ID: 902988527

View in Genome Browser
Species Human (GRCh38)
Location 1:20170602-20170624
Sequence CTCGCTCTCAGCCCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902988522_902988527 29 Left 902988522 1:20170550-20170572 CCTGGGGCTCAGCACATGTCAGC 0: 1
1: 0
2: 1
3: 30
4: 311
Right 902988527 1:20170602-20170624 CTCGCTCTCAGCCCTGCTCCTGG 0: 1
1: 0
2: 4
3: 40
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902988527 Original CRISPR CTCGCTCTCAGCCCTGCTCC TGG Intronic
900108307 1:995534-995556 CTCACTCTCAGCCCATCACCTGG + Intergenic
900171954 1:1273638-1273660 CGCGCTCGCAGGCCTGCGCCGGG - Intronic
900577735 1:3392035-3392057 CTGGGTCTCAGTGCTGCTCCCGG - Intronic
900601115 1:3503050-3503072 CTGGCTCTCAGCCCCGCTGTGGG - Intronic
900680689 1:3914727-3914749 GTGGCCCTCGGCCCTGCTCCAGG + Intergenic
900914842 1:5629596-5629618 CTCCCACTCAGTCCTGCTGCAGG + Intergenic
901535996 1:9883325-9883347 CTCCCTCTCTGCCCTGCACCTGG - Intronic
901678168 1:10898729-10898751 CGCCCTCTCAGCCCTGGGCCTGG - Intergenic
902078143 1:13803560-13803582 CTCGCTCACAGTCATACTCCAGG - Intronic
902451753 1:16500809-16500831 ACAGCTCTCAGCCCTGGTCCAGG - Intergenic
902501195 1:16912856-16912878 ACAGCTCTCAGCCCTGGTCCAGG + Intronic
902605898 1:17569221-17569243 TTGGCTCTGAGCACTGCTCCAGG - Intronic
902619842 1:17644424-17644446 CACGCCCTCGGCCCTACTCCTGG - Intronic
902988527 1:20170602-20170624 CTCGCTCTCAGCCCTGCTCCTGG + Intronic
903018427 1:20376984-20377006 CTTGCTCCCAGCCCTGCCCTGGG + Intergenic
903019991 1:20387036-20387058 CTCCCCCTCAGCCCTGCCTCGGG - Intergenic
903130331 1:21275133-21275155 CTCACTCTCAGCCTGTCTCCTGG - Intronic
903153233 1:21428070-21428092 CTCCCGCTCGGCCCCGCTCCCGG - Intergenic
903424398 1:23242886-23242908 CTCCCTCTCACCCCTACCCCAGG - Intergenic
904131790 1:28280989-28281011 TGGGATCTCAGCCCTGCTCCTGG + Exonic
904474786 1:30757795-30757817 CCCCTTCTCTGCCCTGCTCCAGG - Exonic
904749681 1:32733817-32733839 TTCACTCGTAGCCCTGCTCCTGG + Intergenic
905336285 1:37246838-37246860 CTGGCTCCCGCCCCTGCTCCGGG - Intergenic
905629519 1:39510941-39510963 CTCACCCTGAGCCCTGCACCTGG - Intronic
906225538 1:44118721-44118743 CGCCCTCGCAGCCCTGCCCCAGG - Intergenic
908073496 1:60489689-60489711 CTCTCTCTCTGCACTGTTCCTGG - Intergenic
910107046 1:83642846-83642868 CTCCCTCTCCTCCCTGCCCCTGG - Intergenic
910608332 1:89112035-89112057 AACGCTCTCAGCCCAGTTCCTGG + Intronic
915313789 1:155017265-155017287 GTCCCCCTCCGCCCTGCTCCCGG + Exonic
915731645 1:158058407-158058429 CTCCCTCCCTGCCCTGCCCCAGG + Intronic
916464928 1:165064256-165064278 GTCTCTATCAGCCCTGCTACAGG - Intergenic
917090970 1:171352770-171352792 CACACTCTCAGCTCTGCTCCAGG + Intergenic
918142810 1:181732896-181732918 CTGGCTGGCAGACCTGCTCCGGG - Exonic
918283112 1:183024167-183024189 CTCGCCAGCAGCCCAGCTCCCGG + Intronic
920974386 1:210771981-210772003 CTAGCTCTCAGCTCTGCTCTTGG - Intronic
922502923 1:226110197-226110219 CGCGCTCTCCGCACTGCTCTTGG - Intergenic
923087104 1:230710251-230710273 CTGGCTATCAGCCCTGCCCTGGG + Exonic
923656784 1:235923882-235923904 CTCGCTTCCTGCTCTGCTCCAGG - Intergenic
1062909482 10:1203546-1203568 CTGGCTGTCAGGCCTGCTGCTGG + Intronic
1062969891 10:1639289-1639311 CAGGCTCTAAGCCCTGCTCTAGG - Intronic
1064148748 10:12845268-12845290 CTCACGCTCTTCCCTGCTCCGGG - Intergenic
1064591022 10:16890878-16890900 GTGGAACTCAGCCCTGCTCCTGG + Intronic
1067038932 10:42938417-42938439 CTTGCCCCCAGCCCAGCTCCTGG + Intergenic
1067158167 10:43800030-43800052 CTCACTCACTGCCCTGCCCCTGG - Intergenic
1067785317 10:49241577-49241599 CTTGCTCTCAGTCCTGAGCCTGG - Intergenic
1067795283 10:49316790-49316812 CTCGGTCTCACACCTGCTCTTGG + Intronic
1069724067 10:70566245-70566267 CTCCCTTTAGGCCCTGCTCCTGG + Intronic
1072521743 10:96235803-96235825 CTGCCTCTAAGCCCTGCTTCTGG - Intronic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1074354324 10:112768681-112768703 CCCACCCTCACCCCTGCTCCAGG - Intronic
1074368183 10:112876971-112876993 CTCTATGTCAGCCCTCCTCCAGG - Intergenic
1074531585 10:114302146-114302168 CTTGCTCTTAGCTCAGCTCCTGG + Intronic
1075823589 10:125334704-125334726 CTGGCTCCCAGGCCTGCTACTGG + Intergenic
1076011183 10:126989961-126989983 CTCGCTCTCAGCTCAGCTATAGG - Intronic
1076794453 10:132791855-132791877 CTCAGCCTCAGCCCTGCTGCGGG + Intergenic
1076889343 10:133276291-133276313 CTGGATCCCACCCCTGCTCCTGG - Intronic
1076920945 10:133454406-133454428 CAGGACCTCAGCCCTGCTCCAGG - Intergenic
1077050043 11:562494-562516 CTCGCTCCCGGGCCTGCTCCCGG - Exonic
1077197940 11:1290760-1290782 CTGGCTCTCAGCTCTGTCCCGGG - Intronic
1077219894 11:1411238-1411260 CTTCCTCACAGCCTTGCTCCTGG + Exonic
1077252372 11:1566343-1566365 CAAGCTCTCTGCCCTCCTCCGGG + Intronic
1077332959 11:1991324-1991346 CCCGCTCCCTGGCCTGCTCCTGG - Intergenic
1077452413 11:2656409-2656431 TTCACTCTGAGCCCTTCTCCTGG + Intronic
1077672027 11:4166157-4166179 CTCTGTCTCACCCCTGCTCTAGG + Intergenic
1078210397 11:9265341-9265363 CGCGCTCTCCGCCCTTCTCCAGG - Exonic
1078779523 11:14423727-14423749 CTCTCTTTCAGCCTTGCTCCCGG - Intergenic
1080693159 11:34576490-34576512 CAGCCTCTCTGCCCTGCTCCAGG + Intergenic
1081634527 11:44712094-44712116 CCGGCTCCCAGCCCTACTCCAGG + Intergenic
1081659256 11:44877889-44877911 CTCCCTCTCCCCACTGCTCCTGG + Intronic
1083859264 11:65411345-65411367 AGCGTCCTCAGCCCTGCTCCAGG - Exonic
1083902989 11:65652675-65652697 CTCGCTCCAAGCCCCGCCCCTGG + Intergenic
1084026887 11:66456154-66456176 CTCCCTCCCTCCCCTGCTCCAGG - Intronic
1084528497 11:69712576-69712598 CTGGCTCTCCGCCTTGCTGCAGG - Intergenic
1085875092 11:80397131-80397153 CTTGCCCACAGCCCTGCTACTGG - Intergenic
1086205613 11:84255032-84255054 CTCTCCCACTGCCCTGCTCCAGG + Intronic
1086956012 11:92935078-92935100 CACCCTCTCATCCCTGCACCAGG + Intergenic
1088590042 11:111395375-111395397 CCTGCTCCCATCCCTGCTCCCGG + Intronic
1089638663 11:119832788-119832810 CTCACTAGCAGCGCTGCTCCTGG - Intergenic
1089672165 11:120064068-120064090 CATGCCCTCTGCCCTGCTCCAGG - Intergenic
1089733758 11:120535470-120535492 CCTGCCCTCAGCACTGCTCCAGG - Intronic
1089789461 11:120932280-120932302 CTGACTCTCTGCCCTGCACCAGG - Intronic
1090268770 11:125371265-125371287 CCCCCTCTCAGTGCTGCTCCTGG - Intronic
1090847932 11:130546246-130546268 CTCCCAGTCAGTCCTGCTCCTGG + Intergenic
1090978835 11:131698727-131698749 CTTGCTCTCAGCCCAGTGCCAGG + Intronic
1091196188 11:133732749-133732771 GCTGCTCTGAGCCCTGCTCCAGG + Intergenic
1091218267 11:133916759-133916781 CTAGCTCTCACCCCAGCTCCTGG - Intronic
1091324560 11:134676665-134676687 CCTGCTCTGAGCTCTGCTCCCGG - Intergenic
1202815942 11_KI270721v1_random:46500-46522 CCCGCTCCCTGGCCTGCTCCTGG - Intergenic
1092094253 12:5828277-5828299 CTCCCTGTCAGCCGGGCTCCAGG - Intronic
1092229796 12:6770075-6770097 GTCGCCCTCAGCCCTGCTTCAGG - Intronic
1093711239 12:22332734-22332756 CTCCTTCTCAGGCCTCCTCCTGG - Intronic
1095476285 12:42589927-42589949 CCTGCTCGCAGCCCTGCCCCCGG - Intronic
1095476818 12:42593984-42594006 CTGGCTGTCAGGCGTGCTCCCGG + Intergenic
1095980862 12:47974022-47974044 CCAACCCTCAGCCCTGCTCCAGG + Intronic
1096255405 12:50059143-50059165 CCCTCCCTCAGCCCTGCTCCTGG + Intronic
1096493187 12:52023905-52023927 CTCGCCCCCGGCCCGGCTCCTGG + Intronic
1096540703 12:52305364-52305386 CTCGGCCTCAGCCCGGCTACGGG - Exonic
1096542659 12:52316877-52316899 CTCGGCCTCAGCCCGGCTACGGG + Exonic
1096795785 12:54076791-54076813 CTATGCCTCAGCCCTGCTCCAGG - Intergenic
1097157572 12:57024009-57024031 CTGGCTCTCGGCTCTGATCCTGG - Intronic
1098803042 12:74985802-74985824 CCCGCCCTCAGCCCTGCCCTTGG + Intergenic
1099915077 12:88882839-88882861 CCCCCTCTCAGTCTTGCTCCTGG + Intergenic
1100595763 12:96070716-96070738 CCCCCTCCCAGCCCTGCTGCAGG - Intergenic
1100995485 12:100295931-100295953 CTGGCTCTAAGCCCAGCCCCAGG + Intronic
1102037969 12:109782972-109782994 CTCACTCTCACCCCTGCCCCTGG + Intergenic
1102222125 12:111201666-111201688 CACCTTCTCAGCCCTGCACCTGG + Intronic
1102933515 12:116879602-116879624 GGCGCTCTCTGCCCGGCTCCCGG - Intronic
1103920456 12:124396695-124396717 CTCGCCCTCAGAGCTCCTCCGGG - Intronic
1103939016 12:124491951-124491973 CTCAGCCTCAGCCATGCTCCAGG - Intronic
1104082070 12:125437798-125437820 CTCCCCCTTAGCCCTGCTCCTGG - Intronic
1104091539 12:125521745-125521767 CCCGCTCCCAGCCCTGCCTCAGG - Intronic
1104232651 12:126900155-126900177 CTCTTCCTCAGCCGTGCTCCAGG - Intergenic
1104713754 12:131003640-131003662 CTTGCTCTCAGCTGGGCTCCAGG + Intronic
1104860465 12:131920868-131920890 AGCGCTCTCAGCCCGGCCCCAGG - Intronic
1107566465 13:41610433-41610455 GTTGCTCTCAGCCCTTCTGCTGG - Intronic
1111072219 13:83184039-83184061 CCTGCTCCCACCCCTGCTCCAGG - Intergenic
1111859602 13:93685222-93685244 CTGGCTCTCAGTCCTACTACAGG - Intronic
1113546202 13:111153373-111153395 CTCGGCCTCCTCCCTGCTCCAGG - Intronic
1113650877 13:112033461-112033483 CTGTCTGCCAGCCCTGCTCCAGG - Intergenic
1114417178 14:22552656-22552678 CTTCCTCTCAACCTTGCTCCTGG - Intergenic
1114613057 14:24054579-24054601 CTCCTTCTCAGCCCTGGCCCAGG - Intronic
1114720741 14:24879457-24879479 CTTGCCCTCCTCCCTGCTCCAGG + Intronic
1115052134 14:29075436-29075458 CTCTCTCTCTACCCTGCTCAGGG - Intergenic
1119569856 14:75660883-75660905 CCCTCCCTCAGCCCTGCTCCAGG + Exonic
1121453601 14:94024847-94024869 CTCACTCTCTGCCCTTCTTCAGG - Intergenic
1121507357 14:94486995-94487017 CTCCCCCACAGCCCTGCCCCAGG - Intergenic
1122324863 14:100875914-100875936 CCCGCTCAGAGCCCTGCTGCGGG - Intergenic
1202860934 14_GL000225v1_random:80414-80436 CTGGCTCTTAGGACTGCTCCAGG + Intergenic
1124337876 15:28870648-28870670 CCCACTCTCAGACCTGGTCCAGG + Intergenic
1124339323 15:28879802-28879824 CCGGCTCACAGCTCTGCTCCTGG + Intergenic
1128086792 15:64892186-64892208 CTTGCTCCCAGCACTGCTCAGGG + Intronic
1128322222 15:66701992-66702014 CTCGCTCGCATCCGTGCTCTGGG + Intergenic
1128566023 15:68700767-68700789 CGTGCTCCCAGCCCTTCTCCTGG + Intronic
1128611074 15:69074170-69074192 CCTGCACCCAGCCCTGCTCCGGG - Intergenic
1128739176 15:70071905-70071927 CTCGCTCTCTGCTCTCCTCGAGG + Intronic
1129454115 15:75667414-75667436 CTCGCTCTCAGCCCAGCACCGGG + Intergenic
1129661205 15:77554079-77554101 CTCTCTGTTAGCTCTGCTCCAGG + Intergenic
1129763911 15:78149246-78149268 CTCGCTCGCTGCCCCGCCCCTGG - Intronic
1130060258 15:80564440-80564462 CTCAGCCTCTGCCCTGCTCCTGG + Intronic
1130545846 15:84857349-84857371 CTAGCTGTCAGCCCAGTTCCAGG - Exonic
1131472645 15:92710135-92710157 CTAGCTCTCAGCACAGTTCCCGG - Intronic
1131777982 15:95823118-95823140 CTGGCTCTCCGCCCTGCTCCTGG - Intergenic
1132402755 15:101523510-101523532 CTGGCTGTCAGGCTTGCTCCTGG - Intronic
1132677141 16:1125502-1125524 CCCACTCCCAGTCCTGCTCCCGG - Intergenic
1133767350 16:8847300-8847322 ATCCCTGGCAGCCCTGCTCCCGG + Intronic
1134034653 16:11020556-11020578 CTCTCTCCCTGCCCTGCTCCTGG + Intronic
1134849823 16:17470736-17470758 CTCGCACTCGGCGCTGCTCGCGG - Exonic
1135475998 16:22775636-22775658 ATCGCTCCCATCCGTGCTCCTGG - Intergenic
1135852841 16:25980268-25980290 CGTGCTCTCAGCCCTCTTCCTGG + Intronic
1136397744 16:30002289-30002311 CTCCCCCTCTGACCTGCTCCGGG - Intronic
1137564545 16:49524921-49524943 CTAGCTCCCATCCATGCTCCAGG - Intronic
1137676416 16:50305825-50305847 CGCGCTCAAAGCCCTTCTCCAGG - Exonic
1137871799 16:51956910-51956932 CTCCCTCTCAGCCCTGGCCTTGG + Intergenic
1138278060 16:55750606-55750628 CTCTCTCTCTTCCCTGATCCAGG - Intergenic
1141334092 16:83138768-83138790 CTCTTTGTCACCCCTGCTCCTGG - Intronic
1141663572 16:85454304-85454326 CTCGCCCTCAGCCCTGGTGGTGG + Intergenic
1141685131 16:85565816-85565838 CTGGGTCTCGGCCATGCTCCAGG + Intergenic
1141855921 16:86681527-86681549 CCCGCCCTCTGCCCAGCTCCTGG - Intergenic
1142174865 16:88640499-88640521 CTCCCGTTCAGCCCTGGTCCAGG + Intergenic
1142357097 16:89606320-89606342 CTGGGTGTCAGCTCTGCTCCAGG + Intergenic
1142891718 17:2948236-2948258 CTCGCTAAAATCCCTGCTCCTGG - Intronic
1143026816 17:3945855-3945877 CCCGCTCTCCTCCCTACTCCTGG + Intronic
1143533635 17:7522346-7522368 CTCGTTCTCTGCTCTGCTTCTGG + Intergenic
1144026417 17:11279877-11279899 CACGCTCTCAGTGCTGCTCTGGG + Intronic
1144222783 17:13115007-13115029 CTCGCTCTCAGTCCTCCCTCTGG + Intergenic
1144641918 17:16942246-16942268 CTCGGTCTTAGACCTGCACCCGG + Intronic
1146493769 17:33302432-33302454 CTGGCTCTCACCTCTGCTTCAGG + Intronic
1146701098 17:34961121-34961143 CTCATTCTCATCCCTGCTCTGGG - Intronic
1147256560 17:39185356-39185378 CCTGCTCCCAGCCCTGATCCAGG - Intronic
1148161694 17:45453865-45453887 CTCTCCCTCAGACCTGCTCTCGG - Exonic
1148204934 17:45774282-45774304 CTCCTTCCCAGCCTTGCTCCGGG - Intergenic
1148735613 17:49863026-49863048 CCCACTCCCAGCCCTGCCCCAGG - Intergenic
1149332816 17:55604250-55604272 ATGGCTCTCAGCTCTGGTCCAGG - Intergenic
1149430339 17:56592633-56592655 CCCGCTATGAGCCCTGCACCTGG - Intergenic
1150392931 17:64800510-64800532 CTCTCCCTCAGACCTGCTCTCGG - Intergenic
1151321383 17:73354640-73354662 CTCTCTGTCTGGCCTGCTCCAGG + Intronic
1151380104 17:73719874-73719896 CGCTCTTTCATCCCTGCTCCTGG + Intergenic
1151457411 17:74234166-74234188 AAAGCTCTCAGCCCTGCCCCAGG - Intronic
1151569699 17:74920088-74920110 CTCGCTCTCGGGCCTGCAGCTGG - Exonic
1151595466 17:75075772-75075794 CTCACTCTCAGCCATGATCCAGG - Intergenic
1151731702 17:75915148-75915170 CACGCTCTCAGTCCTGCCCTGGG - Intronic
1152242039 17:79165890-79165912 CCGGCTCCCAGCCCTGCTGCAGG - Intronic
1152384770 17:79965805-79965827 CTCCCCTTCACCCCTGCTCCTGG + Intronic
1152627982 17:81396956-81396978 CCCACTCCCAGCCCAGCTCCAGG - Intronic
1152903473 17:82958134-82958156 CTCTCCCTCAACCCTGCTCCTGG + Intronic
1153888853 18:9493893-9493915 CTCTCTCTCTGGCCTTCTCCTGG + Intronic
1155246936 18:23919736-23919758 CTCTCTCTCAGCACTGCCTCTGG - Intronic
1155297399 18:24397815-24397837 CTCGCGCTCCGCCGTGGTCCCGG - Exonic
1157812368 18:50706494-50706516 CGGGCTCTCAGACCTGCTACAGG - Intronic
1158259260 18:55589414-55589436 CTGGTACTCAGTCCTGCTCCAGG + Intronic
1158387138 18:57007914-57007936 CCTGCACTCAGCCCTGTTCCTGG - Intronic
1158763675 18:60421847-60421869 CTCGCTCTCAGGCCTGTGCTGGG - Intergenic
1160541661 18:79627324-79627346 CTCGCCTGCAGCCCTGTTCCTGG - Intergenic
1160681275 19:412674-412696 CTCGCAGACAGTCCTGCTCCTGG - Intergenic
1160682263 19:417237-417259 GGGGCTCTCAGCCCTCCTCCTGG - Exonic
1161043842 19:2123969-2123991 CTCCCTCCCATCCCTCCTCCCGG - Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161214162 19:3085019-3085041 CTCGCTCGCAGCTCTGTGCCAGG + Intergenic
1161723607 19:5916487-5916509 CTGGCTCTTGGCCATGCTCCAGG + Exonic
1161771149 19:6231352-6231374 CTCACTCACAGCCCTTTTCCAGG - Intronic
1162379449 19:10323019-10323041 CTCCCCCTCGGCCCTACTCCTGG + Intronic
1163008237 19:14409525-14409547 CTCGCACTCACCGCTCCTCCTGG + Exonic
1163364622 19:16869113-16869135 CTGTCGCTCAGCCCAGCTCCAGG - Intronic
1163786957 19:19279668-19279690 CTCGCTGTGACCCCTCCTCCAGG - Intronic
1164766662 19:30777561-30777583 CAGGCTCTCAGGCCAGCTCCAGG + Intergenic
1166565284 19:43761359-43761381 CTCCATCTCAGCCCCTCTCCAGG - Intergenic
1167239056 19:48332514-48332536 CTCGCTCCCAACCTGGCTCCCGG - Exonic
1167249169 19:48391544-48391566 CTCGCTCTCCTCCCTCTTCCCGG - Exonic
1167331676 19:48860093-48860115 CACGCACTCAGCTCTGCTCCAGG - Intronic
1168323759 19:55526334-55526356 CCTGCTGTCAGCCCCGCTCCAGG + Intergenic
925058317 2:872104-872126 CTCCCTCTCAGCCTGGCACCCGG - Intergenic
925204900 2:1997264-1997286 CTCGCTCTAAGCTCTACTCCTGG + Exonic
927498423 2:23565703-23565725 CTCGGACACAGCTCTGCTCCTGG - Intronic
927718497 2:25367962-25367984 ATACCTCTCAGCCCTGCACCAGG - Intergenic
930743770 2:54860363-54860385 CTCCTTCTCAGAACTGCTCCAGG - Intronic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931443614 2:62308500-62308522 CTCTCTCTCAGGCCTGCTTAGGG - Intergenic
932354791 2:71059889-71059911 CGCGCCCTCAGCCTTGCTCTGGG + Intergenic
932456376 2:71852337-71852359 CACGCTCTCGGCCCGGCTCCAGG - Intergenic
932576154 2:72963496-72963518 TTCGCTCTCAGGCCTGCTCTGGG - Intronic
934663245 2:96154241-96154263 CCCTCACTCGGCCCTGCTCCTGG - Intergenic
934713884 2:96532075-96532097 CTGCCACTCAGCCCTGCCCCCGG - Intergenic
934735122 2:96686138-96686160 CTGGCTCCCAGCCCTGCTGCAGG - Intergenic
935652384 2:105393243-105393265 CTCCCTATCAACCCTGCTGCAGG + Intronic
936347612 2:111687223-111687245 TTCTCTCTCTGCCCTGCTCTGGG - Intergenic
936353229 2:111729327-111729349 CTCCCTCCCAGCCCCGTTCCAGG - Intergenic
937960729 2:127455933-127455955 GTCACTCTCAGCCCTGCAGCTGG - Intronic
938073148 2:128318773-128318795 CTCCCGCTCGGCCCCGCTCCCGG + Intergenic
938185424 2:129227589-129227611 CTGGTTCACAGTCCTGCTCCTGG + Intergenic
938727545 2:134120928-134120950 GGCGCGCTCAGCCCTGCTGCCGG + Intronic
944671120 2:201995427-201995449 CTCCATCTCATCCCTCCTCCTGG - Intergenic
945251586 2:207769557-207769579 CTCGCCCTCCGTCCGGCTCCCGG - Exonic
946122281 2:217526542-217526564 CCTGCTCTCCTCCCTGCTCCAGG - Intronic
946143022 2:217707393-217707415 CTCCCTCTGAGCCCTGTTCCTGG - Intronic
947462888 2:230318464-230318486 CCCACACTCAGGCCTGCTCCTGG - Intergenic
947546231 2:231012164-231012186 CTCTCGCTCAGCCCTGCCGCTGG - Intronic
1169134676 20:3190168-3190190 CTGGCTCTCAGCCCTACTTAGGG + Intergenic
1169383203 20:5126815-5126837 CTCGCTCCGAGCCCTGCTCCCGG + Exonic
1169499883 20:6148784-6148806 CTCCCCCTCAACCCAGCTCCTGG - Intergenic
1170705832 20:18744206-18744228 GTCGCCCTCAGCCCCGCTGCTGG - Exonic
1171880464 20:30614664-30614686 CTGGCTCCAAGCCCTGGTCCAGG - Intergenic
1171949897 20:31412082-31412104 CTTGCTCTCAGCACTGCAGCAGG + Intronic
1172098469 20:32472275-32472297 CTTGGTCTCTGCCCTGCCCCTGG - Intronic
1172352623 20:34255265-34255287 CTCGTTCTCAATCCTGTTCCTGG + Intronic
1173468286 20:43301894-43301916 CTGGAACTCAGCCCTGCCCCAGG + Intergenic
1173614409 20:44393426-44393448 CCTGCTCTCTGCCCTTCTCCTGG + Intronic
1173624905 20:44465720-44465742 CTCACCCTCAGGCCTGCTTCAGG + Intergenic
1175523626 20:59618728-59618750 CAGGCTCTCGGCCCTGCTCAGGG - Intronic
1175523633 20:59618766-59618788 CAGGCTCTCGGCCCTGCTCAGGG - Intronic
1175523640 20:59618804-59618826 CAGGCTCTCGGCCCTGCTCAGGG - Intronic
1175523647 20:59618842-59618864 CAGGCTCTCAGCCCTGCTCAGGG - Intronic
1175715542 20:61252549-61252571 CTCGCTCTCCGGCGCGCTCCGGG + Exonic
1175879680 20:62250025-62250047 CTCACTCTGAGCTCAGCTCCAGG + Intronic
1175891954 20:62319645-62319667 CTGGCTCTGAGCCCTGAGCCTGG + Intronic
1178633559 21:34282930-34282952 CTCACTCTCAGGCGAGCTCCAGG - Intergenic
1178890839 21:36520063-36520085 CTCCCTCTGAGGCCTCCTCCAGG + Intronic
1179427155 21:41290603-41290625 CACGCTCTCCGCCCCGCCCCAGG + Intergenic
1179948845 21:44698373-44698395 CCCAGTCTCAGCCCTTCTCCAGG + Intronic
1180082186 21:45491973-45491995 CCTGCTCTCAGCTCTGCCCCGGG - Intronic
1180084584 21:45502118-45502140 CTCGGGCTGGGCCCTGCTCCGGG - Intronic
1180153585 21:45965947-45965969 CTCTCTCTCCCTCCTGCTCCAGG + Intergenic
1181030440 22:20146863-20146885 CACTCCCTCAGCCCTGCCCCTGG - Intronic
1182749200 22:32628160-32628182 CACACCCTCAGCCCTGCTCTCGG + Intronic
1182762123 22:32731123-32731145 CTAGTGCTCAGCCCAGCTCCTGG + Intronic
1183022095 22:35035431-35035453 CACACCCTGAGCCCTGCTCCAGG + Intergenic
1183278030 22:36913692-36913714 CCACCCCTCAGCCCTGCTCCTGG - Intronic
1184128281 22:42502422-42502444 TTCCCTCCCAGCCCTACTCCGGG - Intergenic
1184137071 22:42555735-42555757 TTCCCTCCCAGCCCTACTCCGGG - Intronic
1184568989 22:45310280-45310302 CTCCCTCTCAGCTCTTCCCCTGG + Intronic
1185015219 22:48338936-48338958 CTCCCTCCCAGCCCAGGTCCAGG + Intergenic
1185050858 22:48553335-48553357 GTCGGTCTCAGCTCTGTTCCTGG + Intronic
1185078016 22:48693707-48693729 CTCTCTCTCAGTCCTGCTCCGGG + Intronic
1185221358 22:49630586-49630608 CTCGTTCTGGGCCCTTCTCCCGG - Intronic
1185289377 22:50015987-50016009 GCCTCTCTCAGCCCTCCTCCAGG + Intronic
1185364993 22:50433338-50433360 CGCGCCCCCAGCCCTCCTCCAGG - Intronic
1185365055 22:50433524-50433546 CGCGCCCCCAGCCCTCCTCCAGG - Intronic
950011749 3:9729016-9729038 CTCTCTCTCAGCTCTCTTCCTGG - Intronic
950682413 3:14594304-14594326 CCCTCCCTCAGCCCTGCCCCGGG + Intergenic
951543751 3:23806389-23806411 CTCCCTCCCACCCCCGCTCCCGG - Intronic
953995189 3:47513935-47513957 CTCGCTCTCTGCCCAGCCCCGGG + Intergenic
954215477 3:49122067-49122089 CTCATCCTCAGCCCAGCTCCTGG + Exonic
954284745 3:49610948-49610970 TTCACACTCAGCCCTGCTCTAGG - Intronic
954292116 3:49655225-49655247 CTGGCTCTCAGGCCTCATCCCGG - Exonic
955261465 3:57395283-57395305 CTCTCTCTCACCCCCGGTCCTGG + Intronic
955543727 3:60005127-60005149 CTCACCCTCATCCCTGCTTCAGG + Intronic
959262404 3:104098699-104098721 CTCTATCACACCCCTGCTCCAGG - Intergenic
959514105 3:107246240-107246262 CTATCTCTCATTCCTGCTCCTGG - Intergenic
961305866 3:125958925-125958947 GTCCCTCCCAGCCCTACTCCTGG + Intergenic
961531185 3:127541432-127541454 GGTGCTCTCAGCCCTGCTGCAGG + Intergenic
962273885 3:133997966-133997988 CTAGCTCACAGCCTTGCTCACGG + Intronic
963328565 3:143889287-143889309 ATCACTCTCAGCCCTACTCAAGG + Intergenic
963489629 3:145983443-145983465 CTCTATCTCATCCCTGTTCCAGG - Intergenic
964635298 3:158851654-158851676 CACTCTCTCAGTCCTGCTCATGG + Intergenic
965921434 3:173920029-173920051 GTCTCTCTCAACCCTGCTCTGGG - Intronic
966240588 3:177751673-177751695 CCCTCTCTCAGCCCTGCCCAGGG - Intergenic
967061743 3:185878951-185878973 CTTGTTCTCTGCTCTGCTCCAGG + Intergenic
968621498 4:1605323-1605345 CTTCCTCACAGCCCAGCTCCAGG + Intergenic
968909376 4:3469710-3469732 CTTGGTCTCAGCCCTGGGCCTGG + Intronic
969666282 4:8559159-8559181 CTCGCCCACAGCCCTGCTGCGGG - Intronic
970196371 4:13554575-13554597 TTCGCTCTCACCCCAGCCCCTGG + Intergenic
971154714 4:24068976-24068998 TTCAATCTCAGCCCTACTCCTGG + Intergenic
972774765 4:42230643-42230665 CTCCCTTCCAGCCCTCCTCCTGG + Intergenic
974009264 4:56592593-56592615 CGCGCTCTCGGCCCCTCTCCTGG - Intronic
976114506 4:81712579-81712601 TCTGCTCTCAGCCTTGCTCCAGG - Intronic
978061644 4:104346040-104346062 CTCCCTCTCTGCTCTGCTCCTGG + Intergenic
981342189 4:143634493-143634515 CCCTCTCTCAGACCTGCTACTGG + Intronic
984575518 4:181443359-181443381 CTTGCTCACAGCCCTGCTCTTGG - Intergenic
985163589 4:187069582-187069604 CACCCTGGCAGCCCTGCTCCTGG + Intergenic
985532287 5:441114-441136 CTTGCACTCAGCAGTGCTCCTGG + Intergenic
987251894 5:16108635-16108657 CTCTCTCTCTCCCCTGCCCCAGG - Intronic
987875338 5:23674548-23674570 CCCACTCCCAGCACTGCTCCAGG + Intergenic
988725233 5:33920062-33920084 CCAGATCTCAGCCCTGCTCACGG - Intergenic
988785593 5:34563416-34563438 CTTCCTCTCCGCCCTGGTCCTGG + Intergenic
989694542 5:44184029-44184051 CAAGTTCTCAGCCCTGCTACCGG - Intergenic
989993754 5:50801584-50801606 CTCTCTGTCAGTCCTGCTACAGG + Intronic
995049028 5:107681475-107681497 CTCACTCACAGCCCAGGTCCAGG + Intergenic
996595747 5:125200778-125200800 TTCGCTCGCAGCCCTGCTGCGGG + Intergenic
997199593 5:132001807-132001829 CTCACCCTAAGCCCTGCTCAGGG + Intronic
997250550 5:132385694-132385716 CTTGCTCTCAGCCCTGTGCTGGG + Intronic
997694868 5:135852703-135852725 CACGCTGTCAGACCTGCTCCTGG + Exonic
1000046772 5:157528320-157528342 CTCCCTTTCAGCACTGCTGCTGG + Intronic
1001553420 5:172620425-172620447 CTGGCTCTCAGGCCTGTTGCGGG - Intergenic
1002324795 5:178397245-178397267 CTCCCCCTCAGCTCTGCCCCCGG - Intronic
1002415910 5:179121022-179121044 CTCTCTCTCAGCCCTGCGGCGGG + Intronic
1002851927 6:1003995-1004017 CTCGCTCGCCCGCCTGCTCCCGG + Intergenic
1004815996 6:19312316-19312338 CTCACTGTCAGCCCTGAGCCAGG - Intergenic
1005848778 6:29802946-29802968 CTCTCTCTCCCTCCTGCTCCAGG + Intergenic
1006153950 6:32004163-32004185 CTCCCTCTCAGTCCTGATCATGG + Intergenic
1006154385 6:32006434-32006456 CACCCGCTCAGCCCTGCTGCTGG + Intergenic
1006160257 6:32036900-32036922 CTCCCTCTCAGTCCTGATCATGG + Intergenic
1006160698 6:32039170-32039192 CACCCGCTCAGCCCTGCTGCTGG + Exonic
1006727530 6:36210633-36210655 CTCACCCTCAGCTTTGCTCCTGG - Intronic
1006738279 6:36290723-36290745 CTCCCTCTCAGACCTGGACCAGG + Intronic
1006808684 6:36806022-36806044 CTCAACCTCAGCCCTGCTCTGGG - Intronic
1007419432 6:41710822-41710844 CTCTCTGGAAGCCCTGCTCCAGG + Intronic
1007514785 6:42402409-42402431 CAGGCTCACAGCCCTGCACCCGG - Intronic
1007737594 6:43991170-43991192 TTGGCCCTCAGCCCTGCCCCAGG + Intergenic
1007777157 6:44230197-44230219 CCCCCTCCCAGCCCTGGTCCAGG - Intronic
1016840554 6:148520252-148520274 CTGTCTCTCAGCCTTGCTCAGGG - Intronic
1017402450 6:154079460-154079482 CTGGCTCTCAGAGCTGTTCCTGG - Intronic
1017682912 6:156882197-156882219 CTCCCTCTCAGCCTTGGTCCCGG + Intronic
1017953708 6:159160548-159160570 AGCCCTCTCAGGCCTGCTCCAGG - Intergenic
1018080921 6:160258796-160258818 GCCGCTCTCAGCCTCGCTCCGGG - Exonic
1018807454 6:167272310-167272332 TCTGCTCTCAGGCCTGCTCCCGG + Intronic
1019164769 6:170091048-170091070 CCTGCTCCCGGCCCTGCTCCCGG + Intergenic
1019164806 6:170091139-170091161 CCTGCTCCCTGCCCTGCTCCTGG + Intergenic
1019232923 6:170584162-170584184 CTCCCTCTCCGCGCTGCCCCAGG - Intronic
1019392685 7:797995-798017 CGTGCTCCCAGCCCTGCCCCGGG - Intergenic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1020037729 7:4974681-4974703 CTCGCTCCCTGCCCAGCGCCCGG - Intergenic
1020162093 7:5780946-5780968 CTCGCTCGCTGCCCAGCGCCCGG + Intronic
1021013538 7:15502559-15502581 CTCCCTCTCACCTCTTCTCCTGG + Intronic
1022650193 7:32267174-32267196 CTTGCACTCAGCCTTGCTCAGGG - Intronic
1023850200 7:44146101-44146123 CTCGCTCCCATCCCTGCTCTTGG + Intronic
1023981798 7:45074698-45074720 TTCACTCCCAGCCCTGCTCCTGG - Intronic
1024011407 7:45270062-45270084 CCTGCTCTCAGCCCTGCCCCTGG - Intergenic
1025081550 7:55987791-55987813 TTCCCTCTCTGCCCAGCTCCCGG - Intronic
1026805111 7:73424408-73424430 CCCGCTCTCTGCGCTGCTCGGGG - Intergenic
1027231346 7:76274425-76274447 CTAGGTCTCAAACCTGCTCCTGG - Intronic
1028316201 7:89405874-89405896 CTCCCTCTCAGCCCTTCAGCAGG + Intergenic
1028669413 7:93384063-93384085 CTCCCAATCAGCCCTGCCCCAGG + Intergenic
1028684154 7:93574545-93574567 CTCCCTCTCCGCCCCTCTCCTGG + Intronic
1029027663 7:97434280-97434302 CTCTCTCTCAGCCCAACTACAGG + Intergenic
1029199189 7:98827299-98827321 CCCCCTTCCAGCCCTGCTCCAGG + Intergenic
1029283665 7:99452184-99452206 CTGGCACTCAGCTCTGCTCCTGG - Intronic
1033423196 7:141220539-141220561 CTCCCTCCCACCCCTACTCCAGG - Intronic
1033816760 7:145083013-145083035 CAAGATCTCAGCCCTGCTCATGG - Intergenic
1033898642 7:146108250-146108272 CTCTCTCTCCTCCCTGTTCCTGG + Intergenic
1035040335 7:155922180-155922202 CTCCCTCTGGGCCTTGCTCCTGG + Intergenic
1035283890 7:157794172-157794194 CTCGTTCTCTGCCCTGACCCGGG + Intronic
1035318416 7:158012755-158012777 CTCTTTCTCATCCCTGCTCTTGG - Intronic
1035619376 8:1025969-1025991 CACCGTCTCAGCCCTGCTGCTGG - Intergenic
1036513497 8:9422081-9422103 CTCCACCTCGGCCCTGCTCCTGG + Intergenic
1036603075 8:10281287-10281309 CTCCCTCTCTGCCATTCTCCTGG + Intronic
1036703897 8:11032183-11032205 CTGGCTCTCAGCCCTGCGTCTGG - Intronic
1036706324 8:11049591-11049613 CTCGCTGCCAAGCCTGCTCCAGG - Intronic
1037575401 8:20197718-20197740 CTTGCCCTCAGCCCATCTCCTGG - Intronic
1039474766 8:37833898-37833920 CTCTCTCTCACTCCAGCTCCTGG + Intronic
1039901371 8:41755112-41755134 GTGGCTGTCAGCCCTGCTTCAGG - Intronic
1040417394 8:47207429-47207451 CTCTCTCCCAGGGCTGCTCCAGG + Intergenic
1041167052 8:55101626-55101648 CGCGCTCCCAGCCCTTCTCCAGG + Intergenic
1041361991 8:57064474-57064496 CTCACTCAAAACCCTGCTCCAGG - Intergenic
1041724399 8:61004704-61004726 CTCCCCCGCAGCCCTGCTGCCGG - Intergenic
1042382552 8:68134659-68134681 TTGGCTCTCAAGCCTGCTCCAGG - Intronic
1043982990 8:86662030-86662052 CACCCTCGCAGCCCTGCACCTGG - Intronic
1046819507 8:118620691-118620713 CTCCCTCTCCTCCCTGCCCCAGG - Intronic
1047230674 8:122995590-122995612 CTGGCCCTGAGCCCAGCTCCAGG - Intergenic
1049196531 8:141318754-141318776 CACACTCTGAGCCCTGATCCTGG - Intergenic
1049196537 8:141318802-141318824 CACACTCTGAGCCCTGATCCTGG - Intergenic
1049196648 8:141319445-141319467 CACACTCTGAGCCCTGATCCTGG - Intergenic
1049362282 8:142217898-142217920 CACACTCTGAGCCCTGATCCTGG - Intronic
1049362306 8:142218042-142218064 CACACTCTGAGCCCTGATCCTGG - Intronic
1049593257 8:143472084-143472106 CTTGCTCCCACCCCTGCCCCTGG - Intronic
1049622693 8:143605762-143605784 CTCGCAGCCCGCCCTGCTCCAGG + Exonic
1051331849 9:16031903-16031925 CTCAGTCTCTGCCCTGCTCTGGG - Intronic
1053282191 9:36827674-36827696 GTCGTCCTCAGCCCTGCTCTTGG - Intergenic
1053662484 9:40293339-40293361 CTGGCTCTGAGCCCACCTCCAGG + Intronic
1053785409 9:41649460-41649482 CTATGCCTCAGCCCTGCTCCAGG - Intergenic
1053912938 9:42923514-42923536 CTGGCTCTGAGCCCACCTCCAGG + Intergenic
1054159621 9:61664713-61664735 CTGTGCCTCAGCCCTGCTCCAGG + Intergenic
1054174134 9:61863412-61863434 CTACGCCTCAGCCCTGCTCCAGG - Intergenic
1054374613 9:64439564-64439586 CTGGCTCTGAGCCCACCTCCAGG + Intergenic
1054522127 9:66082945-66082967 CTGGCTCTGAGCCCACCTCCAGG - Intergenic
1054663403 9:67717369-67717391 CTACGCCTCAGCCCTGCTCCAGG + Intergenic
1054832979 9:69646678-69646700 CATGCTCTCAGCCCTGGTGCAGG - Intronic
1057304515 9:93904456-93904478 CTGGGGCTCAGCCCTGCTGCAGG - Intergenic
1058058441 9:100472866-100472888 CTCATTCCCAGCCCTGCTGCTGG + Intronic
1059401046 9:114070906-114070928 CTGGCTCGCAGCCCTGCCCAAGG - Intronic
1060187730 9:121574231-121574253 CTCCCTCTGAGGCCTCCTCCTGG + Intronic
1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG + Intronic
1061232063 9:129320843-129320865 CTCGCTCCCAGCCCTGCAGCCGG - Intergenic
1061385450 9:130286855-130286877 CTGCCACTCAGCCTTGCTCCTGG + Intronic
1061402634 9:130376686-130376708 CTGGCTCTCACCTCTGCTTCCGG + Intronic
1061811282 9:133163869-133163891 CCCGCTGCCTGCCCTGCTCCAGG - Exonic
1061885742 9:133590294-133590316 CTCGAACTGAGCCCAGCTCCTGG + Intergenic
1061996175 9:134187251-134187273 CTCGCTCCCAGGCCTGCTCTGGG - Intergenic
1062448554 9:136606011-136606033 CTGGCTCTCTGCCCTCCTCCCGG - Intergenic
1062719075 9:138025554-138025576 CTCGCTCTCAGCCCCAGTCAAGG - Intronic
1185786226 X:2893255-2893277 CTCTGTCTCGGTCCTGCTCCAGG + Intergenic
1186463284 X:9765379-9765401 CGCGCCCTCAGCCCTGCACCGGG + Intronic
1187188856 X:17013813-17013835 CCCTCTCCCAGCCCTGCTACAGG + Intronic
1187447609 X:19372902-19372924 TTACCTCTCAGCCCTTCTCCAGG - Intronic
1191846431 X:65550891-65550913 AGCGTCCTCAGCCCTGCTCCAGG + Intergenic
1195697760 X:107679300-107679322 CCCCATCTCAGCCCTGCTGCTGG - Intergenic
1201295627 Y:12460834-12460856 CCCACTCCCAGCCCTGCCCCAGG + Intergenic