
1027285605 7:76642879-76642901 CTGTGGGAGGCCGAGATGGGAGG + Intergenic
1028214453 7:88114443-88114465 GTGTGTCTGGAGGTGATGGATGG + Intronic
1028547660 7:92021680-92021702 CTGTGGGAGGCTGAGATGGCTGG - Intronic
1028876391 7:95827909-95827931 CTGGGGGTGGAGGGGATGGAAGG + Intronic
1029171395 7:98631556-98631578 CTTTGGGAGGCCGAGATGGACGG - Intergenic
1029182892 7:98717253-98717275 CTTTGGGAGGCTGAGATGGACGG - Intergenic
1029620261 7:101686041-101686063 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1029756423 7:102576873-102576895 CTTTGTGAGGATGAGGTGGGCGG + Intronic
1029774366 7:102675952-102675974 CTTTGTGAGGATGAGGTGGGCGG + Intergenic
1030211972 7:107005835-107005857 CTTTGTGAGGCGGAGGTGGGTGG - Intergenic
1030360380 7:108589349-108589371 CTCTGGGAGGTGGAGATGCAAGG - Intergenic
1030486859 7:110180086-110180108 CTTTGGGAGGATGAGGTGGAAGG + Intergenic
1030616528 7:111743512-111743534 ATCTGTGATGAGGACATGGAAGG + Intronic
1031544066 7:123031182-123031204 CCGTGTGTGGAAGAGAGGGAGGG - Intergenic
1031604307 7:123749327-123749349 CTGCTTGAAGAGAAGATGGATGG + Intergenic
1031764506 7:125761524-125761546 CTGTGTGAGGTGGTGATGCCTGG - Intergenic
1032015265 7:128375958-128375980 CTTTGGGAGGTGGAGGTGGATGG + Intergenic
1032035350 7:128517393-128517415 CTGTGGGTGGAGGGGCTGGAGGG + Intergenic
1032130639 7:129224951-129224973 GTGGGAGAGGAGGCGATGGAGGG + Intergenic
1032163445 7:129527574-129527596 CTTTGGGAGGATGAGATGGGAGG - Intergenic
1032218456 7:129975783-129975805 CTGTGTGAGGCCGAGGTGGGTGG + Intergenic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033024459 7:137759101-137759123 CTGAGGGAGTAGGAGAGGGAGGG - Intronic
1033421410 7:141207811-141207833 CTTTGGGAGGAAGAGGTGGAAGG + Intronic
1033557723 7:142503291-142503313 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033560178 7:142523348-142523370 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033620553 7:143058479-143058501 GTGTCTGTGGAGGAGAGGGAAGG - Intergenic
1033912964 7:146286860-146286882 CTTTGTGAGGCTGAGGTGGAAGG + Intronic
1034181232 7:149139760-149139782 CTTTGGGAGGCTGAGATGGAGGG + Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034494870 7:151413977-151413999 CTGTGGGAGGCGGAGGTGGGCGG + Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035532061 8:360887-360909 CTTTGTGAGGCTGAGGTGGATGG - Intergenic
1035555661 8:565504-565526 CAGTGGGAGGACGAGAGGGAGGG - Intergenic
1035581426 8:741959-741981 CTGTCTGTGGAGGAGAAGGGCGG + Intergenic
1035583698 8:756152-756174 CTGTGTGAGGATGAGCGGGTTGG + Intergenic
1035753515 8:2012305-2012327 CAGTGACAGGAGGAGAGGGAAGG + Intergenic
1036380223 8:8231834-8231856 CTTTGGGAGGCTGAGATGGACGG + Intergenic
1036530372 8:9579710-9579732 CTGTGTGAGGCCGAGGTGGGCGG - Intronic
1036631509 8:10519111-10519133 CTGTGGGAGGAGCAGAGGGGAGG - Intergenic
1036783124 8:11663878-11663900 CTTTGGGAGGTGGAGATGGAGGG + Intergenic
1037018890 8:13943447-13943469 CAGTGTGAGGAGGATGTGGGAGG - Intergenic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1037963874 8:23118468-23118490 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1038040122 8:23717217-23717239 CTGTCTGGGGAGGAGGTAGAAGG - Intergenic
1038287363 8:26217528-26217550 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
1038330794 8:26607544-26607566 CTTTGGGAGGCTGAGATGGAAGG + Intronic
1038411990 8:27366265-27366287 CTGGGGGATGAAGAGATGGAAGG - Intronic
1038526512 8:28278769-28278791 CTGGGTGAGGGGTAGACGGAGGG + Intergenic
1038571373 8:28665649-28665671 CTTTGGGAGGTTGAGATGGACGG - Intronic
1038770316 8:30472830-30472852 CTGTGGGAGGCCGAGATGGGAGG + Intronic
1039231682 8:35455520-35455542 CTTTGGGAGGCGGAGGTGGACGG - Intronic
1039304892 8:36250786-36250808 CTGTGCCAGGAGGGCATGGAAGG - Intergenic
1039521099 8:38172563-38172585 CTTTGGGAGGTGGAGGTGGATGG - Intronic
1040022565 8:42753974-42753996 CTGGGGGCGGAGGACATGGAGGG + Intronic
1040040762 8:42914871-42914893 CTTTGGGAGGTGGAGATGGGCGG + Intronic
1040762418 8:50865276-50865298 CTGTGTGATGACAAGATGGTAGG - Intergenic
1041028397 8:53710021-53710043 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1041190443 8:55348332-55348354 CTGTGTGGGGATTAGATGGGAGG - Intronic
1041260536 8:56017576-56017598 CAGTGTGAGGGAGAGATTGAAGG + Intergenic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1042236295 8:66616334-66616356 CTTTGGGAGGCTGAGATGGACGG - Intergenic
1042269842 8:66943608-66943630 CTTTGGGAGGCTGAGATGGAAGG - Intergenic
1042557675 8:70047181-70047203 CTGTGGGAGGCGGAGGTGGGTGG - Intergenic
1042657617 8:71117260-71117282 GTGTGGGAGAAGGAGATGTATGG - Intergenic
1043108717 8:76150380-76150402 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1043153230 8:76744654-76744676 CTTTGGGAGGTCGAGATGGACGG - Intronic
1043376150 8:79651972-79651994 CTATGGGAGGAGGAGCAGGAAGG + Intronic
1044336501 8:90989807-90989829 CTTTGGGAGGCCGAGATGGACGG + Intergenic
1044584492 8:93856953-93856975 CTTTGAGAGGCCGAGATGGAAGG + Intergenic
1044971781 8:97627008-97627030 CTTTGGGAGGTGGAGATGGGCGG + Intergenic
1045150414 8:99400913-99400935 CTTTGGGAGGCCGAGATGGACGG - Intronic
1045283587 8:100771172-100771194 AAGTGTGAGGAGGATATGGGTGG - Intergenic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046694016 8:117317957-117317979 CTGCATGATGAGGAGGTGGAAGG + Intergenic
1046943254 8:119951892-119951914 CTTTGAGAGGATGAGATGGGTGG + Intronic
1047204263 8:122790849-122790871 CTTTGTGAGGCTGAGATGGGAGG - Intronic
1047244974 8:123134283-123134305 CTTTGGGAGGATGAGGTGGAAGG + Intronic
1047399779 8:124536305-124536327 CTTTGGGAGGCGGAGGTGGAAGG + Intronic
1047603759 8:126453551-126453573 CTTTGGGAGGCGGAGATGGGCGG + Intergenic
1047782713 8:128123138-128123160 CTGTGGGAGGAGGAAAGGGCTGG - Intergenic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1048609066 8:136002168-136002190 CTTTGGGGTGAGGAGATGGAGGG - Intergenic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1049935988 9:502767-502789 CTTTGTGAGGCCGAGATGGGTGG - Intronic
1050354595 9:4770729-4770751 CTGTGTGAGGTGAAGATTGGAGG - Intergenic
1051071487 9:13173457-13173479 CTTTGGGAGGCGGAGATGGGTGG + Intronic
1051319297 9:15883301-15883323 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1052708210 9:32019020-32019042 CTGTGGGAGGCTGAGATGGGTGG + Intergenic
1053157463 9:35791317-35791339 GTGTGTGAGATGGAAATGGAAGG + Intergenic
1053228219 9:36380735-36380757 CTGTGGGAGGCCGAGGTGGAAGG - Intronic
1053318993 9:37078935-37078957 CTTTGGGAGGCAGAGATGGAAGG + Intergenic
1053439205 9:38101898-38101920 CTTTGGGAGGCAGAGATGGATGG - Intergenic
1053544280 9:39007178-39007200 CTTTGCGAGGACGAGGTGGAAGG - Intergenic
1053808709 9:41830672-41830694 CTTTGCGAGGACGAGGTGGAAGG - Intergenic
1054452014 9:65408349-65408371 ATATGTGAGGAAGAGATGGAAGG - Intergenic
1054621883 9:67356756-67356778 CTTTGCGAGGACGAGGTGGAAGG + Intergenic
1055157201 9:73078962-73078984 CTTTGGGAGGCGGAGGTGGACGG + Intronic
1055434874 9:76282559-76282581 CTTTGGGAGGCTGAGATGGAAGG - Intronic
1055953336 9:81751152-81751174 CTGTGGGAGGCGGAGGTGGACGG - Intergenic
1056307144 9:85301246-85301268 CTTTGAGAGGGTGAGATGGAAGG + Intergenic
1056517914 9:87372431-87372453 CTGTGGGAGGTGGGGTTGGAAGG - Intergenic
1056813834 9:89785656-89785678 CTTTGGGAGGCAGAGATGGATGG + Intergenic
1057016734 9:91658657-91658679 CTCTGTGATGTGGAGAGGGAGGG - Intronic
1057113290 9:92495099-92495121 CTTTGTGAAGTGGGGATGGAAGG + Intronic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1057736232 9:97663933-97663955 CTTTGGGAGGCCGAGATGGATGG + Intronic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1057774939 9:98000220-98000242 CTTTGGGAGGTCGAGATGGAAGG - Intronic
1057865009 9:98673483-98673505 CTCTGAGAGGAGTAGATGAAGGG + Intronic
1058132264 9:101266181-101266203 CTTTGGGAGGCTGAGATGGATGG + Intronic
1058252330 9:102714194-102714216 CCATGTGAGGCTGAGATGGAAGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058689671 9:107508854-107508876 CTTTGGGAGGCCGAGATGGAAGG - Intergenic
1058822108 9:108742170-108742192 CTTTGGGAGGAGGAGGTGGGTGG - Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059452390 9:114378564-114378586 GTGAGTGAGGAAGAGAGGGAAGG + Intronic
1060040998 9:120301052-120301074 CCGAGTGAGGAGGAAATGGCAGG - Intergenic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060301166 9:122375375-122375397 CTGTCTGAGGTGGAGCCGGAAGG - Intronic
1060339205 9:122758753-122758775 CTTTGGGAGGCGGAGGTGGATGG - Intergenic
1060696612 9:125714489-125714511 CTTTGGGAGGCTGAGATGGAGGG - Intergenic
1061081461 9:128373197-128373219 CTGTGACAGGAGGTGATAGAAGG - Intronic
1061522767 9:131130386-131130408 CTTTGGGAGGATGAGACGGACGG - Intronic
1061618179 9:131793866-131793888 GTGTGTGAGGTGGCCATGGATGG + Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061978009 9:134082148-134082170 CTTTGGGAGGCTGAGATGGAAGG + Intergenic
1062035643 9:134381428-134381450 CTGTCTGAGCGGGAGAGGGAAGG + Intronic
1062234724 9:135502354-135502376 CTGTGGGGGGAGGGGATGGGAGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203690612 Un_GL000214v1:38772-38794 CTGTGGGAGGCCGAGGTGGAAGG + Intergenic
1203645683 Un_KI270751v1:65419-65441 CTGTGGGAGGCCGAGGTGGAAGG - Intergenic
1185662196 X:1736306-1736328 CTTTGGGAGGTTGAGATGGAAGG - Intergenic
1185836847 X:3352551-3352573 CTTTGGGAGGGCGAGATGGATGG - Intergenic
1186135247 X:6512538-6512560 CTCTGGGAGGATGAGGTGGAGGG + Intergenic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186252208 X:7680460-7680482 CTGTGTGAGGATGTGATGATGGG - Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1187469721 X:19558334-19558356 ATGTGTGAGGAGGATATACAAGG - Intronic
1187498268 X:19814735-19814757 ATGTTTGAGGAGGAGAAAGAAGG - Intronic
1187760324 X:22576655-22576677 CTTTGGGAGGCCGAGATGGAAGG + Intergenic
1187875356 X:23799222-23799244 CTTTGGGAGGAGGAGGTGGGTGG + Intergenic
1188008244 X:25032670-25032692 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1188048400 X:25454487-25454509 GTGTTTGGTGAGGAGATGGAGGG - Intergenic
1189464150 X:41265358-41265380 CTCTGGGAGGACGAGATGGGTGG + Intergenic
1190018445 X:46849966-46849988 CTCTGTGTGAAGGAGAGGGAGGG - Intronic
1190055765 X:47180189-47180211 CTGTGGGAGGAGGGGAGGCAGGG - Intronic
1190103425 X:47540924-47540946 CTGTGTGAGGCTGAGGTGGGTGG - Intergenic
1190126737 X:47712200-47712222 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1190276041 X:48900005-48900027 CTTTGGGAGGCGGAGGTGGACGG + Intronic
1190394936 X:49972526-49972548 CTGTGTCATGAGGTGATGGCAGG - Intronic
1190443915 X:50503905-50503927 TTCTGGGAGGAGAAGATGGAAGG + Intergenic
1190649556 X:52555816-52555838 GTATATGAGGATGAGATGGAAGG - Intergenic
1190679683 X:52814349-52814371 CTGTGTTAATAGGATATGGAAGG + Intronic
1190724242 X:53177003-53177025 CTTTGTGAGGCCAAGATGGAAGG + Intergenic
1190777695 X:53566360-53566382 CTGTGGGAGGCTGAGATGGGAGG + Intronic
1190840477 X:54139582-54139604 CTTTGGGAGGCCGAGATGGACGG - Intronic
1190888236 X:54547789-54547811 CTGTGTGAGGAATTGAGGGAGGG + Intronic
1191672982 X:63766270-63766292 CACTGAGAGGAGGAAATGGAGGG + Intronic
1191737253 X:64399876-64399898 CTTTGTGAGGTGGAGCTGGGAGG - Intergenic
1192112864 X:68383077-68383099 CTTTGTGAGGCCGAGATGGGAGG + Intronic
1192192418 X:68999452-68999474 CGGTGGGAGGAGGAGAGGGGTGG + Intergenic
1192675733 X:73193976-73193998 CTTTGGGAGGCTGAGATGGATGG + Intergenic
1192819185 X:74625749-74625771 CTTTGTGAGGCCGAGATGGATGG + Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194318169 X:92408124-92408146 CTTTGTGAGGCCGAGGTGGATGG - Intronic
1194591149 X:95801309-95801331 CTGTGTGAGGAAAAAATGTATGG - Intergenic
1194606971 X:95992710-95992732 CTTTGAGAGGTGGAGATGGGAGG + Intergenic
1195077809 X:101344090-101344112 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1195129567 X:101839752-101839774 CGATGTGAGGTGGAGAAGGAGGG + Intronic
1195168865 X:102246893-102246915 GTGTGTGAGGTGGAAAGGGAGGG - Intergenic
1195176672 X:102320077-102320099 CGATGTGAGGTGGAGAAGGAGGG - Intronic
1195182192 X:102367016-102367038 CGATGTGAGGTGGAGAAGGAGGG + Intronic
1195189992 X:102440193-102440215 GTGTGTGAGGTGGAAAGGGAGGG + Intronic
1195630160 X:107047500-107047522 CTGTGGGAGGCGGAGGTGGGAGG - Intergenic
1195910154 X:109881210-109881232 CTTTGTGAGGCCGAGATGGGTGG - Intergenic
1195926425 X:110030361-110030383 CTTTGGGAGGCAGAGATGGAAGG - Intronic
1196012616 X:110904727-110904749 CTGTGGGAGGCTGAGATGGGTGG - Intergenic
1196705399 X:118713006-118713028 CTTTGGGAGGCCGAGATGGACGG - Intergenic
1197213980 X:123851106-123851128 TTGTGGGAGGAAGAGAGGGAAGG - Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1197954140 X:131928893-131928915 CTTTGTGAGGCTGAGATGGGTGG - Intergenic
1198076875 X:133202107-133202129 CTTTGTGAGGCCGAGATGGGTGG - Intergenic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1199649966 X:149940444-149940466 CTGCGGGAGGAGGAGCTGGGGGG + Intergenic
1199849869 X:151717840-151717862 CTCTGAGAGGAGGAGGCGGACGG + Intronic
1200122959 X:153799938-153799960 CTTTGGGAGGCCGAGATGGATGG - Intergenic
1200184203 X:154171043-154171065 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200189856 X:154208171-154208193 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200195609 X:154245980-154246002 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200201262 X:154283101-154283123 CTGTGTGCTGAGGAGAAGCACGG - Intronic
1200626339 Y:5521412-5521434 CTTTGTGAGGCCGAGGTGGATGG - Intronic
1200771470 Y:7129414-7129436 CTTTGGGAGGATGAGATGGGAGG - Intergenic
1201239724 Y:11947184-11947206 CTTTGGGAGGGCGAGATGGATGG + Intergenic
1201434154 Y:13938951-13938973 ATGGGTGAGGGGGAGAGGGAAGG - Intergenic
1201476173 Y:14383856-14383878 GGGTGTGAGGAGGAGATGGAGGG - Intergenic
1201611629 Y:15849320-15849342 CTTTGGGAGGCTGAGATGGATGG - Intergenic
1202065597 Y:20936181-20936203 CTTTGGGAGGCGGAGATGAATGG + Intergenic